ID: 1180617084

View in Genome Browser
Species Human (GRCh38)
Location 22:17135417-17135439
Sequence GGCCAGGGGCCTAGTTGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180617075_1180617084 8 Left 1180617075 22:17135386-17135408 CCATGAAGTGTGGCTGTAACAGC No data
Right 1180617084 22:17135417-17135439 GGCCAGGGGCCTAGTTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180617084 Original CRISPR GGCCAGGGGCCTAGTTGGGG CGG Intergenic
No off target data available for this crispr