ID: 1180647042

View in Genome Browser
Species Human (GRCh38)
Location 22:17347835-17347857
Sequence GGTCCCAGTGGACGTGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180647042_1180647051 5 Left 1180647042 22:17347835-17347857 CCCGCACCACGTCCACTGGGACC No data
Right 1180647051 22:17347863-17347885 GCTGGTCCTGTGCATCCGGCTGG No data
1180647042_1180647049 1 Left 1180647042 22:17347835-17347857 CCCGCACCACGTCCACTGGGACC No data
Right 1180647049 22:17347859-17347881 CCCTGCTGGTCCTGTGCATCCGG No data
1180647042_1180647055 29 Left 1180647042 22:17347835-17347857 CCCGCACCACGTCCACTGGGACC No data
Right 1180647055 22:17347887-17347909 CATCAGCTCATCGTGCCTCAGGG No data
1180647042_1180647054 28 Left 1180647042 22:17347835-17347857 CCCGCACCACGTCCACTGGGACC No data
Right 1180647054 22:17347886-17347908 TCATCAGCTCATCGTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180647042 Original CRISPR GGTCCCAGTGGACGTGGTGC GGG (reversed) Intergenic
No off target data available for this crispr