ID: 1180629054

View in Genome Browser
Species Human (GRCh38)
Location 22:17214683-17214705
Sequence TCAGTGGCCAGTGGCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180629054_1180629059 -7 Left 1180629054 22:17214683-17214705 CCTCCTCAGCCACTGGCCACTGA No data
Right 1180629059 22:17214699-17214721 CCACTGAGACAGCACAGCCTGGG 0: 1
1: 2
2: 2
3: 21
4: 238
1180629054_1180629057 -8 Left 1180629054 22:17214683-17214705 CCTCCTCAGCCACTGGCCACTGA No data
Right 1180629057 22:17214698-17214720 GCCACTGAGACAGCACAGCCTGG 0: 1
1: 1
2: 2
3: 29
4: 301
1180629054_1180629065 27 Left 1180629054 22:17214683-17214705 CCTCCTCAGCCACTGGCCACTGA No data
Right 1180629065 22:17214733-17214755 CCACCTAAGGCAAGAATGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 160
1180629054_1180629063 23 Left 1180629054 22:17214683-17214705 CCTCCTCAGCCACTGGCCACTGA No data
Right 1180629063 22:17214729-17214751 ACAGCCACCTAAGGCAAGAATGG No data
1180629054_1180629060 -4 Left 1180629054 22:17214683-17214705 CCTCCTCAGCCACTGGCCACTGA No data
Right 1180629060 22:17214702-17214724 CTGAGACAGCACAGCCTGGGTGG 0: 1
1: 0
2: 5
3: 52
4: 409
1180629054_1180629062 14 Left 1180629054 22:17214683-17214705 CCTCCTCAGCCACTGGCCACTGA No data
Right 1180629062 22:17214720-17214742 GGTGGCAGAACAGCCACCTAAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180629054 Original CRISPR TCAGTGGCCAGTGGCTGAGG AGG (reversed) Intronic
No off target data available for this crispr