ID: 1180645388

View in Genome Browser
Species Human (GRCh38)
Location 22:17334382-17334404
Sequence CTCCTGTTGTTGATGACAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180645388_1180645395 26 Left 1180645388 22:17334382-17334404 CCGTTTGTCATCAACAACAGGAG No data
Right 1180645395 22:17334431-17334453 CAGAGAGTTTGTCCATTTCTGGG No data
1180645388_1180645394 25 Left 1180645388 22:17334382-17334404 CCGTTTGTCATCAACAACAGGAG No data
Right 1180645394 22:17334430-17334452 TCAGAGAGTTTGTCCATTTCTGG No data
1180645388_1180645392 -9 Left 1180645388 22:17334382-17334404 CCGTTTGTCATCAACAACAGGAG No data
Right 1180645392 22:17334396-17334418 CAACAGGAGGGACTGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180645388 Original CRISPR CTCCTGTTGTTGATGACAAA CGG (reversed) Intergenic
No off target data available for this crispr