ID: 1180621632

View in Genome Browser
Species Human (GRCh38)
Location 22:17166472-17166494
Sequence CTGTGGTTCTTGCCTTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180621632_1180621637 20 Left 1180621632 22:17166472-17166494 CCTTCTGAAGGCAAGAACCACAG No data
Right 1180621637 22:17166515-17166537 AGGTGAGCTCATTCCCTCTGTGG No data
1180621632_1180621636 0 Left 1180621632 22:17166472-17166494 CCTTCTGAAGGCAAGAACCACAG No data
Right 1180621636 22:17166495-17166517 GGAGAACAGAGAATGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180621632 Original CRISPR CTGTGGTTCTTGCCTTCAGA AGG (reversed) Intergenic
No off target data available for this crispr