ID: 1180643088

View in Genome Browser
Species Human (GRCh38)
Location 22:17315199-17315221
Sequence ATCCTTAAACAGCTCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180643088_1180643093 5 Left 1180643088 22:17315199-17315221 CCCTCTAGGAGCTGTTTAAGGAT No data
Right 1180643093 22:17315227-17315249 CTGGACAATGTGAAGCCCACGGG No data
1180643088_1180643092 4 Left 1180643088 22:17315199-17315221 CCCTCTAGGAGCTGTTTAAGGAT No data
Right 1180643092 22:17315226-17315248 CCTGGACAATGTGAAGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180643088 Original CRISPR ATCCTTAAACAGCTCCTAGA GGG (reversed) Intergenic
No off target data available for this crispr