ID: 1180618794

View in Genome Browser
Species Human (GRCh38)
Location 22:17146286-17146308
Sequence GAGGGCGCCACAGGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180618794_1180618798 -8 Left 1180618794 22:17146286-17146308 CCCTCCACACCTGTGGCGCCCTC 0: 1
1: 0
2: 0
3: 16
4: 209
Right 1180618798 22:17146301-17146323 GCGCCCTCCTGTGAGCTTACCGG 0: 4
1: 15
2: 7
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180618794 Original CRISPR GAGGGCGCCACAGGTGTGGA GGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900857849 1:5200373-5200395 GTGGGCGCCACAGGTTGGGGAGG - Intergenic
902076350 1:13789986-13790008 GAGGGCCTTGCAGGTGTGGATGG + Intronic
902132751 1:14277766-14277788 GAGGGAGCCACGGGTGTGAGGGG - Intergenic
903469429 1:23575566-23575588 GAGGGTGTCACAAGAGTGGAGGG - Intergenic
903576905 1:24344975-24344997 GGAGGGGGCACAGGTGTGGAGGG - Intronic
903576911 1:24344992-24345014 GGCGGAGGCACAGGTGTGGAGGG - Intronic
903576941 1:24345092-24345114 AAAGGGGGCACAGGTGTGGAGGG - Intronic
903576987 1:24345243-24345265 GGAGGGGGCACAGGTGTGGAGGG - Intronic
903576998 1:24345276-24345298 GGCGGAGGCACAGGTGTGGAGGG - Intronic
905037405 1:34927139-34927161 GAGGGCGCTACAGATGTCGCTGG - Intronic
905896064 1:41546504-41546526 GAGGAGCCCCCAGGTGTGGAGGG + Intronic
912949498 1:114111045-114111067 GAGGGAGCCCGAGGTGTTGAAGG - Intronic
913289800 1:117261635-117261657 CAGGGCACCACAGCTCTGGAGGG + Intergenic
914847668 1:151291774-151291796 AAGGGGGCCACAGGAGAGGAGGG + Exonic
915558408 1:156672995-156673017 GAGGGTGCCTGAGGTGTGGGGGG + Exonic
916097118 1:161361064-161361086 GATGGCGCCACTGGAGTGGCTGG + Intronic
916676285 1:167066617-167066639 ACGGGCCCCACATGTGTGGAAGG - Intronic
917132520 1:171757205-171757227 GAAGGGGCCTCAGGTGGGGAAGG - Intergenic
917238250 1:172917977-172917999 GAAGGCAATACAGGTGTGGAAGG - Intergenic
918109427 1:181442453-181442475 GTGGGGGACACAGGTGTGAAGGG + Intronic
919737623 1:200963058-200963080 GAGGGAGGAACAGGTGTGGAGGG + Intergenic
919990770 1:202707711-202707733 GAGGGCGGCACAGGCCTGGCGGG + Intronic
920494029 1:206441375-206441397 GAGGGGGCCGCGGGTGTGGATGG + Intronic
923046915 1:230362351-230362373 GAGGCAGCGACAGCTGTGGATGG - Intronic
1063115018 10:3067180-3067202 GGGAGCGCCACAGGTGGGGCAGG - Intronic
1067455872 10:46418868-46418890 GAGGGCTCCCCAGGTCTAGAGGG - Intergenic
1067631328 10:47965771-47965793 GAGGGCTCCCCAGGTCTAGAGGG + Intergenic
1068620627 10:59177175-59177197 AAGGGCGCCACGGTTGTGGACGG - Intronic
1069020847 10:63486826-63486848 GGGAATGCCACAGGTGTGGAAGG - Intergenic
1069991786 10:72320773-72320795 GAGGAGGCCACAGGTGTAGCTGG - Intergenic
1070636663 10:78134139-78134161 GAGAGGGCCACTGCTGTGGATGG + Intergenic
1075148349 10:119902838-119902860 GAGGGAGCCCCAGGTCTGGCAGG - Exonic
1075461810 10:122621386-122621408 GAGGGAGCCCCAGGTCTTGAAGG - Intronic
1076015627 10:127025386-127025408 CAGGTCACCACAGCTGTGGAAGG + Intronic
1076589660 10:131574436-131574458 GAGGCTGGCACAGATGTGGACGG - Intergenic
1077229994 11:1454419-1454441 GAGGGAGGCAGGGGTGTGGACGG + Intronic
1077402744 11:2367184-2367206 GAGAGAGCCACAGCTGTAGAGGG - Intergenic
1077669750 11:4146550-4146572 GTGGGAGCCACACGTGTGTAAGG + Intergenic
1078142716 11:8703447-8703469 GGGGGAGTCACAGGGGTGGAAGG + Intronic
1081614667 11:44583542-44583564 GCAGGCGGCAGAGGTGTGGAAGG + Intronic
1082115682 11:48325722-48325744 GTGGGCTCCACAGGTGGAGAGGG - Exonic
1082257993 11:50053596-50053618 GTGGGCTCCACAGGTGGAGAGGG + Intergenic
1082628262 11:55510439-55510461 GTGGGAGCCACAGGTGGAGAGGG - Intergenic
1082640290 11:55651604-55651626 GTGGGAGCCACAGGTGGAGAGGG - Exonic
1082717300 11:56629649-56629671 GTGGGAGCCACAGGTGGAGAAGG - Intergenic
1083092049 11:60209916-60209938 GAGGCCGCTACAGCTGTTGAAGG - Intronic
1085036313 11:73302350-73302372 GAAGGAGCCACAGACGTGGAGGG + Intergenic
1085720633 11:78909624-78909646 GGGAGCACCACAGGTATGGAGGG + Intronic
1089305655 11:117524742-117524764 GAGGGCGCCTCAGGGGTCGGGGG - Intronic
1089377419 11:118004472-118004494 AAGGGAGACAGAGGTGTGGAGGG + Intergenic
1090851732 11:130576591-130576613 GAGAGTGAGACAGGTGTGGATGG + Intergenic
1091203446 11:133800526-133800548 GAGGGGGTGACAGGTGAGGAAGG + Intergenic
1091214627 11:133893159-133893181 GAAGGGGCCTCAGGTGTGAAGGG + Intergenic
1099116643 12:78634413-78634435 GATGGAGCCAGAGGTGTAGAAGG - Intergenic
1101400482 12:104382610-104382632 GAGGGCACCATAGCTGTGGGTGG - Intergenic
1103397899 12:120622122-120622144 GAGGGAGCCCCAGGTGGGGTGGG + Intergenic
1103528257 12:121581542-121581564 CAGGGCGCCACAGCTGGGGCTGG - Intergenic
1103901293 12:124304798-124304820 GAGGACGACACCAGTGTGGAAGG - Intronic
1103951981 12:124556241-124556263 GAGGGGGCCACAGGTGAGGGAGG + Intronic
1113643480 13:111975738-111975760 GTGTGCACCACACGTGTGGAGGG + Intergenic
1113825169 13:113247087-113247109 GAGGGCGCAACAGGTGGTGGGGG + Intronic
1114327284 14:21602080-21602102 GTGGGAGCCACAGGTGGAGAAGG + Intergenic
1114330680 14:21634096-21634118 GTGGGAGCCACAGGTGGAGAAGG + Exonic
1115788687 14:36855475-36855497 GAGGAAGCCACAGATGAGGAAGG - Intronic
1115961483 14:38838663-38838685 CAGGGCGAGACAGGCGTGGAAGG - Intergenic
1116984321 14:51203551-51203573 GAGGGCCCCACAGCTGTTGCTGG - Intergenic
1118535803 14:66763087-66763109 GAGGAACCCACAGATGTGGACGG - Intronic
1119738742 14:77000258-77000280 GAGGGAGGCACAGGGGTGGGTGG + Intergenic
1122815654 14:104310839-104310861 TAGGGGGCCCCAGGGGTGGATGG + Intergenic
1123097689 14:105774182-105774204 GAGGCAGCCACAGGTGCGCAGGG - Intergenic
1123390556 15:19867073-19867095 GAAGTACCCACAGGTGTGGAGGG + Intergenic
1124060998 15:26293720-26293742 GATGGTGCCACTGGAGTGGAGGG + Intergenic
1124165265 15:27320394-27320416 TAGGGCTCCAGAGGTGTGGGTGG + Intronic
1127118771 15:55753280-55753302 GAGGAGGACACAGGTTTGGAGGG + Intergenic
1128114169 15:65094982-65095004 TAGGGGTGCACAGGTGTGGACGG - Intronic
1130371025 15:83285074-83285096 GAGGGCGCCCCAGGGTAGGAGGG - Intergenic
1131073493 15:89480361-89480383 GTAGGCGCCAAATGTGTGGATGG + Exonic
1132337120 15:101055146-101055168 GAGGGCGCCCTAGGCGTGGAGGG + Exonic
1132688408 16:1171758-1171780 GAGGGTGGCAAAGTTGTGGACGG - Intronic
1132844640 16:1994344-1994366 CAGGGCCCCACAGGAGGGGACGG + Intergenic
1133067135 16:3216317-3216339 GTGGGAGCCACAGGTGGAGAAGG - Intergenic
1133246190 16:4450443-4450465 GAGGACGAGACAGATGTGGAGGG + Exonic
1135303025 16:21347130-21347152 GTGGGGGCAACAGGTGTGAACGG - Intergenic
1137367993 16:47877405-47877427 GATGAGGCCACAGGTGTGGAAGG - Intergenic
1141735520 16:85849832-85849854 GAGGGAGAAACAGGCGTGGACGG - Intergenic
1141763118 16:86042065-86042087 GATGGCGTCACAGGTTTGCAGGG + Intergenic
1141858952 16:86703743-86703765 GCGGGCTCCACACGCGTGGAAGG - Intergenic
1142061496 16:88033084-88033106 GTGGGGGCAACAGGTGTGAACGG - Intronic
1142245493 16:88968350-88968372 GAGAGCCCCCCAGGTGGGGACGG + Intronic
1142267626 16:89071801-89071823 GGGGGCGGCAGAGGTGCGGAGGG - Intergenic
1142922151 17:3198225-3198247 GTGGGAGCCACAGGTGCAGAAGG - Exonic
1143316122 17:6034787-6034809 GAGGGAGCCACAGGTGAGCATGG + Intronic
1143983849 17:10894336-10894358 AAGGGAGGCACAGCTGTGGAAGG - Intergenic
1146884450 17:36461858-36461880 GAGGGCCCAGCAGGTGTGGCCGG + Intergenic
1146927844 17:36757329-36757351 GAGGGGGCCCCAGGTCTGGCAGG + Intergenic
1147968457 17:44206865-44206887 GATTGGGCCGCAGGTGTGGAGGG + Exonic
1148041231 17:44708974-44708996 GAAGGAGCCACAGGAGTTGAGGG + Intronic
1151521333 17:74632450-74632472 TAGGGCACCACAGGTGCGGTGGG + Intergenic
1151932424 17:77241080-77241102 GTGGGGGGCGCAGGTGTGGAAGG + Intergenic
1153911466 18:9709019-9709041 GAGGGCGCGGCCGGGGTGGAAGG + Intronic
1154530842 18:15343763-15343785 GAAGTACCCACAGGTGTGGAGGG - Intergenic
1158118107 18:54019128-54019150 GAGGGAGCCACAGGGCTGCAGGG - Intergenic
1159049563 18:63406919-63406941 AAGGGCTTTACAGGTGTGGATGG + Intronic
1160306855 18:77747975-77747997 GAGGGCTCCAGTGGTGTGGAAGG + Intergenic
1160483769 18:79269139-79269161 CAGGACGCGACAGGTGGGGACGG - Intronic
1160508869 18:79442260-79442282 GAGGGGCCCACAGGTGTGGCCGG + Intronic
1161304210 19:3557792-3557814 GAGCGCGCCGCAGGAGTGGCCGG + Intronic
1161329529 19:3679636-3679658 GAGGGGTCCTCAGCTGTGGAGGG + Intronic
1161808257 19:6457596-6457618 GAGGGGGCCGGAGGTGGGGAAGG + Intronic
1165331140 19:35141616-35141638 GAGGGCGCCGCGGGTGAGGCGGG + Intronic
1166782197 19:45348618-45348640 GGGGGCGCCCCAGGAATGGAGGG - Intronic
1168000818 19:53444724-53444746 GAAATAGCCACAGGTGTGGAGGG + Intronic
925070868 2:965571-965593 GAGGGGGCCACAGAGGAGGAGGG - Intronic
925211393 2:2050513-2050535 GGAGGCGCCACAGGTGTTCACGG + Intronic
927207080 2:20617494-20617516 CAGGGCGCCACAGCTGGAGAGGG + Intronic
927516072 2:23672318-23672340 GAAGGAGCCACTGGAGTGGACGG - Intronic
928170311 2:28999156-28999178 GAGGGGGACAGAGGTGTGAATGG - Intronic
929097594 2:38278722-38278744 GAAGCACCCACAGGTGTGGAGGG + Intergenic
935373845 2:102375406-102375428 GAGGGTGTCAAAGGTGTGGGTGG + Intronic
936600480 2:113890168-113890190 GAAGGCGGCCCAGCTGTGGATGG + Exonic
937970099 2:127542591-127542613 GAAGCACCCACAGGTGTGGAGGG - Intronic
938251170 2:129816916-129816938 GAGGGCACAACAGGACTGGAAGG + Intergenic
944457697 2:199911936-199911958 AAGGGCGCCAAGGGCGTGGAAGG - Intronic
945036072 2:205704944-205704966 GTGGGAGCTCCAGGTGTGGAGGG + Intronic
946895511 2:224319569-224319591 GAGGGAGCCGGAGGTGGGGAGGG - Intergenic
948207897 2:236172655-236172677 GAGGGCGGCGCAGGTGTGAAGGG - Intergenic
949080034 2:242089022-242089044 GCGGGCGCGTCAGGTGGGGACGG + Intergenic
1171134332 20:22683491-22683513 GAGGGCTCAAAAGGTGAGGAGGG - Intergenic
1171249856 20:23638704-23638726 AAGGGGGGCATAGGTGTGGAAGG - Intergenic
1175132802 20:56802161-56802183 GAGATCGCCACAGCTCTGGACGG - Intergenic
1175704680 20:61167991-61168013 GAGGGAGCTACAGGTGCTGAGGG + Intergenic
1176766567 21:13024701-13024723 GAAGTACCCACAGGTGTGGAGGG + Intergenic
1177999158 21:28139731-28139753 GAGGAAGCCACAGGTTTAGAAGG + Intergenic
1178415858 21:32404623-32404645 GAGTGGGCCAGAGGTGGGGAGGG + Intergenic
1179993500 21:44960691-44960713 GAGGGAGCCACAGGCCTGAAAGG - Intronic
1180049650 21:45325370-45325392 GGCTGGGCCACAGGTGTGGACGG - Intergenic
1180513693 22:16119149-16119171 GAAGTACCCACAGGTGTGGAGGG + Intergenic
1180618794 22:17146286-17146308 GAGGGCGCCACAGGTGTGGAGGG - Intronic
1180785820 22:18547155-18547177 GAGGGTGCCAGAGGTAGGGACGG - Intergenic
1180959488 22:19756156-19756178 GAGGGAGCCACGTGTGTGCAGGG + Intergenic
1181131102 22:20732880-20732902 GAGGGTGCCAGAGGTAGGGACGG - Intronic
1181242745 22:21486709-21486731 GAGGGTGCCAGAGGTAGGGACGG - Intergenic
1181277052 22:21693924-21693946 GAGGAGGCCTCAGGTGGGGAAGG - Intronic
1181313290 22:21956956-21956978 GAGGGCCCCACAGGTGCCCAGGG + Intergenic
1181346395 22:22223028-22223050 GAGGGCCCCACAGGTGCCCAGGG + Intergenic
1183378420 22:37478592-37478614 GAGGGTGCCCCAGGAGGGGAAGG + Intronic
1183674265 22:39290950-39290972 GAGGCAGCCGCCGGTGTGGATGG + Intergenic
1184695204 22:46135128-46135150 GAGGTGGTCACTGGTGTGGAGGG + Intergenic
1184970577 22:48017042-48017064 GAGTGAGCCACACGTGTGGGTGG - Intergenic
1185304100 22:50103027-50103049 GAGCGGGTCACAGGTGTGGCGGG + Intronic
950306088 3:11916049-11916071 GAGGGGACCACAGGTGGGGCTGG - Intergenic
950416112 3:12869778-12869800 GAAGGGGCCACAGGTGGGGCTGG - Intronic
952852212 3:37738725-37738747 CAGGCTGCCTCAGGTGTGGAAGG - Intronic
953913013 3:46902262-46902284 GAGGGCTCCACAGGTGCGAAGGG + Intronic
954693754 3:52409832-52409854 GAGAGCGACCCAGGTGAGGAGGG - Exonic
957039574 3:75327061-75327083 GAGAGCCCCACAGGGGTGGCAGG + Intergenic
957188422 3:76973899-76973921 GATGGGGACACAGGTGGGGATGG + Intronic
958858810 3:99420248-99420270 GAAAGACCCACAGGTGTGGAGGG + Intergenic
959737443 3:109676109-109676131 GAGGGCTGAACAGGTGTGGAAGG - Intergenic
963049383 3:141128319-141128341 CAGGGCGTGACAGGTGTGGGTGG + Intronic
963238171 3:142975575-142975597 GAGTCAGCCTCAGGTGTGGAGGG + Intronic
967471358 3:189865526-189865548 GAGGGTGCCAAAGGTGTTGGGGG + Intronic
968563299 4:1296150-1296172 GAGGGGGGCACAGGTGCGGGTGG - Intronic
968563356 4:1296351-1296373 GAGGGGGGCACAGGTGCGGGTGG - Intronic
968734132 4:2286360-2286382 GAGGGGGCATCAGGCGTGGACGG + Intronic
977445290 4:97124018-97124040 GATGGGGCCCCAGGGGTGGAGGG - Intergenic
977749462 4:100591636-100591658 GAGGGAGCCACATGTGTGCAGGG + Intronic
978995192 4:115142922-115142944 GAGGGCGCGGTAGGTGAGGAAGG + Intergenic
983252757 4:165363344-165363366 GAGGGCCCAAGAGGTATGGAGGG - Intronic
984011831 4:174380950-174380972 GAGAAGCCCACAGGTGTGGAGGG + Intergenic
993520122 5:88889722-88889744 GAGGGCGCAACGGCTGTGGGTGG + Intronic
997554428 5:134783118-134783140 CAGGGAGACACTGGTGTGGAAGG - Intronic
998553670 5:143102249-143102271 GAGGGAGCCCCAGGCCTGGAAGG - Intronic
999195625 5:149779728-149779750 GAGGAGGCCACAGGTGTGCTGGG + Intronic
999288165 5:150406714-150406736 TCGGGCTCCCCAGGTGTGGAGGG - Intronic
1001317822 5:170656835-170656857 GAGGGAGCCACAGGTCAGCAAGG + Intronic
1001473831 5:172035268-172035290 AAGAGAGCCTCAGGTGTGGACGG + Intergenic
1001957964 5:175861333-175861355 GGGCGCCCCAGAGGTGTGGAGGG + Intronic
1001974771 5:175988534-175988556 GAGGGCGCCTGGGATGTGGATGG - Intronic
1002100559 5:176855603-176855625 GAAGACGCCGCCGGTGTGGAGGG + Intronic
1002242663 5:177855244-177855266 GAGGGCGCCTGGGATGTGGATGG + Intergenic
1002382232 5:178839196-178839218 GAGGATGCCACAGATCTGGAGGG + Intergenic
1003220944 6:4160570-4160592 CAGGACGGCACAGGTGAGGAGGG + Intergenic
1006449121 6:34095849-34095871 GGGGCCGCCACAGGTGGGCAGGG + Intronic
1006834226 6:36986770-36986792 GAAGGCTCCACAGCTGGGGAGGG - Intergenic
1007572412 6:42902649-42902671 GAGATACCCACAGGTGTGGAGGG - Intergenic
1008541204 6:52547730-52547752 CAGGGTGCCAAAGGGGTGGAGGG + Intronic
1019111993 6:169724158-169724180 GAGGGCGCCAAAGGCTGGGAGGG + Intronic
1020017155 7:4837906-4837928 AAGGCCGCCACAGATGGGGATGG - Intronic
1028757204 7:94451416-94451438 GATGGTGCCACAGCTGTGTAGGG - Intergenic
1028918546 7:96286406-96286428 CAGAGTGCCACAGGTGTGGAGGG - Intronic
1033212204 7:139468335-139468357 GAAAGACCCACAGGTGTGGAGGG + Intronic
1033482035 7:141752065-141752087 GAAACAGCCACAGGTGTGGAGGG + Intronic
1034459615 7:151191287-151191309 GAGAGGGCTGCAGGTGTGGAGGG - Intronic
1035167574 7:157000542-157000564 GAGTGCGCCCCAGGCTTGGAGGG - Intronic
1035538083 8:407315-407337 GCGGGCGCGTCAGGTGGGGACGG + Intronic
1036782610 8:11659784-11659806 GTGGGGACCACAGGTCTGGAAGG - Intergenic
1037131331 8:15411064-15411086 GTGGGGGCCTCAGGAGTGGATGG - Intergenic
1044771585 8:95641201-95641223 TAGGAAGCCACAGCTGTGGAGGG - Intergenic
1049316258 8:141970210-141970232 GAGTGAGCCACAGGGGTGGGGGG - Intergenic
1049613496 8:143566716-143566738 GAGGGCACAGCAGGTGTGGCCGG + Exonic
1051890098 9:21932549-21932571 GATGGGGCCACAGGAGTGGTTGG - Intronic
1053470040 9:38339888-38339910 AGGGGGGCCACAGGTGTGGATGG + Intergenic
1053708543 9:40781507-40781529 GAAGAACCCACAGGTGTGGAGGG - Intergenic
1054418454 9:64902302-64902324 GAAGTACCCACAGGTGTGGAGGG - Intergenic
1056854175 9:90110851-90110873 GAGGGCTCCACCCCTGTGGATGG + Intergenic
1057429334 9:94979893-94979915 GAGGGAGCCACAGGCGTGTCAGG - Intronic
1060855947 9:126915070-126915092 GAGGGAGCTGCAGGTGTGGGGGG + Intronic
1061155352 9:128857419-128857441 GAGATACCCACAGGTGTGGAGGG + Intronic
1061882994 9:133577335-133577357 GAGGAAGCCAGAGGTGTGGGCGG + Intergenic
1062103523 9:134740409-134740431 GATGGGTCCACAGGTGTGGCTGG + Intronic
1062215090 9:135384697-135384719 GAGGGCCCTTCAGGTGGGGAGGG - Intergenic
1062475187 9:136723207-136723229 GTGGGCGCAACAGGGGTGGAAGG - Exonic
1062515812 9:136934964-136934986 GAGGGTGCAACACTTGTGGATGG + Intronic
1185791035 X:2928572-2928594 GAGGGCGTCACAGCTGTGCTCGG + Intronic
1187287096 X:17916010-17916032 GAGGGGCCTACAGGTGTGGCTGG + Intergenic
1190256935 X:48770518-48770540 GATGGGGGCAGAGGTGTGGATGG - Intronic
1192153770 X:68727970-68727992 GTGGGCCCCAGTGGTGTGGATGG + Intergenic
1192159330 X:68771206-68771228 GAGGGCGGCCCAGCTGTGTATGG + Intergenic
1192196869 X:69034389-69034411 GGGGGGGCCACATGTGTGTATGG + Intergenic
1192502755 X:71664440-71664462 TAGGGGGCCACAGGTGCAGATGG - Intergenic
1192504017 X:71670065-71670087 TAGGGGGCCACAGGTGCAGATGG + Intergenic
1192529089 X:71870944-71870966 TAGGGGGCCACAGGTGCAGATGG - Intergenic
1192531486 X:71891015-71891037 GAGGTTGCCAGGGGTGTGGAGGG - Intergenic
1196293556 X:113973503-113973525 GAAGGCCACACAGGTGTGCAAGG - Intergenic