ID: 1180649974

View in Genome Browser
Species Human (GRCh38)
Location 22:17369566-17369588
Sequence CGCAGCCGCCTCAGTAGTTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 251}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180649968_1180649974 -4 Left 1180649968 22:17369547-17369569 CCCCGCGGGCAGCCGCAGCCGCA 0: 1
1: 1
2: 2
3: 21
4: 235
Right 1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 251
1180649964_1180649974 21 Left 1180649964 22:17369522-17369544 CCGCGGGATGGGGCGAGCGCGCG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 251
1180649969_1180649974 -5 Left 1180649969 22:17369548-17369570 CCCGCGGGCAGCCGCAGCCGCAG 0: 1
1: 0
2: 1
3: 32
4: 344
Right 1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 251
1180649963_1180649974 27 Left 1180649963 22:17369516-17369538 CCGCAGCCGCGGGATGGGGCGAG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 251
1180649962_1180649974 30 Left 1180649962 22:17369513-17369535 CCGCCGCAGCCGCGGGATGGGGC 0: 1
1: 0
2: 0
3: 17
4: 202
Right 1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 251
1180649970_1180649974 -6 Left 1180649970 22:17369549-17369571 CCGCGGGCAGCCGCAGCCGCAGC 0: 1
1: 0
2: 6
3: 77
4: 632
Right 1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180649974 Original CRISPR CGCAGCCGCCTCAGTAGTTC GGG Exonic
902292418 1:15444138-15444160 CTCAGCCTCCTGAGTAGTTTGGG - Intronic
903628346 1:24746870-24746892 CGCAGCCTCCAGAGTAGTACAGG - Intronic
904144247 1:28377353-28377375 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
904178090 1:28645529-28645551 CGCAGCCTCCTGAGTAGCTGGGG - Intergenic
904796877 1:33062797-33062819 CGCAGCCTCCTGAGTAGCTGGGG - Intronic
905556730 1:38891538-38891560 AGCTGCCTCCTCAGTTGTTCAGG - Intronic
906962417 1:50426612-50426634 CTCAGCCGCCTCATTTGTCCCGG - Intergenic
906990648 1:50733911-50733933 CTCAGCCTCCTGAGTAGCTCGGG + Intronic
911006638 1:93232852-93232874 CTCAGCCTCCTCAGTAGCTGGGG - Intronic
915114526 1:153587896-153587918 CTCAGCCTCCTGAGTAGTTAGGG - Intergenic
917325714 1:173829790-173829812 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
917886129 1:179386839-179386861 CTCAGCCTCCTCAGTAGCTGGGG + Intronic
919671297 1:200340401-200340423 CGCAGCCTCCTGAGTAGCTGGGG - Intergenic
920258086 1:204670143-204670165 CACAGCCTCCACACTAGTTCAGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921443313 1:215214707-215214729 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
923582186 1:235228410-235228432 CACAGCCTCCTCAGTAGCTGGGG + Intronic
924192164 1:241565605-241565627 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
924464660 1:244289402-244289424 CGCAGCCTCCTGAGTAGCTTGGG - Intergenic
924937063 1:248780984-248781006 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
1062890984 10:1059679-1059701 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1063476358 10:6332038-6332060 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
1063806972 10:9656428-9656450 CACAGCCAACTCAATAGTTCTGG + Intergenic
1063911547 10:10835497-10835519 CTCAGCCTCCTCAGTAGCTGGGG + Intergenic
1063969759 10:11373423-11373445 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
1065139782 10:22708897-22708919 CTCAGCCTCCTGAGTAGTTCAGG + Intronic
1065475551 10:26133708-26133730 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1067250908 10:44586610-44586632 ACCAGCAGCCTCAGTAGTGCTGG + Intergenic
1068548235 10:58376964-58376986 CTCAGCCGCCTGAGTAGCTGGGG + Intergenic
1069697090 10:70394485-70394507 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
1070260584 10:74851222-74851244 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1073070325 10:100789220-100789242 CTCAGCCTCCTGAGTAGTTGAGG + Intronic
1073398847 10:103240617-103240639 AACAGCTGGCTCAGTAGTTCTGG + Intergenic
1075338061 10:121623127-121623149 AGAAGCTGACTCAGTAGTTCTGG + Intergenic
1080507312 11:32928052-32928074 AGCAGCAGCCTGAGCAGTTCGGG - Exonic
1081420014 11:42865056-42865078 TTCACCCTCCTCAGTAGTTCTGG - Intergenic
1081620990 11:44619114-44619136 AGCAGCTGCCTCAGTACTTGGGG - Exonic
1084766297 11:71311114-71311136 CACAGACTCCTCAGTTGTTCTGG + Intergenic
1086731022 11:90250077-90250099 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
1087613643 11:100463857-100463879 CCCAGCCCCCTGAGTAGTTGGGG - Intergenic
1087697388 11:101395403-101395425 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
1089557209 11:119321088-119321110 CGCAGCCGCCTGAGCATTTATGG - Intronic
1090442243 11:126734074-126734096 AGCTTCTGCCTCAGTAGTTCTGG - Intronic
1090763397 11:129856326-129856348 CTCAGCCTCCTGAGTAGCTCAGG + Intronic
1091443181 12:527431-527453 CACAGCCGTTTCAGTAGCTCAGG + Intronic
1091497212 12:982964-982986 CTCAGCCTCCCCAGTAGTTGGGG + Intronic
1092300835 12:7248582-7248604 CTCAGCCTCCTGAGTAGTTAGGG - Intergenic
1094542666 12:31375469-31375491 CTCAGCCTCCTGAGTAGTTTGGG + Intergenic
1094701296 12:32873214-32873236 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1095381403 12:41598001-41598023 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
1095884837 12:47177828-47177850 CCCAGCCTCCTGAGTAGTACAGG - Intronic
1096458147 12:51804433-51804455 CTCAGCCTCCTGAGTAGCTCGGG + Intronic
1098282246 12:68873546-68873568 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1098570465 12:71982118-71982140 CTCAGCCTCCTCAGTAGCTGGGG + Intronic
1100334528 12:93617033-93617055 CACAGCCACCTCGGTAGTACTGG - Intergenic
1102353089 12:112209440-112209462 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1102748582 12:115271999-115272021 CTCAGCCCCCTGAGTAGTTGGGG - Intergenic
1102975678 12:117205675-117205697 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
1104012936 12:124944803-124944825 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
1106519397 13:30483728-30483750 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1107874616 13:44779326-44779348 CTCAGCCACCTGAGTAGTTGGGG + Intergenic
1108300547 13:49070246-49070268 CGCAGCCTCCTGAGTAGCTGGGG + Intronic
1108352930 13:49603584-49603606 CTCAGCCTCCTGAGTAGCTCGGG - Intergenic
1108621301 13:52186734-52186756 CGGAGCTGCCTGAGCAGTTCTGG + Intergenic
1108665636 13:52627505-52627527 CGGAGCTGCCTGAGCAGTTCTGG - Intergenic
1109344364 13:61097234-61097256 CATAGCCACCTCATTAGTTCTGG + Intergenic
1109599231 13:64601193-64601215 CTCAGCCGCCTGAGTAGCTGGGG - Intergenic
1109693409 13:65923154-65923176 CTCAGCCTCCCCAGTAGTTGGGG - Intergenic
1113974342 13:114214701-114214723 CTCAGCCTCCTCAGTAGCTGGGG + Intergenic
1114839031 14:26240815-26240837 CTCAGCCTCCTCAGTAGCTGGGG + Intergenic
1116945250 14:50830571-50830593 CGCAGCCGGCGCAGCGGTTCCGG + Intronic
1117147976 14:52854650-52854672 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
1117374983 14:55111748-55111770 CTCAGCCTCCTCAGTAGCTGGGG + Intergenic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1117866772 14:60158114-60158136 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1118802456 14:69203173-69203195 CTCAGCCTCCTCAGTAGCTGGGG + Intronic
1118818170 14:69327231-69327253 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1119360030 14:74041670-74041692 CTCAGCCTCCTAAGTAGTTGGGG + Intronic
1125637655 15:41202799-41202821 CTCAGCCTCCTCAGTAGCTGGGG - Intronic
1126053540 15:44709013-44709035 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1126788824 15:52202258-52202280 CGCAGCCTCCTGAGTAGCTGTGG - Intronic
1128965760 15:72056109-72056131 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1129191343 15:73939353-73939375 AGGAGCAGCCTCAGGAGTTCAGG - Intronic
1129637955 15:77342520-77342542 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1131487691 15:92835657-92835679 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
1132355144 15:101165904-101165926 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
1132747235 16:1442031-1442053 CTCAGCCTCCTCAGTAGCTGAGG + Intronic
1132753102 16:1467964-1467986 CTCAGCCTCCTGAGTAGTTTGGG - Intronic
1132774568 16:1585885-1585907 CGCAGCCTCCTGAGTAGCTGAGG + Intronic
1133098067 16:3461017-3461039 CTCAGCCTCCTCAGTCGTTGGGG + Intronic
1134777441 16:16865383-16865405 CTCAGCCTCCTGAGTAGCTCAGG + Intergenic
1135075029 16:19385833-19385855 CTCAGCCTCCTGAGTAGCTCGGG - Intergenic
1135098948 16:19589358-19589380 CTCAGCCTCCTGAGTAGTTAGGG + Intronic
1135393237 16:22111434-22111456 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1135535836 16:23293805-23293827 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1136356468 16:29747472-29747494 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
1137439636 16:48487136-48487158 CTCAGCCTCCTGAGTAGTTGAGG + Intergenic
1138426320 16:56934826-56934848 CTCAGCCTCCTGAGTAGTTTGGG + Intronic
1139677693 16:68536421-68536443 CTCAGCCTCCCCAGTAGTTGGGG + Intronic
1139844833 16:69913139-69913161 CTCAGCCTCCTAAGTAGTTGGGG + Intronic
1140110528 16:72000428-72000450 CTCAGCCTCCTCAGTAGCTGGGG + Intergenic
1140572640 16:76126640-76126662 CTCAGCCTCCTGAGTAGCTCGGG + Intergenic
1142022562 16:87793026-87793048 CTCAGCCTCCTGAGTAGCTCAGG + Intergenic
1144718734 17:17452888-17452910 CTCAGCCTCCTAAGTAGTTGGGG - Intergenic
1146927684 17:36756211-36756233 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
1147567234 17:41545300-41545322 CTCAGCCTCCTCAGTAGCTAGGG + Intergenic
1149238181 17:54617442-54617464 CTCAGCCGCCTCAGAAGCTGGGG - Intergenic
1150077815 17:62208172-62208194 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
1150262842 17:63810200-63810222 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1150710561 17:67527584-67527606 CTCAGCCTCCTCAGTAGCTGAGG - Intronic
1151528053 17:74684671-74684693 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1151750394 17:76033953-76033975 CGCAGCCGCCCCTGTTGTACAGG + Intergenic
1152114574 17:78377809-78377831 CTCAGCCTCCTGAGTAGTTTGGG + Intergenic
1155191210 18:23432562-23432584 CGCAGCCTCCTGAGTAGCTGGGG - Intronic
1157380845 18:47215208-47215230 GGCAGCCTCCACAGAAGTTCAGG + Intronic
1159333924 18:67038874-67038896 CTCAGCCTCCTCAGTAGCTGAGG + Intergenic
1161171558 19:2814809-2814831 CTCAGCCTCCTGAGTAGTTGGGG - Exonic
1161504084 19:4634700-4634722 TGCTGCCTCCTCTGTAGTTCTGG + Intergenic
1161624123 19:5316032-5316054 CTCAGCCTCCTCAGTAGCTGGGG + Intronic
1162093729 19:8297908-8297930 CTCAGCCTCCTGAGTAGTACAGG - Intronic
1162908721 19:13838267-13838289 CTCAGCCGCCTGAGTAGCTGGGG - Intergenic
1163652270 19:18524984-18525006 CTCAGCCGCCCGAGTAGCTCGGG + Intergenic
1164882460 19:31744920-31744942 CTCAGCCTCCTAAGTAGTTAGGG - Intergenic
1164956864 19:32393647-32393669 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
1166610828 19:44194390-44194412 CGCAGCCTCCTGAGTAGCTGGGG + Intergenic
1166848661 19:45746558-45746580 CACAGCGGGCTCAGTAGTTTGGG + Intronic
928556162 2:32427397-32427419 CTCAGCCTCCTGAGTAGCTCAGG + Intronic
929524030 2:42682953-42682975 CTCAGCCTCTTCAGTAGCTCGGG - Intronic
931727348 2:65124101-65124123 CTCAGCCTCCTCAGTAGCTTGGG + Intronic
932228600 2:70063447-70063469 CTCAGCAGCCTTAGGAGTTCAGG - Intergenic
932251604 2:70249072-70249094 CCCAGCCGCCACAGTATTTTAGG + Intergenic
932698487 2:73976962-73976984 CTCAGCCTCCTCAGTAGCTAGGG - Intergenic
933834099 2:86231902-86231924 CGCAGAGGCTTCAGTAGGTCTGG - Intronic
936808407 2:116365547-116365569 CTCAGCCTCCTCTGTAGTTGTGG - Intergenic
937104540 2:119297621-119297643 CTCAGCCTCCTCAGTAGCTGGGG + Intergenic
938652266 2:133395760-133395782 CTCAGCCTCCTGAGTAGTTGAGG + Intronic
939521751 2:143239872-143239894 CTCAGCCTCCTAAGTAGCTCAGG - Intronic
940350162 2:152675759-152675781 CTCAGCCTCCTCAGTAGCTGAGG + Intronic
942879589 2:180843329-180843351 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
943157956 2:184209041-184209063 CTCAGCCTCCTGAGTAGCTCTGG + Intergenic
946833824 2:223751730-223751752 CGCAGCCTCCTGAGTAGCTGGGG - Intronic
947599143 2:231434618-231434640 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
947786248 2:232823467-232823489 CTCAGCCACCTCAGTAGCTTGGG + Intronic
948054716 2:235002607-235002629 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1173630982 20:44515235-44515257 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1174002783 20:47386900-47386922 CTCAGCCTCCTCAGTAGCTCTGG - Intergenic
1174605015 20:51754999-51755021 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1175270192 20:57728453-57728475 CTCAGCTGCCTCAGTAGGTCTGG + Intergenic
1176913575 21:14597991-14598013 CTCAGCCTCCCCAGTAGTTAGGG - Intronic
1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG + Exonic
1177152413 21:17468477-17468499 CTCAGCCGCCCCAGTAGCTGGGG + Intergenic
1177362353 21:20089271-20089293 CTCAGCCGCCTGAGTAGCTGGGG - Intergenic
1179143083 21:38744474-38744496 CTTAGCTGCCTCAGTTGTTCAGG - Intergenic
1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG + Exonic
1180662403 22:17479879-17479901 CTCAGCCTCCTGAGTAGCTCAGG + Intronic
1181613744 22:24037417-24037439 CTCAGCCTCCTGAGTAGTTTAGG + Intronic
1181828954 22:25543688-25543710 CTCAGCCTCCTGAGTAGTTGAGG + Intergenic
1184447907 22:44562521-44562543 CTCAGCCGCCTGAGTAGCTAGGG + Intergenic
1184461955 22:44643252-44643274 CTCAGCCGCCTGAGTAGCTGGGG - Intergenic
1184928645 22:47663118-47663140 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
951341271 3:21490280-21490302 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
952351579 3:32543940-32543962 CTCAGCCCCCTGAGTAGTACAGG - Intronic
952441106 3:33330164-33330186 CTCAGCCTCCTCAGTAGCTGGGG - Intronic
953947734 3:47163886-47163908 CGCAGCCGCCTCCGAAGATGGGG - Exonic
954339565 3:49941982-49942004 CTCAGCCTCCTGAGTAGTTAGGG - Intronic
954768575 3:52944634-52944656 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
956022468 3:64947237-64947259 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
957009635 3:74989006-74989028 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
961546737 3:127639449-127639471 TGCAGCCACCACAGTACTTCTGG + Exonic
963369930 3:144386179-144386201 CTCAGCCTCCTGAGTAGCTCGGG + Intergenic
967334692 3:188330697-188330719 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
969670767 4:8588981-8589003 CTCAGCCTCCTGAGTAGTTGAGG + Intronic
970562153 4:17292847-17292869 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
971399424 4:26262324-26262346 CTCAGCCTCCTGAGTAGCTCAGG + Intronic
977934990 4:102791673-102791695 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
984266552 4:177504523-177504545 TGCAGCCTCCTGAGTAGTTGGGG + Intergenic
984947576 4:184982086-184982108 CTCAGCCTCCTAAGTAGCTCGGG - Intergenic
985338183 4:188918649-188918671 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
985347092 4:189017481-189017503 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
985855375 5:2420369-2420391 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
986221593 5:5773318-5773340 GGCAGCCGCCTCACTATCTCAGG - Intergenic
987435037 5:17884090-17884112 CTCAGCCTCCTGAGTAGTTGAGG + Intergenic
987978036 5:25041514-25041536 CTCAGCCTCCTGAGTAGCTCTGG - Intergenic
989050982 5:37320066-37320088 CTCAGCCGCCTGAGTAGCTGGGG - Intronic
989459596 5:41682253-41682275 CACAGCCACCACAGTAGGTCAGG + Intergenic
989560949 5:42850242-42850264 CTCAGCCTCCTAAGTAGTTTGGG - Intronic
992965219 5:81992516-81992538 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
993188340 5:84648366-84648388 CTCAGCCGCCTGAGTAGCTGGGG - Intergenic
994660749 5:102651033-102651055 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
995793969 5:115922855-115922877 CTTAGCTGCCTTAGTAGTTCTGG - Intergenic
995968299 5:117937074-117937096 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
996270227 5:121595942-121595964 CTCAGCCTCCTCAGTAGCTGGGG - Intergenic
998840130 5:146244653-146244675 CTCAGCCTCCTGAGTAGTTTGGG + Intronic
998850948 5:146350181-146350203 CCCAGCCCCATCAGTAGGTCTGG + Intergenic
1000946925 5:167434295-167434317 CTCAGCCTCCTGAGTAGTACGGG - Intronic
1001064730 5:168527514-168527536 CTCAGCCTCCTCAGTAGCTGAGG + Intergenic
1001504673 5:172268630-172268652 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1001618992 5:173066064-173066086 CTCAGCCTCCTGAGTAGCTCAGG + Intronic
1002584113 5:180230713-180230735 CTCAGCCTCCTCAGTAGTGGGGG + Intergenic
1002678638 5:180940974-180940996 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1003217074 6:4123843-4123865 CTCAGCCTCCTGAGTAGTACAGG - Intronic
1004635190 6:17461030-17461052 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1005508018 6:26486939-26486961 CTCAGCCTCCTGAGTAGTTGGGG + Intergenic
1007882900 6:45187016-45187038 CGCAGCCTCCCAAGTAGTTGGGG - Intronic
1014445431 6:121521797-121521819 CTCAGCCTCCTCAGTAGCTAGGG + Intergenic
1015151187 6:130040210-130040232 CTCAGCCTCCTCAGTAGCTGGGG - Intronic
1017104314 6:150873782-150873804 CTCAGCCTCCTGAGTAGCTCTGG + Intronic
1021025653 7:15663447-15663469 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1021548583 7:21844307-21844329 CTCAGCCTCCTCAGTAGCTGCGG - Intronic
1025082220 7:55993621-55993643 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1026468708 7:70676313-70676335 CTCAGCCTCCTCAGTAGTTGGGG - Intronic
1026691009 7:72549975-72549997 CTCAGCCTCCTAAGTAGTTGGGG + Intergenic
1026970016 7:74462120-74462142 CGCAGCCTCCTGAGTAGCTGGGG - Intronic
1027577458 7:79947977-79947999 CTCAGCCTCCTCAGTAGCTGGGG + Intergenic
1029122877 7:98280493-98280515 CTCAGCCTCCTCAGTAGCTGGGG - Intronic
1029550609 7:101235378-101235400 CTCAGCCTCCTGAGTAGCTCAGG + Intronic
1029681893 7:102117279-102117301 CTCAGCCACCTCAGTAGCTGGGG - Intronic
1030977999 7:116151357-116151379 CTCAGCCTCCTGAGTAGTTGGGG + Intronic
1031030628 7:116730531-116730553 AGAAGCCGCCGCAGTAGTCCAGG + Intronic
1033136334 7:138787533-138787555 CTCAGCCTCCTTAGTAGCTCGGG - Intronic
1034065556 7:148133343-148133365 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1035782925 8:2243212-2243234 CTCAGCCCCCTGAGTAGCTCGGG - Intergenic
1037138594 8:15493375-15493397 CACAGCCTCCTGAGTAGTTGGGG + Intronic
1038429857 8:27491324-27491346 CGCCGCCGCCGCAGTGGGTCGGG + Intronic
1040504591 8:48035772-48035794 CTCAGCCTCCTGAGTAGCTCTGG - Intronic
1040838659 8:51759918-51759940 CTCAGCCGCCCCAAAAGTTCAGG + Intronic
1040840550 8:51780093-51780115 CTCAGCCTCCTCAGTAGTTTGGG - Intronic
1042250224 8:66749009-66749031 CTCAGCCGCTTGAGTAGCTCTGG + Intronic
1042527806 8:69782461-69782483 CTCAGCCTCCTGAGTAGTTGAGG - Intronic
1044655600 8:94545006-94545028 CTCAGCCCCCTGAGTAGTTAGGG - Intronic
1045162942 8:99569310-99569332 CTCAGCCTCCTAAGTAGTTAGGG - Intronic
1046170068 8:110493862-110493884 CTCAGCCTCCTCAGTAGGTGGGG - Intergenic
1046897177 8:119485662-119485684 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1049980641 9:901129-901151 CTCAGCCCCCTCAGTAGCTGAGG + Intronic
1052977039 9:34418956-34418978 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1053413953 9:37934412-37934434 CTCAGCCTCCTGAGTAGTTTAGG + Intronic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1059324291 9:113494601-113494623 CTCAGCCTCCTCAGTAGCTGGGG + Intronic
1061556694 9:131374640-131374662 CTCAGCCTCCTGAGTAGTTTGGG + Intergenic
1061938036 9:133869111-133869133 CTCAGCCGCCTGAGTAGCTGGGG + Intronic
1203770509 EBV:47722-47744 CACAGCCGCCTCAGAAGCTGGGG - Intergenic
1189482151 X:41400278-41400300 CTCAGCCTCCTGAGTAGCTCTGG - Intergenic
1189672426 X:43425106-43425128 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
1190109432 X:47580512-47580534 CTCAGCCTCCTCAGTAGCTGGGG - Intronic
1190175803 X:48148351-48148373 CCCAGCCTCCTGAGTAGCTCGGG + Intergenic
1190201513 X:48365667-48365689 CCCAGCCTCCTGAGTAGCTCGGG - Intergenic
1190260550 X:48794130-48794152 CGGAGCCACCACAGTAGTGCTGG - Exonic
1190770552 X:53510593-53510615 CTCAGCCTCCTCAGTAGCTGGGG + Intergenic
1191091409 X:56626453-56626475 CTCAGCCTCCTGAGTAGTTAGGG + Intergenic
1192112911 X:68383478-68383500 CTCAGCCTCCTGAGTAGTTGGGG - Intronic
1193828488 X:86257522-86257544 CTCAGCCTCCTGAGTAGTTAGGG + Intronic
1193938292 X:87650210-87650232 CTCAGCCTCCTTAGTAGTTGAGG + Intronic
1194518788 X:94892572-94892594 CTCAGCCTCCCCAGTAGTTGGGG - Intergenic
1195262392 X:103145574-103145596 CTCAGCCTCCTGAGTAGGTCAGG + Intergenic
1198839987 X:140846201-140846223 CTCAGCCTCCTGAGTAGTTAGGG + Intergenic
1199228387 X:145406935-145406957 CTCAGCCTCCTGAGTAGTTGGGG - Intergenic
1200034613 X:153319422-153319444 CGCAGCAGCCTCAGGAAGTCAGG + Intergenic
1200224127 X:154407710-154407732 CTCAGCCTCCTGAGTAGTTGGGG + Intronic