ID: 1180633572

View in Genome Browser
Species Human (GRCh38)
Location 22:17246727-17246749
Sequence GCACCAGCTCTGTCTAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180633572_1180633583 20 Left 1180633572 22:17246727-17246749 CCCCCTTTAGACAGAGCTGGTGC No data
Right 1180633583 22:17246770-17246792 ATCAGTAAGAGGGTGCAAGTGGG No data
1180633572_1180633584 21 Left 1180633572 22:17246727-17246749 CCCCCTTTAGACAGAGCTGGTGC No data
Right 1180633584 22:17246771-17246793 TCAGTAAGAGGGTGCAAGTGGGG No data
1180633572_1180633579 9 Left 1180633572 22:17246727-17246749 CCCCCTTTAGACAGAGCTGGTGC No data
Right 1180633579 22:17246759-17246781 CACTCCATAAAATCAGTAAGAGG No data
1180633572_1180633582 19 Left 1180633572 22:17246727-17246749 CCCCCTTTAGACAGAGCTGGTGC No data
Right 1180633582 22:17246769-17246791 AATCAGTAAGAGGGTGCAAGTGG No data
1180633572_1180633580 10 Left 1180633572 22:17246727-17246749 CCCCCTTTAGACAGAGCTGGTGC No data
Right 1180633580 22:17246760-17246782 ACTCCATAAAATCAGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180633572 Original CRISPR GCACCAGCTCTGTCTAAAGG GGG (reversed) Intergenic
No off target data available for this crispr