ID: 1180629019

View in Genome Browser
Species Human (GRCh38)
Location 22:17214512-17214534
Sequence CAGGATCAGATGGACTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180629016_1180629019 -9 Left 1180629016 22:17214498-17214520 CCAGCTGTCTTCTCCAGGATCAG 0: 1
1: 1
2: 4
3: 30
4: 272
Right 1180629019 22:17214512-17214534 CAGGATCAGATGGACTCCAGAGG 0: 1
1: 0
2: 2
3: 21
4: 242
1180629012_1180629019 20 Left 1180629012 22:17214469-17214491 CCGAGTTGCATCTAACGCTCTGA No data
Right 1180629019 22:17214512-17214534 CAGGATCAGATGGACTCCAGAGG 0: 1
1: 0
2: 2
3: 21
4: 242
1180629015_1180629019 -5 Left 1180629015 22:17214494-17214516 CCAGCCAGCTGTCTTCTCCAGGA 0: 1
1: 1
2: 4
3: 29
4: 515
Right 1180629019 22:17214512-17214534 CAGGATCAGATGGACTCCAGAGG 0: 1
1: 0
2: 2
3: 21
4: 242
1180629010_1180629019 22 Left 1180629010 22:17214467-17214489 CCCCGAGTTGCATCTAACGCTCT 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1180629019 22:17214512-17214534 CAGGATCAGATGGACTCCAGAGG 0: 1
1: 0
2: 2
3: 21
4: 242
1180629011_1180629019 21 Left 1180629011 22:17214468-17214490 CCCGAGTTGCATCTAACGCTCTG 0: 1
1: 1
2: 0
3: 3
4: 44
Right 1180629019 22:17214512-17214534 CAGGATCAGATGGACTCCAGAGG 0: 1
1: 0
2: 2
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180629019 Original CRISPR CAGGATCAGATGGACTCCAG AGG Intronic
900383460 1:2397501-2397523 CAGGGTCGGAGGGACACCAGCGG - Intronic
903344757 1:22677141-22677163 CAGGAGCAGATGGGCCGCAGTGG - Intergenic
903672701 1:25046018-25046040 CTGGACCAGCTGGACTCCTGTGG - Intergenic
904120691 1:28195874-28195896 CAGGCTTGGAAGGACTCCAGAGG + Intergenic
905809312 1:40900166-40900188 AAGGATCACCTGGGCTCCAGTGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
910346861 1:86248694-86248716 CAGGAACACATGTACTACAGAGG + Intergenic
910572356 1:88720121-88720143 GAGGATCAGCTGAACCCCAGAGG - Intronic
910760519 1:90727245-90727267 CAGTGTCAGATTCACTCCAGCGG - Intergenic
910975651 1:92902698-92902720 CAGGATCAGCTGGAAACCAGGGG - Intronic
911585536 1:99685889-99685911 CAGATTCAAATGAACTCCAGGGG - Intronic
912137358 1:106678113-106678135 CAGAATAAGATAAACTCCAGGGG + Intergenic
912231779 1:107801734-107801756 CAGATTCAGAGAGACTCCAGGGG - Intronic
912775355 1:112503190-112503212 CAGTATCCCAGGGACTCCAGTGG - Intronic
913317816 1:117567333-117567355 AAGGAAGAGATGGAGTCCAGTGG + Intergenic
913945814 1:125163706-125163728 CATCATCAAATGGACTCAAGTGG - Intergenic
913983019 1:143540895-143540917 CATCATCAAATGGACTCCAATGG - Intergenic
916889733 1:169104319-169104341 CAGGTTCAGATGAAGTCCTGAGG - Intergenic
919329770 1:196156763-196156785 CAGATTCAGAGAGACTCCAGGGG + Intergenic
921664648 1:217853996-217854018 CAGATTCAGAGAGACTCCAGGGG + Intronic
922527377 1:226315599-226315621 CAGATTCAGAGAGACTCCAGGGG - Intergenic
923983198 1:239349921-239349943 CAGGATCACTTGAATTCCAGAGG + Intergenic
1062987239 10:1780189-1780211 CCGGAAGACATGGACTCCAGAGG + Intergenic
1062987253 10:1780247-1780269 CGGGAAGACATGGACTCCAGAGG + Intergenic
1062987279 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG + Intergenic
1062987293 10:1780418-1780440 CCGGAAGACATGGACTCCAGAGG + Intergenic
1063264896 10:4436674-4436696 AAGGATCAGATGGACTTGGGAGG - Intergenic
1063434823 10:6021285-6021307 CCAGATCAGATGGACTCTAAGGG - Intronic
1063492105 10:6473521-6473543 CAGGATCAGAACGCCGCCAGAGG + Intronic
1063893030 10:10649866-10649888 GAGGAACAGCTGCACTCCAGGGG - Intergenic
1064350709 10:14573652-14573674 GAGAATCACATGGACCCCAGAGG + Intronic
1065909969 10:30294222-30294244 CAGATTCAGAGAGACTCCAGGGG - Intergenic
1066663425 10:37759028-37759050 AAGGATCAGATGGACTCCCTTGG + Intergenic
1066742176 10:38527737-38527759 CAGAATGGGATGGACTCCAATGG + Intergenic
1066936354 10:41843161-41843183 CATGATCAAATGGAATCCAATGG - Intergenic
1069176349 10:65293574-65293596 CAGATTCAGAGAGACTCCAGGGG - Intergenic
1070250498 10:74768817-74768839 CAGATTCAGAGTGACTCCAGGGG + Intergenic
1070818929 10:79343508-79343530 AAAGACCAGCTGGACTCCAGAGG + Intergenic
1071016449 10:81002486-81002508 CAGGCTCAGATGGACCTCTGAGG + Intergenic
1071059710 10:81555075-81555097 GAGGATCACTTGGGCTCCAGAGG + Intergenic
1072257855 10:93638044-93638066 CAGGATTTCATGGATTCCAGAGG - Intronic
1075268555 10:121027576-121027598 AAAGATCAGATGGTTTCCAGTGG - Intergenic
1075848667 10:125568029-125568051 GAGGGACAGCTGGACTCCAGGGG + Intergenic
1076225108 10:128768297-128768319 CAGGAGCAGAAGTACCCCAGAGG + Intergenic
1076410224 10:130244146-130244168 CAGGAGCTGATGGTCTGCAGAGG + Intergenic
1076934744 10:133559820-133559842 CTGGATCTAATGGACTGCAGTGG + Intronic
1077190629 11:1254677-1254699 CAGGATCTGGGGGAATCCAGGGG - Exonic
1077305192 11:1865785-1865807 CAGGATCCGAAGGACCCCACGGG - Intronic
1077884349 11:6375181-6375203 CAGATTCAGAGAGACTCCAGCGG + Intergenic
1078991351 11:16649371-16649393 AAGCATCAGGTGGACTACAGAGG + Intronic
1080809888 11:35693026-35693048 CAGATTCAGAGAGACTCCAGGGG + Intronic
1081482891 11:43505605-43505627 CAGATTCAGAGAGACTCCAGGGG + Intergenic
1083519589 11:63296012-63296034 CAGGACAGGATGCACTCCAGAGG + Intronic
1085754940 11:79194493-79194515 CAGGCTGAGGTGGTCTCCAGTGG + Intronic
1086573016 11:88306594-88306616 CAGGAACAAGTGGACTCCAGGGG + Intronic
1090461110 11:126892287-126892309 CAGAAGCTGAGGGACTCCAGGGG + Intronic
1091379580 12:47826-47848 CACGATGAGATCTACTCCAGAGG - Intergenic
1091713367 12:2758826-2758848 AAGGATAAAATGGACTTCAGGGG + Intergenic
1092456593 12:8649367-8649389 CAGGAGCTGATGGACTCTAAGGG + Intronic
1093156177 12:15688644-15688666 CAGGGGCAGCCGGACTCCAGGGG + Intronic
1101473235 12:105018961-105018983 CAGGGACAGCTGGACTCCGGGGG - Intronic
1102486229 12:113259496-113259518 CAGGCACAGCTGGATTCCAGAGG + Intronic
1103537262 12:121641584-121641606 CAGGACCAGCTGGACCACAGAGG + Exonic
1104188794 12:126458081-126458103 CTGGATGAGATGAACTCCAGAGG - Intergenic
1106931896 13:34675340-34675362 CAGATTCAGAGAGACTCCAGGGG - Intergenic
1108181709 13:47846446-47846468 GAGGATCAGATGGATCCCTGGGG - Intergenic
1109013524 13:56979520-56979542 CAGATTCAGAGAGACTCCAGGGG - Intergenic
1110199972 13:72838493-72838515 CAGATTCAGAGAGACTCCAGGGG + Intronic
1111923071 13:94432738-94432760 CAGATTCAGAAAGACTCCAGGGG - Intergenic
1113890642 13:113733386-113733408 CAAGATCAAATGGAGGCCAGTGG + Intronic
1114574475 14:23699888-23699910 CAGGGACAGCTGGACTCTAGGGG - Intergenic
1115203282 14:30875257-30875279 CAGGAGCAGATCGGCTGCAGGGG - Intronic
1115498907 14:34032249-34032271 CAGGATAAGATTAACTTCAGGGG + Intronic
1116657644 14:47673108-47673130 GAGGAGCAGATGGAGTGCAGTGG + Intronic
1119768565 14:77206054-77206076 CAGGCTCAGAGGTAATCCAGAGG + Intronic
1122581734 14:102775993-102776015 CAGGGACCTATGGACTCCAGCGG - Intergenic
1202874025 14_GL000225v1_random:191729-191751 CAGAATGGAATGGACTCCAGTGG + Intergenic
1125233535 15:37484755-37484777 CAGGATGAGATGGTCTCAGGTGG - Intergenic
1127256151 15:57295602-57295624 GAGAATCACCTGGACTCCAGAGG + Intronic
1128292642 15:66489864-66489886 CAGGCTCAGCTGGACCACAGTGG - Intronic
1128327676 15:66735650-66735672 CAGGCTGAGCTGGACTCCAGTGG - Intronic
1129017667 15:72482928-72482950 GAGGATCACTTGGACTCAAGAGG - Intronic
1134183941 16:12068451-12068473 CAGGCTGAGATGGAGTGCAGTGG - Intronic
1134459896 16:14421841-14421863 CGGGACAAGATGGACTCCTGAGG - Intergenic
1136353318 16:29726730-29726752 GAGAATCAGTTGAACTCCAGAGG - Intergenic
1136904786 16:34078502-34078524 CATCATCAGATGGACTCAAATGG + Intergenic
1136905102 16:34082216-34082238 CATCATCAGATGGACTCAAATGG + Intergenic
1136940756 16:34574379-34574401 CATTATCAAATGGAGTCCAGAGG + Intergenic
1136941451 16:34587996-34588018 CATCATCAAATGGAGTCCAGAGG + Intergenic
1136941947 16:34594392-34594414 CATGATCAGATGGAATCAAATGG - Intergenic
1136950459 16:34711447-34711469 AATCATCAGATGGACTCCAATGG - Intergenic
1136951778 16:34728855-34728877 CATCATCAAATGGATTCCAGAGG - Intergenic
1137215965 16:46390941-46390963 CATCATCAAATGGAGTCCAGAGG + Intergenic
1137215977 16:46391099-46391121 CATCATCAAATGGAGTCCAGAGG + Intergenic
1137456230 16:48619990-48620012 CAGGGTCAGGTGGTCTCAAGAGG - Intronic
1140019271 16:71222068-71222090 TAGGCTCAGAAAGACTCCAGTGG - Intronic
1140513863 16:75528635-75528657 GAGAATCACTTGGACTCCAGAGG - Exonic
1140930624 16:79624484-79624506 GAGCATCAGATAGACTTCAGAGG - Intergenic
1143199207 17:5100501-5100523 CAGGATGCCATGGGCTCCAGGGG - Intergenic
1144653576 17:17021604-17021626 CAGCTTCAGATGGAGCCCAGAGG - Intergenic
1146096367 17:29933634-29933656 AAGGGTTAAATGGACTCCAGTGG - Intronic
1148385731 17:47233332-47233354 CAGGTTCTGATGGCCTCCACTGG + Intergenic
1152123960 17:78435273-78435295 CCGGATCGGATGGACTCTGGAGG - Intronic
1152216529 17:79035901-79035923 CTGTATCAGATGCCCTCCAGGGG - Intronic
1152536245 17:80951771-80951793 CTGGTTCAGATGGACACCTGAGG + Intronic
1153174887 18:2359786-2359808 CAGATTCAGAAAGACTCCAGGGG - Intergenic
1155785515 18:29894858-29894880 CAGTATCAAATGAACTTCAGAGG + Intergenic
1155859704 18:30881442-30881464 CAGGATTGGATGGAGTGCAGTGG - Intergenic
1155902603 18:31409787-31409809 CAGGATCGGATGGATTCCTCTGG + Intronic
1157714884 18:49877607-49877629 CAGGATCACTTGGACTACAGTGG - Intronic
1158580466 18:58676534-58676556 CAGGCTGAGATGGTCTCCACAGG + Intronic
1159826839 18:73223390-73223412 CAGGAACAGATGGGATCCAGAGG - Intronic
1160102376 18:75935004-75935026 CAGGGTCAGAAGGCCTGCAGAGG + Intergenic
1161180477 19:2877776-2877798 CATGATCATATGGACTCGAAAGG - Exonic
1163261219 19:16191304-16191326 CTGGATGAGACAGACTCCAGAGG + Exonic
1167624134 19:50575862-50575884 GAGGATCACTTGGACCCCAGAGG + Intergenic
1168027077 19:53650231-53650253 CAGATTCAGACGGACTCCAGGGG - Intergenic
925383224 2:3443225-3443247 CAGGGCCACATGGAATCCAGTGG + Intronic
927141775 2:20135884-20135906 CAGGTTCAGACAGACTTCAGGGG - Intergenic
928649291 2:33387909-33387931 CAGGACCAGATGGACATGAGTGG - Intronic
929119271 2:38470559-38470581 GAGGGGCAGATGGACTCCTGTGG + Intergenic
931597612 2:63967061-63967083 CAAGAACATATGGTCTCCAGAGG - Intronic
931821911 2:65960766-65960788 CAGAATCAGATTGGCTCCATAGG + Intergenic
932582475 2:73000731-73000753 CAGGATCAGGTGGACTACTGGGG - Intronic
933167081 2:79088075-79088097 AAGGATCAGAAGGCCTACAGAGG + Intergenic
934191899 2:89806117-89806139 CATGATCAAATGGAATCGAGTGG + Intergenic
934253905 2:90390445-90390467 CATCATCAAATGGACTCCAATGG + Intergenic
934254441 2:90397085-90397107 CATCATCAAATGGACTCCAACGG + Intergenic
936117462 2:109713402-109713424 CAGGAGCAGATGGACTAGAGGGG + Intergenic
936564277 2:113570999-113571021 CACGATGAGATCCACTCCAGAGG + Intergenic
936696671 2:114958075-114958097 CAGATTCAGAGAGACTCCAGGGG + Intronic
938140488 2:128791039-128791061 CAGATTCAGAGAGACTCCAGTGG - Intergenic
938289214 2:130140573-130140595 AAGGGTCAGATGGGCTTCAGTGG + Intronic
938467312 2:131532365-131532387 AAGGGTCAGATGGGCTTCAGTGG - Intronic
941369090 2:164642283-164642305 CAGATTCAGAGGGACTCCAGGGG + Intergenic
941675417 2:168338812-168338834 AAGGATCACAAGGACTACAGGGG - Intergenic
942017190 2:171829107-171829129 CAGGGTCAAATTGATTCCAGTGG - Intronic
943363461 2:186947612-186947634 CAGATTCAGAGAGACTCCAGGGG + Intergenic
944482241 2:200169673-200169695 CTGGGACAGTTGGACTCCAGAGG + Intergenic
946063079 2:216961432-216961454 CAGGATAAGATGGTTTCCAAGGG - Intergenic
946989941 2:225317283-225317305 CAGATTCAGATAGACTCCAGGGG + Intergenic
948579092 2:238971895-238971917 CAGGGTCAGGAGGAGTCCAGAGG + Intergenic
1169152843 20:3304122-3304144 CAGGCTGAGAAGGCCTCCAGTGG - Intronic
1169276853 20:4239024-4239046 CAGGAGCAGATGGACTCAGGAGG + Intronic
1169387637 20:5164725-5164747 AAGGACCCGTTGGACTCCAGTGG + Intronic
1172096299 20:32462183-32462205 CAGGCACAGATGGATTTCAGGGG - Intronic
1172127449 20:32633320-32633342 CACCATCAGGTGGACTTCAGTGG - Intergenic
1172188397 20:33046282-33046304 CAGGCACGGATGGACACCAGGGG - Intergenic
1172614834 20:36276063-36276085 CATGAACAGATGGCCTTCAGGGG + Intergenic
1172766190 20:37352328-37352350 CCGGATCAGTTGGCCTGCAGAGG - Intronic
1172802257 20:37584472-37584494 CATGATAAGATTAACTCCAGGGG + Intergenic
1176078267 20:63259059-63259081 CAGGCTGAGCTGGACTTCAGGGG + Intronic
1176689126 21:9882496-9882518 CAGGATGAGGTGGTCTCCAATGG - Intergenic
1176692471 21:9932581-9932603 CAGATTCAGAGAGACTCCAGGGG + Intergenic
1180533118 22:16367488-16367510 CATGATCAAATGGACTCGAATGG + Intergenic
1180629019 22:17214512-17214534 CAGGATCAGATGGACTCCAGAGG + Intronic
1183024376 22:35053176-35053198 CTGAATCAGGAGGACTCCAGGGG + Intergenic
1183283155 22:36943929-36943951 CAGATTCAGAAAGACTCCAGGGG + Intergenic
1183406022 22:37631078-37631100 CTGGGTTTGATGGACTCCAGGGG - Exonic
1183946924 22:41331779-41331801 GAGGATCACATGAACCCCAGAGG + Intronic
1184114858 22:42416574-42416596 CAGGATCACATGGAGACCACGGG + Intronic
1203316525 22_KI270737v1_random:18308-18330 CATGATCAAATGGACTCGAATGG - Intergenic
1203326735 22_KI270738v1_random:30002-30024 CAGCATCAAATGGAATCCAATGG + Intergenic
1203328210 22_KI270738v1_random:49866-49888 CATCATCAAATGGACTCCAATGG + Intergenic
1203329116 22_KI270738v1_random:61553-61575 CATAATCAAATGGAATCCAGTGG + Intergenic
1202726559 2_KI270716v1_random:5311-5333 CATCATCAAATGGACTCTAGTGG - Intergenic
949132241 3:517787-517809 CAGAATCATTTGAACTCCAGAGG - Intergenic
951901794 3:27664479-27664501 CAGATTCAGAGAGACTCCAGGGG + Intergenic
953870849 3:46626587-46626609 CAGGCTCCTATTGACTCCAGTGG - Intergenic
957630720 3:82712865-82712887 CAGTTTCAGAGAGACTCCAGGGG - Intergenic
961596412 3:128021617-128021639 CAGGCTCAGAGAGACTACAGGGG - Intergenic
961943275 3:130658734-130658756 CAGCATTAGAGAGACTCCAGCGG + Exonic
963924025 3:150932347-150932369 CAGGATCTGTGGGAGTCCAGAGG + Intronic
963926189 3:150953605-150953627 GAGGATCACTTGAACTCCAGAGG - Intronic
964959417 3:162405025-162405047 CAGGGTCAAATTGATTCCAGTGG + Intergenic
967796045 3:193599822-193599844 CAGATTCAGAGAGACTCCAGGGG + Intronic
970419986 4:15897017-15897039 CAGATTCAGAGAGACTCCAGGGG + Intergenic
971784219 4:31079870-31079892 GAGGATCATATGGAACCCAGTGG + Intronic
978255146 4:106684149-106684171 CAGATTCAGAGAGACTCCAGTGG - Intergenic
979742294 4:124167160-124167182 CAGATTCAGAGAGACTCCAGGGG - Intergenic
980352510 4:131700313-131700335 CAGGATGAGGTGGTCTCCAATGG - Intergenic
980365059 4:131792802-131792824 CAGATTCAGAGAGACTCCAGCGG + Intergenic
981276344 4:142901872-142901894 GAGGATCACTTGAACTCCAGAGG - Intergenic
982328372 4:154153637-154153659 CAGATTCAGAGAGACTCCAGGGG - Intergenic
982538653 4:156639614-156639636 CAGGATCAGATGGTCTATGGGGG + Intronic
982869149 4:160553792-160553814 CAGGGGCAGATGAACTCCAGGGG - Intergenic
983052159 4:163061225-163061247 CAGTATCACATGGACCCCATAGG - Intergenic
983208577 4:164935717-164935739 GAGGATCATTTGAACTCCAGAGG - Intergenic
983395661 4:167192393-167192415 CAGGAACAGATGGCTTCCTGAGG - Intronic
983482775 4:168295568-168295590 CAGATTCAGAGAGACTCCAGGGG - Intronic
985764792 5:1771566-1771588 CAGGATCAGAAGGACCTCATGGG + Intergenic
988224824 5:28399569-28399591 CAGATTCAGAGAGACTCCAGTGG - Intergenic
990082116 5:51929825-51929847 CAGATTCAGAGAGACTCCAGGGG - Intergenic
992007731 5:72495000-72495022 CAGGAGGAAATTGACTCCAGGGG + Intronic
992859946 5:80899688-80899710 CAGGGTCAAATTGACTCCAGTGG + Intergenic
993305163 5:86267640-86267662 CAGGACCAGATGGATTCCAGAGG - Intergenic
994011618 5:94910890-94910912 CAGGCTCAGATGAACTTCTGTGG + Intronic
994282845 5:97926734-97926756 CAGATTCAGAGGGACTCCAGGGG - Intergenic
995297348 5:110537236-110537258 CAGGGTCAAATTGATTCCAGTGG - Intronic
997667423 5:135642883-135642905 CAGGCTCAGATGGTATCCACAGG + Intergenic
1000099345 5:158000146-158000168 CAGGAAGAGATGGAGTCTAGAGG - Intergenic
1000388028 5:160693999-160694021 CAGGGTCAGATGGCCTGCTGAGG + Intronic
1000785138 5:165533820-165533842 AAGGATCAGATGGAATGCAATGG - Intergenic
1001714518 5:173803844-173803866 CAGGATCACTTGGGCCCCAGGGG + Intergenic
1002327572 5:178419967-178419989 CAGATTCAGAGAGACTCCAGGGG - Intronic
1004536637 6:16509544-16509566 AAGGATCAGAAGGTGTCCAGGGG - Intronic
1005779027 6:29168950-29168972 CTGGCTCTGATGGGCTCCAGTGG + Intergenic
1006885555 6:37379104-37379126 CAGGATCACATGAACCCAAGAGG - Intronic
1007632991 6:43283171-43283193 GACGATCAGAAGGAGTCCAGGGG + Exonic
1007776852 6:44228753-44228775 GAGGCCCAGATGGCCTCCAGTGG + Intronic
1011414166 6:87100427-87100449 CAGATTCAGAAAGACTCCAGGGG + Intergenic
1012244985 6:96916065-96916087 CAGATTCAGAGAGACTCCAGAGG + Intergenic
1015759247 6:136640371-136640393 AAGGACCAGATGTAGTCCAGGGG + Intronic
1018143065 6:160859037-160859059 CAGATTCAGAGAGACTCCAGAGG + Intergenic
1018328699 6:162704210-162704232 CAGGCTCAGGTGGACTGCGGGGG + Intronic
1019070053 6:169338120-169338142 CAGGAGCAGATGCTCTCCAAGGG - Intergenic
1020906985 7:14075611-14075633 ATGGATCAGATGGACCACAGAGG + Intergenic
1021261584 7:18464949-18464971 CAGGATAAGAAGGAATTCAGAGG - Intronic
1021780800 7:24103722-24103744 CAGGATCAGCTTGGATCCAGGGG - Intergenic
1022793949 7:33717286-33717308 CTGTACCAGATAGACTCCAGAGG - Intergenic
1023602369 7:41892542-41892564 CAGCAGCAGATGGCCTGCAGGGG - Intergenic
1025318557 7:58064361-58064383 CATCATCAAATGGAATCCAGTGG - Intergenic
1025483974 7:61023039-61023061 AATGATCAGATGGACTCTAATGG - Intergenic
1025487383 7:61067838-61067860 CATCATCAAATGGACTCCAGTGG + Intergenic
1025558720 7:62343079-62343101 CATCATCAAATGGACTCCAATGG + Intergenic
1025559235 7:62349820-62349842 CATGATCAAATGGACTCGAATGG + Intergenic
1025559644 7:62355346-62355368 CATCATCAAATGGAGTCCAGTGG + Intergenic
1026581577 7:71622960-71622982 GAGCATAAGATGGAGTCCAGAGG - Intronic
1029727021 7:102413219-102413241 CACGACCAGATGCACCCCAGTGG + Intronic
1031691194 7:124789969-124789991 CAGATTCAGAGAGACTCCAGGGG - Intronic
1034677103 7:152899813-152899835 CAGATTCAGAGAGACTCCAGGGG - Intergenic
1036619995 8:10418501-10418523 CATGGTTGGATGGACTCCAGAGG + Intronic
1039290447 8:36088907-36088929 CAGGGACAGCTGAACTCCAGGGG - Intergenic
1039301944 8:36219092-36219114 CAGATTCAGACAGACTCCAGGGG + Intergenic
1039884536 8:41647538-41647560 CAGGATCAGATGGGCTTCAGGGG - Intronic
1043683917 8:83065116-83065138 CAGGGTCAAATTGATTCCAGTGG - Intergenic
1044803854 8:95984459-95984481 CAGGTACAGATGGCCTCCAGGGG + Intergenic
1048899881 8:139027231-139027253 CAAGAACAGCTGGACTCCAGGGG + Intergenic
1049888244 9:43105-43127 CACGATGAGATCCACTCCAGAGG - Intergenic
1051243643 9:15086117-15086139 CAGACTCAGAGAGACTCCAGGGG + Intergenic
1052488110 9:29128391-29128413 CAGGGTCAAATTGATTCCAGTGG - Intergenic
1053141590 9:35685828-35685850 AAGGATCAGAGAGGCTCCAGAGG + Intronic
1053301009 9:36949526-36949548 AAGAATCACATAGACTCCAGAGG + Intronic
1053629414 9:39918653-39918675 CAGATTCAGAGAGACTCCAGGGG + Intergenic
1053780200 9:41599400-41599422 CAGGATGAGGTGGTCTCCAATGG + Intergenic
1053947508 9:43327332-43327354 AATAATCAGATGGACTCCAATGG - Intergenic
1053948890 9:43346273-43346295 CAGCATCGAATGGACTCCAGTGG - Intergenic
1054168142 9:61809557-61809579 CAGGATGAGGTGGTCTCCAATGG + Intergenic
1054214473 9:62332049-62332071 CAGATTCAGAGAGACTCCAGGGG - Intergenic
1054365383 9:64333590-64333612 CAGATTCAGAGAGACTCCAGGGG + Intergenic
1054673010 9:67823305-67823327 CAGATTCAGAGAGACTCCAGGGG + Intergenic
1055251089 9:74306528-74306550 CAGGAGCAGATGGTATCCAAGGG - Intergenic
1055793992 9:79954706-79954728 CAGGCTGAGATGGTCTCCAATGG + Intergenic
1059812421 9:117870372-117870394 CTTTATCAGATGGACTTCAGAGG - Intergenic
1203730408 Un_GL000216v2:84629-84651 CAGAATGGAATGGACTCCAGTGG - Intergenic
1203590637 Un_KI270747v1:55890-55912 AATAATCAGATGGACTCCAATGG - Intergenic
1203592070 Un_KI270747v1:74474-74496 CAGCATCGAATGGACTCCAGTGG - Intergenic
1185974677 X:4706977-4706999 CAGATTCAGAGAGACTCCAGGGG + Intergenic
1186127106 X:6426080-6426102 GAGGAACAGCTTGACTCCAGGGG - Intergenic
1187135814 X:16546198-16546220 CAGGATCTGAAGGCCCCCAGGGG - Intergenic
1188252446 X:27914276-27914298 CAGGATCAGTTGGTTTCTAGTGG - Intergenic
1188686261 X:33074297-33074319 CAGATTCAGAGAGACTCCAGGGG - Intronic
1195037904 X:100986930-100986952 CTGCATCAGCTGGGCTCCAGAGG - Intronic
1200019260 X:153188239-153188261 CTGCCTCAGATGGACTCCTGTGG + Intergenic
1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG + Intergenic
1202115592 Y:21467163-21467185 GAGGATTAGCTGGACTCCATAGG - Intergenic