ID: 1180641183

View in Genome Browser
Species Human (GRCh38)
Location 22:17300759-17300781
Sequence AACCAGACCAGTATGGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180641180_1180641183 -8 Left 1180641180 22:17300744-17300766 CCAATAGCGAGAAGCAACCAGAC No data
Right 1180641183 22:17300759-17300781 AACCAGACCAGTATGGGCTGTGG No data
1180641179_1180641183 22 Left 1180641179 22:17300714-17300736 CCATAAACAATTATGTCTCTGCA No data
Right 1180641183 22:17300759-17300781 AACCAGACCAGTATGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180641183 Original CRISPR AACCAGACCAGTATGGGCTG TGG Intergenic