ID: 1180626779

View in Genome Browser
Species Human (GRCh38)
Location 22:17199024-17199046
Sequence TGCCCCCCATTAGCCAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180626779_1180626783 18 Left 1180626779 22:17199024-17199046 CCAACTCTGGCTAATGGGGGGCA No data
Right 1180626783 22:17199065-17199087 GTGGCAAAAGCCTTTGTTCCAGG No data
1180626779_1180626784 19 Left 1180626779 22:17199024-17199046 CCAACTCTGGCTAATGGGGGGCA No data
Right 1180626784 22:17199066-17199088 TGGCAAAAGCCTTTGTTCCAGGG No data
1180626779_1180626780 -1 Left 1180626779 22:17199024-17199046 CCAACTCTGGCTAATGGGGGGCA No data
Right 1180626780 22:17199046-17199068 ATTAAGACCTAGACTCTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180626779 Original CRISPR TGCCCCCCATTAGCCAGAGT TGG (reversed) Intronic