ID: 1180616949

View in Genome Browser
Species Human (GRCh38)
Location 22:17134629-17134651
Sequence CAGCAAGTATATGTGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180616946_1180616949 3 Left 1180616946 22:17134603-17134625 CCATGGAGTAGTAGAAGACATAG No data
Right 1180616949 22:17134629-17134651 CAGCAAGTATATGTGGGTCATGG No data
1180616945_1180616949 19 Left 1180616945 22:17134587-17134609 CCAATATGGACAGAGTCCATGGA No data
Right 1180616949 22:17134629-17134651 CAGCAAGTATATGTGGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180616949 Original CRISPR CAGCAAGTATATGTGGGTCA TGG Intergenic
No off target data available for this crispr