ID: 1180649939

View in Genome Browser
Species Human (GRCh38)
Location 22:17369451-17369473
Sequence CCGGAGAAACAGATGGGGCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180649939_1180649955 13 Left 1180649939 22:17369451-17369473 CCTAGCCCCATCTGTTTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1180649955 22:17369487-17369509 ATATTGTAGGGGACTGGGGGCGG 0: 1
1: 0
2: 3
3: 21
4: 260
1180649939_1180649954 10 Left 1180649939 22:17369451-17369473 CCTAGCCCCATCTGTTTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1180649954 22:17369484-17369506 ATTATATTGTAGGGGACTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 150
1180649939_1180649950 2 Left 1180649939 22:17369451-17369473 CCTAGCCCCATCTGTTTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1180649950 22:17369476-17369498 GGGACTCGATTATATTGTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 31
1180649939_1180649953 9 Left 1180649939 22:17369451-17369473 CCTAGCCCCATCTGTTTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1180649953 22:17369483-17369505 GATTATATTGTAGGGGACTGGGG 0: 1
1: 0
2: 2
3: 12
4: 120
1180649939_1180649952 8 Left 1180649939 22:17369451-17369473 CCTAGCCCCATCTGTTTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1180649952 22:17369482-17369504 CGATTATATTGTAGGGGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 50
1180649939_1180649948 0 Left 1180649939 22:17369451-17369473 CCTAGCCCCATCTGTTTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1180649948 22:17369474-17369496 CGGGGACTCGATTATATTGTAGG 0: 1
1: 0
2: 0
3: 0
4: 23
1180649939_1180649949 1 Left 1180649939 22:17369451-17369473 CCTAGCCCCATCTGTTTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1180649949 22:17369475-17369497 GGGGACTCGATTATATTGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 32
1180649939_1180649951 7 Left 1180649939 22:17369451-17369473 CCTAGCCCCATCTGTTTCTCCGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1180649951 22:17369481-17369503 TCGATTATATTGTAGGGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180649939 Original CRISPR CCGGAGAAACAGATGGGGCT AGG (reversed) Exonic
901202241 1:7473337-7473359 TAGGAGGAACAGCTGGGGCTGGG + Intronic
901276660 1:7996826-7996848 CAGGAGCAAGAGATGGGGGTCGG + Intergenic
902510018 1:16961347-16961369 CCCGGGAAACAGATGAGGCCTGG - Intronic
903173123 1:21565719-21565741 ACGGAGAGGCAGGTGGGGCTGGG - Intronic
903444017 1:23409168-23409190 GAGGAGAAACACATGGGCCTTGG + Intronic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
910075718 1:83276195-83276217 CCACAGAAACTGGTGGGGCTGGG - Intergenic
914964089 1:152237704-152237726 CAGGAGAAAGAGATGGGGGGAGG - Intergenic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915748688 1:158184155-158184177 CCAGAGACACAGATGTGGCAAGG - Exonic
917078976 1:171237255-171237277 CCTGAGAGCCACATGGGGCTGGG + Intergenic
919915926 1:202139272-202139294 CAGGCTAAAGAGATGGGGCTCGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920734517 1:208518654-208518676 ACAGAGAAACAGATGGGTTTGGG + Intergenic
920938544 1:210458700-210458722 CAGGAAAAATAGATTGGGCTTGG + Intronic
922854831 1:228765907-228765929 CAGGAGATAGAGATGAGGCTGGG + Intergenic
924200251 1:241651060-241651082 GAGGAGAAACAAATGGGGTTGGG + Intronic
1064321799 10:14311730-14311752 TCTGAGAGACAGATGGGGGTTGG - Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1067043176 10:42969338-42969360 TCTGAGATTCAGATGGGGCTGGG - Intergenic
1067087813 10:43252133-43252155 CCCCAGAAGCAGAGGGGGCTTGG + Intronic
1067719772 10:48719616-48719638 GAGGAGAAACAGGAGGGGCTGGG + Intronic
1067719840 10:48719988-48720010 CTGAAGCAACAGATGGGACTTGG - Intronic
1069619535 10:69828273-69828295 CAGGAGGAAGAGATGGGGGTGGG - Intronic
1069781197 10:70956721-70956743 CCTGAAAAATAAATGGGGCTTGG + Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1072250551 10:93578995-93579017 CTTGAGAAAAAGATGGGGGTGGG - Intronic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1074047981 10:109856694-109856716 CCTGAGCAATAGCTGGGGCTGGG + Intergenic
1075429433 10:122368239-122368261 CCAGAGATTCAGATTGGGCTGGG + Intergenic
1076411489 10:130254784-130254806 TCGGAGAATAAGGTGGGGCTGGG - Intergenic
1076632255 10:131858176-131858198 CCTGAGGACCAGATGGGGATGGG - Intergenic
1077103572 11:832627-832649 GAGGAGAAAGAGATGGGGGTTGG + Intergenic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1079202464 11:18387312-18387334 TCTGAGAGACAGATGGGGCTTGG + Intergenic
1080301689 11:30791629-30791651 CAGGGAAAAGAGATGGGGCTGGG + Intergenic
1082799664 11:57405452-57405474 CCAGAAAAACACATGGGGGTGGG - Intronic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1084101122 11:66950375-66950397 CCAGAGAAAGAGGTGGGGCCGGG - Intronic
1084801699 11:71548275-71548297 CAGGAGAAGAAGCTGGGGCTCGG + Intronic
1090543849 11:127739730-127739752 CAGCAGAAAAAGATGGGGCCAGG + Intergenic
1090734333 11:129598267-129598289 CCTAAGAAGCACATGGGGCTGGG + Intergenic
1091213602 11:133885510-133885532 CCTGGGAAACACAAGGGGCTGGG - Intergenic
1092091288 12:5805656-5805678 CAGGAAACAGAGATGGGGCTCGG - Intronic
1096212355 12:49776353-49776375 CAGGAGAAACAGATAAGGCCAGG + Intergenic
1096252288 12:50040926-50040948 CCAGAGAAACAGACCAGGCTGGG - Intergenic
1096911111 12:54984817-54984839 CCGGAGCAAAGGATGTGGCTGGG - Intergenic
1097133015 12:56827499-56827521 CAGGAGAACCACATGGTGCTGGG + Intergenic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1099481040 12:83167059-83167081 GCGGAGAAACTGATAGGGATGGG - Intergenic
1102205023 12:111084298-111084320 CCCTAGAAACAGATGGTACTTGG - Intronic
1103379043 12:120479631-120479653 CTGAAGAACCAGATGGTGCTAGG + Intronic
1104280524 12:127372469-127372491 CTGGAAAAACACATGGGACTTGG - Intergenic
1108544701 13:51481116-51481138 CCAGAGAAACACATGAAGCTAGG - Intergenic
1109658185 13:65421977-65421999 CCTGTGCAACAAATGGGGCTGGG + Intergenic
1109730446 13:66406189-66406211 CAGGAGAAACACATGGGCTTTGG + Intronic
1114280747 14:21191061-21191083 CTGGAGAAAGAATTGGGGCTTGG - Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1116814346 14:49569742-49569764 CAGGAGATACAAATGAGGCTTGG + Intergenic
1117786779 14:59293991-59294013 CCTGAGAAATGGATGTGGCTTGG - Intronic
1118325431 14:64777368-64777390 CCAGGGAAACAGATGCAGCTAGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1119479731 14:74951866-74951888 TGGGAGAAACAAAAGGGGCTGGG + Intronic
1119558717 14:75572937-75572959 CCAGTGAAACAGCTGGAGCTCGG + Intergenic
1121755191 14:96396400-96396422 CAGCAAAAAGAGATGGGGCTGGG - Intronic
1126549952 15:49917624-49917646 CTGGAGAATCAGATGGTGTTGGG + Intronic
1127795191 15:62431939-62431961 CCAGAGCAAGAGATGGGCCTGGG - Intronic
1129389758 15:75214662-75214684 CAGGAGAGACAGGAGGGGCTTGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1130602569 15:85286608-85286630 TCAGTGATACAGATGGGGCTGGG + Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1132666407 16:1083099-1083121 CCGGAGAACCCGGTGGGGGTGGG + Intergenic
1133232559 16:4373409-4373431 CCGGAGGGTCAGATGGGGATGGG + Intronic
1134810911 16:17166346-17166368 CTGGAGGAACAGATGGGAATTGG - Intronic
1136569150 16:31086492-31086514 CTGGTGAAAGAGACGGGGCTGGG + Intronic
1137497154 16:48979317-48979339 CCTGTGAAACAAATGGGGATAGG + Intergenic
1139130121 16:64132924-64132946 CAGGAGAAACACATTTGGCTTGG + Intergenic
1141601087 16:85126839-85126861 CCGAAGAAACAGGAGAGGCTGGG - Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1147168143 17:38604271-38604293 AGGGAGAAACAGGTGAGGCTTGG - Intronic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1148065922 17:44869732-44869754 CGAGGGAAAGAGATGGGGCTTGG - Intronic
1148651262 17:49251762-49251784 TCCAGGAAACAGATGGGGCTGGG - Intergenic
1149559617 17:57599245-57599267 CCCGAGACACAGATGGGGAAAGG + Intronic
1150782506 17:68134635-68134657 CCGGAGAAAGATAGGGAGCTGGG - Intergenic
1151752635 17:76049367-76049389 CTTGAAAAACAGATGGGGTTTGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1155613835 18:27699348-27699370 CCAGCCAAACAGCTGGGGCTTGG + Intergenic
1156138603 18:34077008-34077030 CCTTAGAAAGAAATGGGGCTAGG + Intronic
1156458024 18:37305617-37305639 CCTGAGAATCAGATGGGCCTGGG + Intronic
1157763702 18:50282500-50282522 CCGGAGAAACAGATGAGTGGAGG + Exonic
1157789681 18:50520452-50520474 CCGGAGAAAGAGAGGGAGATGGG + Intergenic
1159630629 18:70745655-70745677 CCTGAGTGGCAGATGGGGCTTGG + Intergenic
1160910816 19:1473006-1473028 CCGGGGCAACAGATGGGGCCGGG - Exonic
1161419195 19:4166689-4166711 CAATAGAAACAGATGGGGCCAGG - Intronic
1161449717 19:4338405-4338427 CGGGAGAGACAGACGGGGCCAGG + Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162454526 19:10775375-10775397 ACAGACAAACAGATGAGGCTGGG - Intronic
1164079841 19:21852479-21852501 ACGGGGAAGCAGCTGGGGCTAGG + Intergenic
1164779078 19:30878232-30878254 ACTGAGAAACAGGTGGGGCATGG + Intergenic
1166289323 19:41851636-41851658 GCAGAGCAACAGAGGGGGCTGGG - Exonic
1167689064 19:50974758-50974780 GCCCAGAAACAGAAGGGGCTGGG + Intergenic
1168345965 19:55650373-55650395 CCGGGGAAGAGGATGGGGCTGGG - Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
928902011 2:36329638-36329660 CTGGAGAAGAAGAGGGGGCTGGG - Intergenic
929558966 2:42943723-42943745 CTGGAGAAGTTGATGGGGCTTGG + Intergenic
930010363 2:46933220-46933242 CCCGAGGAACAGAAGGGACTGGG + Intronic
936849173 2:116874453-116874475 CCTGAGAACCACATGGGGCAAGG - Intergenic
937677643 2:124609359-124609381 CAGGAGAATCAGTTGAGGCTAGG + Intronic
942299335 2:174547017-174547039 CTAGAGAAAGAGATGGGCCTGGG + Intergenic
944338466 2:198566020-198566042 CCCCAGAAACAGATGCTGCTAGG + Intronic
945314770 2:208359967-208359989 CGGGAGGAGCGGATGGGGCTTGG + Intronic
945564752 2:211383545-211383567 CCAGAGAAAGAGAGGGGGGTGGG + Exonic
948122778 2:235543482-235543504 CCAGAGAAGAAGCTGGGGCTCGG + Intronic
1168955657 20:1832584-1832606 CCGGAGAGGGAGCTGGGGCTCGG + Intergenic
1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG + Intronic
1172410429 20:34717911-34717933 TCTGAGAAACATATGTGGCTGGG + Intronic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1172993199 20:39050761-39050783 CAGGAGAAGCAGATGGGCCATGG + Intergenic
1173249651 20:41357816-41357838 CCAGAGAAACAGATGGGGGCTGG + Intronic
1174635177 20:51993330-51993352 CAGGAGAATCAGTTGAGGCTAGG + Intergenic
1175681461 20:60991837-60991859 CCGGAGACACATCTGGGTCTGGG + Intergenic
1176358125 21:5969663-5969685 CCAGAGGAACAGCTGGTGCTGGG + Intergenic
1179765393 21:43568888-43568910 CCAGAGGAACAGCTGGTGCTGGG - Intronic
1179944441 21:44661756-44661778 CAGGAGAGAAAGACGGGGCTGGG + Intronic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1183354941 22:37353204-37353226 CCGCAGAACCAGATAGAGCTGGG - Intergenic
1183604280 22:38859644-38859666 AGGGGCAAACAGATGGGGCTGGG + Intergenic
1184123597 22:42471023-42471045 CCTGAGATACAGAGGGAGCTGGG - Intergenic
1184213600 22:43051696-43051718 CCTGAGAAACATCTGGGGCCTGG + Intronic
1184390546 22:44200946-44200968 TCGGGGAGGCAGATGGGGCTTGG - Intronic
949925945 3:9041803-9041825 TAAGAGAAACAGATGAGGCTGGG + Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953799522 3:46011640-46011662 GCGGAGTAGCAGGTGGGGCTTGG + Intergenic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
954784874 3:53085254-53085276 CGGGAGAAGCAGAGAGGGCTGGG + Intronic
956837110 3:73104409-73104431 CAGGAGAGACATTTGGGGCTGGG - Intergenic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
956846988 3:73192886-73192908 AGGGAGAAACAAATGGGACTTGG + Intergenic
961318638 3:126057361-126057383 CCAGAGAAGGAGAAGGGGCTGGG + Intronic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
961976196 3:131027385-131027407 TCGGTGAAACAGATCTGGCTGGG - Intronic
962160175 3:132990614-132990636 AAGGAGAAGCTGATGGGGCTTGG - Intergenic
962369138 3:134806284-134806306 CAGGAGAAACAGAGAGAGCTAGG - Intronic
963867561 3:150379026-150379048 CAGGAGCAAGAGATGGGGCGGGG - Intergenic
964576047 3:158169667-158169689 CAAGAGAAGCAGATGGGGTTAGG - Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
967388799 3:188935146-188935168 CTTGAGAAACAGATGAGGTTTGG + Intergenic
968691581 4:1992897-1992919 CCCAAGGAACAGAAGGGGCTGGG - Intronic
969308634 4:6339669-6339691 CCAGAGAAACAGATGAGGGTGGG + Intronic
969502137 4:7559587-7559609 CTGGAGCAACAAATGTGGCTGGG + Intronic
972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG + Intronic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG + Intronic
978183506 4:105831257-105831279 CCGGAGAGAATGATTGGGCTGGG + Intronic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
980309847 4:131112772-131112794 CCTGAGACTCAGATGGGGCAGGG - Intergenic
980319521 4:131251485-131251507 CCAGAGAAACACATGGACCTTGG + Intergenic
982048918 4:151479679-151479701 CCAGAGAAACAAATGTGGGTGGG - Intronic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
985984801 5:3505769-3505791 CCACAGAGACAGAAGGGGCTCGG - Intergenic
991504087 5:67306050-67306072 CCGGAGAAAGAAAAGGTGCTGGG + Intergenic
994641882 5:102420998-102421020 CCCGAGAAGCAGAAGGGGCTGGG + Intronic
994670031 5:102754115-102754137 TGGGAGAAAGAGAGGGGGCTGGG + Intronic
999934660 5:156474038-156474060 CTGGAGAAAATGAAGGGGCTGGG - Intronic
1006083763 6:31582022-31582044 GCGGAGAAACAGATGTACCTCGG + Intronic
1006710644 6:36066566-36066588 CCGAAGAAACAAATAGGGATAGG + Intronic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1011351675 6:86431048-86431070 CCAGAGAAATACATGGGGCCAGG + Intergenic
1011699305 6:89941029-89941051 CCAGAAAAACATATGGGTCTGGG + Intronic
1019511638 7:1420529-1420551 CAAGAGAAATAGATGGGGCCGGG - Intergenic
1020279838 7:6644492-6644514 CCGGAAGATCAGATCGGGCTTGG - Exonic
1021658497 7:22895276-22895298 CTAGAGAAGCAGATGGGGTTGGG - Intergenic
1023353778 7:39347000-39347022 CTTGAGAAGCAGATGGGCCTGGG + Intronic
1024236617 7:47403355-47403377 CAGGAGAATCATATGGGGCCTGG - Intronic
1024346029 7:48314664-48314686 CCTGGGAAACCAATGGGGCTGGG - Intronic
1027291898 7:76723021-76723043 ACGGAGTAAAAGATGGGGCCTGG - Intergenic
1027293431 7:76741069-76741091 CCACAGAAACTGGTGGGGCTGGG - Intergenic
1029435593 7:100562446-100562468 CAGGAGATGCCGATGGGGCTGGG - Intronic
1031339809 7:120585293-120585315 GCAGAGAAACAGAAGGGGATGGG + Intronic
1031339830 7:120585488-120585510 GCAGAGAAACATATGGTGCTTGG + Intronic
1031356595 7:120794473-120794495 CCGGAGAGAGAGATGGGGGGTGG - Intronic
1034234626 7:149557100-149557122 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034239406 7:149598332-149598354 CCCCAGAAACAGATGGGGAATGG + Intergenic
1035000510 7:155609001-155609023 CCTGGGAAACAGATGGGTCGAGG + Intergenic
1035080284 7:156210087-156210109 CCGGAGAGACAGTAGGTGCTTGG + Intergenic
1035270145 7:157714984-157715006 CAGGAAAAGCACATGGGGCTGGG - Intronic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1044803090 8:95977098-95977120 CCAGAGGAAAAGATGGGACTTGG + Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1050660650 9:7879774-7879796 CCTGAGAACCACATGGGGCAGGG + Intronic
1058974930 9:110117210-110117232 CCGGAGGAACACATGAGCCTGGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060548980 9:124476404-124476426 CCGGAGAGACAGGTGAGGCTGGG + Exonic
1060955422 9:127635513-127635535 TCGGAGACACAGATGTGGCTGGG + Intronic
1062108348 9:134767915-134767937 CCTGAGAAACACAGAGGGCTGGG + Intronic
1062530631 9:136997977-136997999 CCGGGGCAGCAGAGGGGGCTGGG - Intergenic
1185573342 X:1151739-1151761 ACGGAGAAAGAGGTGGGTCTTGG - Intergenic
1185724140 X:2405702-2405724 CAGGAGAAACACTTGGGCCTGGG + Intronic
1194509140 X:94770827-94770849 CCCTAGAAAAAGATGAGGCTTGG - Intergenic
1195067505 X:101250817-101250839 CAGGAGAACCAGCAGGGGCTGGG - Intronic
1195797611 X:108668422-108668444 CCGGAGAACCAGGAGGGCCTGGG - Exonic
1198049499 X:132936359-132936381 CTAGAGAAACATATGGGCCTGGG - Intronic