ID: 1180639448

View in Genome Browser
Species Human (GRCh38)
Location 22:17286676-17286698
Sequence AGAGGCAGAGACTTTGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180639445_1180639448 12 Left 1180639445 22:17286641-17286663 CCAATGTGAAAGGATATAGAGCT No data
Right 1180639448 22:17286676-17286698 AGAGGCAGAGACTTTGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180639448 Original CRISPR AGAGGCAGAGACTTTGAGGA CGG Intergenic
No off target data available for this crispr