ID: 1180650003

View in Genome Browser
Species Human (GRCh38)
Location 22:17369665-17369687
Sequence GCGCCCCGCCGCCCCCGCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 18, 3: 107, 4: 597}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180649995_1180650003 20 Left 1180649995 22:17369622-17369644 CCTCGGCTCCTGCACTCGCCGAG 0: 1
1: 0
2: 1
3: 6
4: 153
Right 1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG 0: 1
1: 0
2: 18
3: 107
4: 597
1180649994_1180650003 21 Left 1180649994 22:17369621-17369643 CCCTCGGCTCCTGCACTCGCCGA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG 0: 1
1: 0
2: 18
3: 107
4: 597
1180649992_1180650003 25 Left 1180649992 22:17369617-17369639 CCCGCCCTCGGCTCCTGCACTCG 0: 1
1: 0
2: 4
3: 21
4: 271
Right 1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG 0: 1
1: 0
2: 18
3: 107
4: 597
1180649998_1180650003 12 Left 1180649998 22:17369630-17369652 CCTGCACTCGCCGAGCGGCGGCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG 0: 1
1: 0
2: 18
3: 107
4: 597
1180649993_1180650003 24 Left 1180649993 22:17369618-17369640 CCGCCCTCGGCTCCTGCACTCGC 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG 0: 1
1: 0
2: 18
3: 107
4: 597
1180650001_1180650003 2 Left 1180650001 22:17369640-17369662 CCGAGCGGCGGCAGCAGCGGGAG 0: 1
1: 2
2: 5
3: 46
4: 393
Right 1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG 0: 1
1: 0
2: 18
3: 107
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180650003 Original CRISPR GCGCCCCGCCGCCCCCGCCG AGG Exonic
900088674 1:909972-909994 CCGCGCCGCCGCCCCTGCCCAGG - Intergenic
900157461 1:1208924-1208946 GCCCCCCGCCCCCCGCCCCGTGG - Intergenic
900206621 1:1434440-1434462 GCCCCCCACCCCCCCTGCCGGGG - Intergenic
900589950 1:3454988-3455010 GAGCCCCGCCTCTCCCGCCCCGG - Intronic
900623687 1:3598713-3598735 GAGCCCCCCCCCCCCCCCCGGGG + Intronic
900640032 1:3684222-3684244 CCGCCCCGCCTCCGCCGCCCAGG + Intronic
901066502 1:6497090-6497112 GCGCCGCTCTGCCCCCACCGCGG - Exonic
901088336 1:6625438-6625460 TGGCGCCGCCGCGCCCGCCGCGG + Intronic
901109978 1:6785967-6785989 CCGCCCCGCGGCCCCCACCGTGG - Intronic
901243045 1:7705637-7705659 GAGCTCCGCGGGCCCCGCCGCGG - Intronic
901602081 1:10430419-10430441 GCGGCCCGTCGCTCGCGCCGCGG + Exonic
901797842 1:11691146-11691168 CCGTCCCGCCTCCCCCGCCCTGG + Intronic
902072078 1:13749132-13749154 GCGCCCCTCGCCCCACGCCGCGG + Intronic
902323631 1:15684475-15684497 GCGGCCCCCGGCCCCCGGCGCGG + Exonic
902451462 1:16499247-16499269 CCGCCCCGCCGCACCCGGTGCGG - Intergenic
902585711 1:17437883-17437905 GCGCCCCTCCCCCCCCGCCCCGG - Intronic
902893337 1:19461084-19461106 TCCCCCCCCCGCCCCCGCCCAGG - Intronic
902940888 1:19799715-19799737 GCGCCCCGCCCTCCACCCCGGGG - Intronic
903263393 1:22143011-22143033 GAGCCCCGCCGCGCGCGCCCCGG - Intronic
903468351 1:23568094-23568116 GCGCCCCGGCGGCCCCACCCTGG + Intergenic
903652446 1:24930158-24930180 GCCCCGCGCGGGCCCCGCCGCGG - Intronic
903883764 1:26529773-26529795 GCCGTCCGCCGCCGCCGCCGCGG - Intronic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904252931 1:29237667-29237689 GGGCCCCGCGGCCGCCGCCTCGG + Intronic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904642071 1:31938389-31938411 GCGCCCCGCAGCGCCCCCTGAGG - Intronic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
905517175 1:38570276-38570298 GCGCCCGGCCTGCCCCGCGGTGG - Intergenic
905630461 1:39515390-39515412 GCACCCCGGCGCCCCCCGCGCGG - Intronic
905667300 1:39770799-39770821 GCACCCCGGCGCCCCCCGCGCGG + Exonic
908534766 1:65067170-65067192 GCGCTCCGCCGCCTACCCCGAGG + Intergenic
910760207 1:90725392-90725414 GCGCCCCGCAGACCTCGGCGAGG + Intergenic
910981240 1:92961539-92961561 CCACTCCCCCGCCCCCGCCGCGG + Intergenic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
912471664 1:109911028-109911050 GCGCCCGGCGGCGCCCGGCGCGG - Exonic
913250730 1:116910298-116910320 GCGCCCCGCCGAGCCCTCCAGGG - Intronic
913979466 1:143497090-143497112 GCCCTCCGCCGCCACCGCCGCGG + Intergenic
914808369 1:151008401-151008423 GAGCCCCGCCTCCGCCGCTGGGG + Intronic
914869126 1:151458824-151458846 CCGCCCCCCGGCGCCCGCCGCGG - Intronic
915326916 1:155085481-155085503 CCGCCGCGCCGGCCCCGCCCCGG - Intronic
916535334 1:165698423-165698445 GCTCCACGCGGGCCCCGCCGCGG + Exonic
916548309 1:165827527-165827549 ACGCCTCGCCGCCTCCGCCTCGG + Exonic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
919826574 1:201507347-201507369 GCGCCCTGTCGCCGCCACCGCGG + Exonic
919895703 1:202008452-202008474 CCGCCCCCCCGCCCCCGCACTGG - Exonic
920002252 1:202808006-202808028 GCTCCCCGCCCCCCGCGCCTCGG + Intronic
920179224 1:204122330-204122352 GTGCCCCGCCCCCCCAGCCATGG + Exonic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920385660 1:205568959-205568981 CCGCCCCTCCCTCCCCGCCGCGG + Exonic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
921177910 1:212609369-212609391 GCGCCCCCCCCCCCCCACCCGGG - Intronic
922526642 1:226309250-226309272 GCGCTGCGCTGCTCCCGCCGCGG + Exonic
922539410 1:226407780-226407802 CCGCCCCGCCGCCCGCACAGCGG + Intronic
922821296 1:228487494-228487516 GCTCCCTGCGGGCCCCGCCGAGG + Exonic
922821408 1:228487922-228487944 GCGCCTCTCCGCCCCCGCCCCGG + Intronic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
1064274197 10:13891771-13891793 CCCCGCCGCCGCCCCCGCCGCGG + Intronic
1064354240 10:14603836-14603858 TCGCCCCGCGGCGCCCGGCGTGG - Intronic
1064764754 10:18659552-18659574 GCTCCGCGCAGCCCGCGCCGCGG + Exonic
1064859773 10:19815553-19815575 GGTCCCCGCCGCTGCCGCCGCGG - Intergenic
1065099665 10:22321037-22321059 TCCCCCCGCCGCCCCCCCAGCGG - Intronic
1065140282 10:22713798-22713820 GCCCCCAGCAGCTCCCGCCGGGG + Intronic
1065140462 10:22714416-22714438 GCGCGCCGGGGCCGCCGCCGGGG - Exonic
1065526112 10:26622628-26622650 GCGAACCGCCGCCCCAGGCGTGG + Intergenic
1067478096 10:46579239-46579261 CCGCCCCGCCGCCCCCGCTGGGG + Intronic
1067616644 10:47762548-47762570 CCGCCCCGCCGCCCCCGCTGGGG - Intergenic
1067972810 10:50991711-50991733 CCGACCCGCCCCCGCCGCCGCGG - Intronic
1069024091 10:63521504-63521526 GCGCCCACCCGCCCCGGACGTGG + Exonic
1069470730 10:68687134-68687156 CCGCCCCCCCGCCCCCGCCTTGG + Intronic
1069761812 10:70816247-70816269 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1070162316 10:73873937-73873959 GCGCCCGGCCCCGCCCCCCGCGG - Intronic
1070257638 10:74825542-74825564 GCGCCGCGCTCCCCCCGCCCGGG - Intergenic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1071997554 10:91162972-91162994 CCGCCCCGCCCCCGCCGGCGCGG + Intergenic
1072107761 10:92290796-92290818 CCGCCCCGACGCCACGGCCGGGG + Intronic
1072336657 10:94403482-94403504 GGGCACCGGCGGCCCCGCCGGGG - Exonic
1072409037 10:95183747-95183769 GGGCCCCGCCGCCCCAGCAGGGG + Intergenic
1072784048 10:98268370-98268392 GCGCCCAGCCGCAGCCGGCGGGG + Intergenic
1072891606 10:99329723-99329745 GGGCCACGCCGCCACCGCCCGGG - Exonic
1073051654 10:100671116-100671138 GAGACCCGCCGCCTCCGCCGGGG + Intergenic
1073287877 10:102399364-102399386 GCGCCCCGCCCCCGCCTCCCGGG - Exonic
1073325844 10:102643729-102643751 GAGGCCCGGCGCCCCCGCCGCGG - Intergenic
1074772504 10:116742816-116742838 GCGCGCCACTACCCCCGCCGCGG - Intergenic
1075031964 10:119029820-119029842 GCGCCCCGCTCGCCCCGCCGCGG + Exonic
1075032115 10:119030358-119030380 GGGCTCGGCCGCCCACGCCGGGG - Exonic
1075697490 10:124447633-124447655 GCCCCCCGCCGCCCCTGGCTGGG + Exonic
1075754757 10:124801913-124801935 GCCCCCTGCCGCGCCCGCTGGGG + Intronic
1075841800 10:125511240-125511262 GCCCCTCCCCGCCCCCGTCGCGG + Intergenic
1076749889 10:132537420-132537442 CCGCCCCGCCCCCCGCGCCGCGG - Intergenic
1076751454 10:132545505-132545527 GTGCCCCACTGCCCCTGCCGGGG + Intronic
1076849997 10:133088061-133088083 GCGCTGCGCTCCCCCCGCCGGGG - Exonic
1076878678 10:133229845-133229867 CGCCCCCGCCGCCCCCGCCCGGG - Intergenic
1076998636 11:311262-311284 GCGTCCCGCCCACCCCGCGGGGG - Intronic
1077000107 11:318497-318519 GCGTCCCGCCCACCCCGCGGGGG + Intergenic
1077090625 11:776876-776898 GCGCCCCGCGGCCCCCGTCCTGG - Intronic
1077107917 11:849896-849918 GCGACCCGCTGCCACCGCGGGGG + Intronic
1077107950 11:849976-849998 GCGCCCCGCACCCGCCGCCCCGG - Intronic
1077495324 11:2884382-2884404 GCGCCCGGCCGCGCCCGGGGAGG + Intronic
1077495790 11:2885961-2885983 GCGCCCCGCCCCGCCCCCGGTGG - Intergenic
1077674967 11:4187455-4187477 TCGCGCTGCCGCCGCCGCCGCGG - Intergenic
1077962405 11:7089453-7089475 GCGGGCCGCCGCCACCCCCGCGG - Exonic
1078266246 11:9758161-9758183 GCGCCCCGCCTCCCTCGCCCAGG - Intergenic
1078659824 11:13277857-13277879 ACTCACCGCCGCCGCCGCCGCGG + Exonic
1079205639 11:18412244-18412266 GCCCCCCGCCGGCCCAGGCGCGG - Intergenic
1079250144 11:18781140-18781162 GCACCCCCCCGGCCCCGCCCCGG + Intronic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1079708653 11:23653276-23653298 GAGCCTCCCCGCCCCCGCCATGG - Intergenic
1080283600 11:30585391-30585413 GCGCCCCGCGGCCGCCCCCGGGG - Intronic
1080606641 11:33869639-33869661 GCGCGCCCCGGCCCCCGCCTCGG - Intronic
1081604731 11:44520244-44520266 GCGCCCAGCTGCCCCCGCCTCGG - Intergenic
1081832002 11:46121753-46121775 ACGCCCCACCGCCCCCGGTGGGG - Intergenic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1081851489 11:46277935-46277957 GCGCCCCGCGCCCCCCACCCGGG + Exonic
1082807297 11:57459293-57459315 TCGCCCCGCTGCCCGCGCCGCGG - Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083176110 11:60951451-60951473 GCCGCCCGCCGCCACCGTCGAGG + Exonic
1083437604 11:62653269-62653291 GCGCTCCGCCGCTCGCGCCTCGG - Exonic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083657122 11:64234963-64234985 GCGACCCGCGGCCTCGGCCGAGG + Intronic
1083659806 11:64246782-64246804 CCCCGCCGCCGCCCTCGCCGCGG - Exonic
1083741531 11:64713893-64713915 GCGGCGCCCCTCCCCCGCCGCGG + Exonic
1083801188 11:65047444-65047466 GCGCCCCTCCGTCCCTGCCTCGG - Intronic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1084000941 11:66295205-66295227 GCGCCAGCTCGCCCCCGCCGGGG + Exonic
1084165301 11:67372613-67372635 CCCCGCCCCCGCCCCCGCCGCGG - Intronic
1084265616 11:68003872-68003894 GGCCCGCCCCGCCCCCGCCGGGG + Intronic
1085044040 11:73343205-73343227 GGGCCCAGCCGCCGCCTCCGGGG + Intronic
1088906624 11:114159922-114159944 CCCCCCCGCCTCCCCCGCCCAGG - Intronic
1089242973 11:117097984-117098006 GCTCCGCGCCCGCCCCGCCGCGG + Intronic
1089432715 11:118436697-118436719 GCTTCCCGCCGCCGCCGCCGCGG - Exonic
1089700250 11:120240228-120240250 GTTCCCGGCCGCCGCCGCCGCGG - Intronic
1091558567 12:1594108-1594130 GGGCCCCGCCGCTCCGGCCTCGG + Exonic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1092143599 12:6200262-6200284 CCGCCCCACCGGCCCCGCCCGGG - Intronic
1092280912 12:7097041-7097063 GGGCCCCGCCCCCACGGCCGTGG + Exonic
1092462338 12:8697840-8697862 GCCCCCCGCCCGCCGCGCCGCGG + Intronic
1092796044 12:12111058-12111080 GCGCGCCTCCTCCGCCGCCGCGG + Intronic
1092899498 12:13044823-13044845 CCGTCCCGCCGCCCCCGCCCAGG - Intronic
1093464846 12:19439376-19439398 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1093894662 12:24562708-24562730 GCGGCCCGGCGCCCGCCCCGGGG + Intergenic
1094753558 12:33440045-33440067 GCGGCCCGGCGCCCCTGCCGAGG + Intergenic
1096178600 12:49538886-49538908 CCACCTCCCCGCCCCCGCCGAGG + Intergenic
1096191342 12:49622239-49622261 GCGGCCCGCAGCCGCCGCCGCGG - Intronic
1096495434 12:52037117-52037139 GGTCCCCGCCCCGCCCGCCGGGG + Intronic
1096786126 12:54018243-54018265 GCGCCCCTCACCCCCAGCCGCGG + Intronic
1097192188 12:57224928-57224950 GCGCCCCGCCGCGGCCGGAGCGG + Exonic
1097891387 12:64780865-64780887 TCGCCTCGCCACCGCCGCCGCGG - Intergenic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1098521578 12:71439916-71439938 TCTCCTCGCCGCCCACGCCGTGG + Exonic
1098991176 12:77065836-77065858 GCCCCGCGCCGCCCCCACCTTGG - Intergenic
1100391311 12:94148361-94148383 GCCGCCCGCCGCGGCCGCCGCGG - Intergenic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101606071 12:106248196-106248218 GCGCCCAGCCACCCCCGCGCCGG - Intronic
1101640129 12:106581629-106581651 GCGCTTCCCCGCCCCCGCCGCGG + Intronic
1101986546 12:109451694-109451716 GCGCCCCGCCGCCCCGCCTGTGG + Exonic
1102492953 12:113299717-113299739 GAGCCCCGCCCCTCCTGCCGGGG - Exonic
1102678075 12:114672066-114672088 GGGCCCCGCGGCCGCCGCCATGG + Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1102887510 12:116533328-116533350 TCGCCCCGCCCCCTCCGGCGTGG + Intergenic
1102962044 12:117099288-117099310 GCGCCCCGGGGCCCCCGCCGCGG - Exonic
1103410842 12:120710503-120710525 GGGCCCAGCCGCCGACGCCGCGG - Exonic
1103541995 12:121672620-121672642 GCGCGCCGCGGGCCCGGCCGGGG + Intronic
1103604879 12:122079017-122079039 GCGCCGCGCCACCGCCGCCTCGG + Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103649644 12:122422642-122422664 GCGCCCGCCCGGCCCCGCGGCGG - Intergenic
1103698490 12:122835431-122835453 GCGCCCGGGCCCGCCCGCCGGGG - Exonic
1103764555 12:123271341-123271363 CCGCCCCGCACCCCCAGCCGAGG + Intronic
1103899225 12:124294983-124295005 CCGGCCCGGCGCCTCCGCCGAGG - Intronic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1104602230 12:130161981-130162003 GCACCCCGCGCCCCTCGCCGCGG + Intergenic
1104676272 12:130714443-130714465 GCGCCACGCAGCCCTCCCCGGGG - Intronic
1104929219 12:132329404-132329426 GCGCCCCGCGACCCCAGCCCCGG - Intergenic
1104961487 12:132490345-132490367 GCGCCCAGCCGCCCGCGCCGGGG + Exonic
1104983352 12:132583499-132583521 GCCGCCCGCCGCCCCCGCCTTGG + Exonic
1105454200 13:20525656-20525678 GCGACCCGGCGCCCACCCCGAGG + Intronic
1105557249 13:21459020-21459042 GCGCCCCGCCGCAGTCCCCGGGG + Intronic
1105964530 13:25372324-25372346 GCCCCGCGCCGCCCCCGCCCCGG - Intronic
1106422479 13:29595415-29595437 GAGCCCCGCCGCCGCCGGCTTGG - Exonic
1106735794 13:32586782-32586804 GCGCCCCGCGACCCCCGCCCCGG - Intronic
1106735836 13:32586914-32586936 GCCCGCCGCCGCCGCCGCCCCGG - Intronic
1106735865 13:32587014-32587036 GCGCCCCTCCCCCCGCGCCCCGG + Intronic
1106776714 13:33016451-33016473 GCGCCCCGCCGCGCCGCCCGCGG + Exonic
1107133327 13:36919686-36919708 CCCGACCGCCGCCCCCGCCGCGG + Intronic
1107467550 13:40664833-40664855 GCCCGCGCCCGCCCCCGCCGAGG + Intronic
1107945961 13:45418127-45418149 GCGCCCCGCCGAGCCCGGCCCGG + Intronic
1108063250 13:46553353-46553375 CCGCCCCGCCGCTCCTGCGGGGG - Exonic
1108541659 13:51452261-51452283 GCGCCCGCCCGCCCGCGCGGTGG + Intronic
1110965488 13:81689963-81689985 GCGCGCCTCCTCCGCCGCCGCGG + Intergenic
1111811997 13:93102788-93102810 CCGCCCCGCCCCCGCCGCCATGG - Intergenic
1112290786 13:98143036-98143058 GCGCCCGCCTCCCCCCGCCGAGG + Intronic
1112415382 13:99200209-99200231 GCACCCTGCCCTCCCCGCCGTGG - Intergenic
1112506991 13:99981403-99981425 CCGCCCCGGCGCCCCCGCCGCGG + Intergenic
1112630025 13:101150239-101150261 GCTCCCCGCCACCCCCACCCAGG - Intronic
1113493626 13:110712411-110712433 CCGCCCCGCTGCGGCCGCCGCGG - Intronic
1113517691 13:110915483-110915505 GCCCCCGGCCGCCCCAGGCGTGG - Intergenic
1113541724 13:111115017-111115039 GCGCCCCGCGCCCCTGGCCGGGG - Intronic
1114664556 14:24370033-24370055 GCTCCCCGCTGCCCTCGCCCCGG + Exonic
1116958114 14:50944400-50944422 GCAGCCCGCCGCCCCAGCCATGG - Exonic
1117803162 14:59465148-59465170 GCACTCCGGCGCCCCCTCCGCGG - Exonic
1117841862 14:59869573-59869595 GCGCCCCCCCCCCCCCACCCCGG - Intronic
1118220975 14:63853775-63853797 GCGCCCCCCCGCCCCCGCGGAGG - Intronic
1118339149 14:64880002-64880024 CCGCCTCCCCGCCCCCGCCGCGG - Intergenic
1118971649 14:70642432-70642454 GCGCCCGGCCTCCCCGGCTGGGG + Exonic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1119484916 14:74980924-74980946 CCGCGCCGCCGCCGCCACCGTGG - Intergenic
1119779897 14:77270730-77270752 GCGCCCCAGCGCCCCGGCAGCGG + Intronic
1121050438 14:90816329-90816351 AGGCCCCACCGCCGCCGCCGCGG + Exonic
1121052437 14:90828284-90828306 CCGCCCTGCGGCCCCCGCCGCGG - Intergenic
1121168705 14:91835903-91835925 GCGCGCGGCCGTCCCCGCCTGGG + Intronic
1121690894 14:95876570-95876592 GCGCCCCGCCGCTGCGGTCGCGG + Intergenic
1122221037 14:100239216-100239238 GGGCTCCGCCGCCACGGCCGCGG - Exonic
1122399540 14:101458699-101458721 GCGACCCGCGGCGCCCCCCGCGG + Intergenic
1122582188 14:102777746-102777768 GGGCCCCGCCGCCCAGGGCGCGG - Intronic
1122603024 14:102930565-102930587 TCACCCCGCAGCCCCTGCCGCGG + Exonic
1122689123 14:103523189-103523211 GCCCCTCGCCGCCGCCGCGGGGG - Intergenic
1122862350 14:104588333-104588355 GTGCCCCACTGCCCCCTCCGTGG + Intronic
1123025066 14:105420323-105420345 GCGCCCCCCCGCCACCCCCGCGG - Intronic
1123030614 14:105449522-105449544 GCGCCCGGCCGGCCCGGCTGAGG + Intronic
1123047669 14:105526698-105526720 CAGGCCCGCCGCCCCCTCCGCGG - Intronic
1123396504 15:19943558-19943580 GCCCCCCGCCCCCCCCGCCGTGG + Intergenic
1123630792 15:22258308-22258330 GCGCCCCGGGGCCCGCGCGGGGG - Intergenic
1123684491 15:22787180-22787202 CCGCCCGGCAGCCCTCGCCGTGG + Intronic
1124128911 15:26967868-26967890 GGGTCCCGCCGCCCCCGCCGAGG + Intergenic
1124392187 15:29269474-29269496 GGCCCAGGCCGCCCCCGCCGTGG - Exonic
1124696863 15:31870708-31870730 GCGCCCCTCCGCTCCGCCCGCGG + Intronic
1125508788 15:40282031-40282053 CCGCGCCGCCGCCGCCGCTGCGG - Exonic
1125883892 15:43214336-43214358 GTGCCCCGCCCCCCCAACCGTGG - Intronic
1125999374 15:44194921-44194943 GCGCCGCCCCGCCCCGCCCGCGG - Intronic
1126109484 15:45167149-45167171 CATCCCCGCCGCCCCCGCCCCGG - Intergenic
1126150925 15:45522916-45522938 GCGCCCCGCCTCTCGCCCCGAGG + Intergenic
1126502922 15:49366766-49366788 TAGCCCGGCCGCCCCCGCCACGG - Intronic
1126746407 15:51830016-51830038 GCGCCCCACGTCCCCCGCCCGGG - Intronic
1127257885 15:57306959-57306981 GCGCCGCGCCGCACCCGCTACGG + Intergenic
1127877334 15:63122305-63122327 GCACCCCGCCGCCCCGGGTGGGG - Intronic
1127931647 15:63600991-63601013 GCGCCCGCGCGCGCCCGCCGCGG + Intronic
1127931659 15:63601043-63601065 CCGCCCCGCCGCTGCCCCCGGGG + Intronic
1128067929 15:64775774-64775796 GCGCCCCGCGGCCGGGGCCGGGG - Intergenic
1128143174 15:65316486-65316508 CCGCCCCACCGCCCCCGACTGGG + Intergenic
1128321960 15:66700980-66701002 GCGCCCCGCGGTCACCGCGGGGG + Intergenic
1128370051 15:67033846-67033868 GCGCCCACCGTCCCCCGCCGCGG + Intergenic
1129082389 15:73052410-73052432 CCGCCCCCCCCCCCCCGCCCCGG + Intronic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1129424568 15:75454509-75454531 GCGCCCCGCCTACCCGCCCGCGG + Intronic
1129483027 15:75843129-75843151 GCGCGCCCCCGCCCCCGGCCTGG - Intergenic
1130085968 15:80778988-80779010 GCGCCCCGGGGCGCCCTCCGAGG - Intergenic
1130115303 15:81000956-81000978 GCTCGCCGCCGCCGCCGCCTCGG - Exonic
1131846081 15:96491922-96491944 GCGCACCGCCCCCCGCCCCGGGG - Intergenic
1132093028 15:98960898-98960920 GCGTCACGCCCCCCCCGCCAGGG + Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132560016 16:589366-589388 CCACCCCGCCGCTCCCTCCGAGG + Exonic
1132580101 16:680741-680763 GGGCCCGGCCGGCCCCACCGAGG + Intronic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132683511 16:1153183-1153205 GCGCCCCGCGCCCCGCGCCCCGG + Intergenic
1132734718 16:1379692-1379714 GCGCCCCGCCCCCTCCGCGCTGG + Intronic
1132815957 16:1826694-1826716 CCGCCCCGCCGCACCCACCGAGG + Exonic
1132848051 16:2009727-2009749 GCGCCCCCCGGCCGCCGCCATGG + Exonic
1132934524 16:2473963-2473985 GCCCCCCGCGCCCCCAGCCGCGG - Exonic
1132987812 16:2777184-2777206 GCCCCCCGCCGCCCCCGGCCCGG + Intronic
1133188392 16:4116159-4116181 GTGCGCCGCCGCTCCCGCCGCGG + Exonic
1133220179 16:4316293-4316315 GGGCCCCCCCCCCCCCGCCCCGG - Intronic
1133286749 16:4694254-4694276 GGGCCCCGCCCCCCGCCCCGGGG + Intronic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1134070279 16:11256100-11256122 GCCCCCCGCCGTCCCGCCCGCGG - Exonic
1134784228 16:16926268-16926290 TCCCCCCCCTGCCCCCGCCGGGG + Intergenic
1136241829 16:28949377-28949399 ACCCCCCTCCGCCCCCGCCTTGG - Intergenic
1136261718 16:29082050-29082072 CCACCCCGCCGAACCCGCCGCGG - Intergenic
1137412930 16:48244635-48244657 GCCGCCCGCCGCCGCCGCGGGGG - Intronic
1137454815 16:48610096-48610118 GCGCCCCGCCGCCCGCCCTCAGG + Exonic
1138561371 16:57802560-57802582 GCGCGCCGCCGCCCCCCGCCGGG - Exonic
1139528095 16:67528776-67528798 CCGCCCCGCCGCCCCTCCCCTGG - Intronic
1139549815 16:67666975-67666997 CCGCCTCTCCGCCCCTGCCGAGG - Exonic
1139705430 16:68737693-68737715 GCGGCCAGACGCCCCCGCCTCGG - Intronic
1139826699 16:69762588-69762610 GCGCGCCGCGGCCCGCGCGGGGG + Intronic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141132329 16:81444888-81444910 CCACCCCGCCGCCCCCACCCCGG + Intergenic
1141157785 16:81609373-81609395 CCGCCCCATCTCCCCCGCCGAGG - Intronic
1141538630 16:84700439-84700461 CCTCCCCGCCGCGCCGGCCGGGG + Intronic
1142120467 16:88384025-88384047 CTGCCCCCCCGCCCCCGCCGGGG - Intergenic
1142125834 16:88409865-88409887 GCGCCCCCCCCCCCCCCCCCCGG - Intergenic
1142271868 16:89094021-89094043 GCGCCCGGCCGACCCCGCCGCGG - Intronic
1142474601 17:181487-181509 GCGCCGCCCCGCCCCGGGCGCGG + Exonic
1142552813 17:751593-751615 GAGCGCAGCCGCCCCCACCGCGG + Intronic
1142599162 17:1044733-1044755 GCTCCCCGCCACCCCTGCTGAGG + Intronic
1142637724 17:1268411-1268433 GCCCCCGCCCGCCCCCGCCCGGG + Intergenic
1142683348 17:1562682-1562704 CGTCCCCGCCGCCCTCGCCGCGG + Exonic
1142762358 17:2050051-2050073 CCGCCCCGCCCGCCCCCCCGCGG - Intergenic
1142799538 17:2336971-2336993 GCGCCCCGCCTCCCACGGAGCGG + Exonic
1143164771 17:4892357-4892379 GCGCCCCCCCGCCGCCCCCTCGG + Intronic
1143697166 17:8629847-8629869 GCGTCCTGCCGCGCCCTCCGTGG - Intronic
1144756186 17:17681839-17681861 GCCTCGCGCCGCCCCCGCCCCGG - Intronic
1144873741 17:18385867-18385889 GCACCCCGCCGTCCCCACCCTGG + Intronic
1145694246 17:26774654-26774676 TTGCCCCCCCGCCCCCACCGCGG + Intergenic
1146166472 17:30593649-30593671 ACCCCCCCCCGCCCCCGCCTTGG - Intergenic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1146398683 17:32487368-32487390 GCACCCCGCCGCCCCAGTCCCGG - Intronic
1146787355 17:35731782-35731804 GCCCCCCGGCTCCCCCGCCCGGG - Exonic
1147028363 17:37609223-37609245 GCCCCTCGCCGCCCCCGCGGAGG + Intronic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147907589 17:43833039-43833061 GCCTCCCGCCCCTCCCGCCGCGG + Intronic
1148561814 17:48610720-48610742 CCGCCATGCCCCCCCCGCCGGGG + Exonic
1148899436 17:50865652-50865674 CCGCCCCGTGGCCCCCGCCCCGG + Intronic
1149610520 17:57955302-57955324 TGGCCCCGCCGCCACCGCTGCGG - Exonic
1149994616 17:61400093-61400115 GCGCGCCGCCGCCCGGGCCGGGG + Exonic
1150217211 17:63477357-63477379 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
1151438473 17:74113398-74113420 CCCCGCCCCCGCCCCCGCCGTGG - Intergenic
1151857983 17:76736757-76736779 GCGCCCCGCCCCGCCTCCCGCGG + Exonic
1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG + Intergenic
1152677258 17:81648062-81648084 GCGGCCCGCCGCTCCGGCGGTGG + Exonic
1152708891 17:81860405-81860427 GCGCGCCGACGCCCCCGAGGAGG - Exonic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1152811449 17:82384577-82384599 GCACCCCACCCTCCCCGCCGTGG - Intergenic
1152924487 17:83080866-83080888 CCCCGCCCCCGCCCCCGCCGCGG + Intronic
1153688352 18:7567771-7567793 GCGCCCACCCACCGCCGCCGGGG + Exonic
1153805309 18:8705327-8705349 GCGCGCCGCCAGCGCCGCCGCGG + Intergenic
1153959948 18:10132094-10132116 CCGCCCCGCCCGCTCCGCCGCGG + Intergenic
1154173399 18:12067104-12067126 GCCCCCCGGCCGCCCCGCCGGGG + Intergenic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154954784 18:21242790-21242812 CCCCCTCGCCGCCTCCGCCGGGG - Intronic
1155507335 18:26547004-26547026 GCCCCCAGCCGCCCTCGCTGGGG - Intronic
1157529517 18:48409452-48409474 GCGCCCCGCCTCCCGCGCCGCGG + Intronic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1158259051 18:55587935-55587957 GCTCCGCGCCTCCCGCGCCGCGG - Intronic
1158553910 18:58459648-58459670 GCCCGCCCCTGCCCCCGCCGTGG + Intergenic
1158718234 18:59899767-59899789 GCGCTCTGCGCCCCCCGCCGCGG + Intergenic
1158893502 18:61893968-61893990 CGGCCCCGCCACCCCCTCCGCGG + Intronic
1159008590 18:63037199-63037221 GGGCCACCCCGCCCCCGCCCCGG + Intergenic
1160157004 18:76441927-76441949 GGGCCCCTCCGCCCCCTCCTCGG + Exonic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160674741 19:384021-384043 ACGGCCCGCGGCCCCCGGCGAGG + Intergenic
1160706345 19:531913-531935 GGGCCCCTCCGCCGCCGCCATGG + Exonic
1160719592 19:591317-591339 GCGCCCCGGGAACCCCGCCGCGG - Intronic
1160736085 19:663018-663040 GCCGCCCGCCGCCCCGGCCCGGG + Intronic
1160858711 19:1228711-1228733 GCGCCCCGCGGCCCCCGCCCGGG + Exonic
1160858855 19:1229235-1229257 GCGCCTCGCCGAGCCCGTCGTGG - Exonic
1160860849 19:1236791-1236813 GCAACCCGCCCCCCCAGCCGCGG - Intronic
1160861276 19:1238097-1238119 GCCGCCCCCCGCACCCGCCGCGG + Intergenic
1160910446 19:1471481-1471503 GCTCCCAGCCTCCCCCGCCAGGG - Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160944074 19:1633088-1633110 GGGCCCCGCCCGCCCCGCCCCGG - Intronic
1160966653 19:1749688-1749710 GGGCTCCGTTGCCCCCGCCGCGG - Intergenic
1160967550 19:1753311-1753333 GCGCCCGCCCGCGCCCGCTGGGG - Exonic
1160967914 19:1754574-1754596 GGCCGCCGCCGCTCCCGCCGGGG - Exonic
1161006796 19:1941201-1941223 GCGCTCCGCCGCGCCCGCTCCGG - Exonic
1161161667 19:2765144-2765166 GCACCCGGCCGCCCCTGCCCTGG + Intronic
1161175989 19:2842162-2842184 GGGCGTCTCCGCCCCCGCCGAGG - Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1161849466 19:6731142-6731164 GCGCACCCCCACCCCCACCGTGG + Intronic
1161851389 19:6739686-6739708 GCCGCCCGCCGCCCTCCCCGGGG - Exonic
1162022417 19:7873943-7873965 GCCCACCGCCTCCCCCGCCTCGG + Intronic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162046739 19:8005325-8005347 CCGCCCCGACCCGCCCGCCGCGG + Intronic
1162312194 19:9914032-9914054 GCGCCCCACCACCACCGCGGTGG + Intronic
1162524140 19:11197639-11197661 CCGCCCGGGCGCCCCGGCCGCGG + Intronic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1162741796 19:12777798-12777820 CCGCTCCACCGCCCCAGCCGGGG - Intronic
1162745092 19:12793587-12793609 CCGCCCAGCCGCGCGCGCCGGGG + Intronic
1162951373 19:14073641-14073663 GCCGTCCCCCGCCCCCGCCGAGG - Exonic
1162964553 19:14149769-14149791 GCGGCCCGCCCGCCCCGGCGGGG + Exonic
1163138610 19:15331845-15331867 GCGCGCCGCGGACCCCGCGGCGG + Intronic
1163320476 19:16571904-16571926 GGGCCCGGCCGCCGCCCCCGAGG + Intronic
1163427075 19:17245679-17245701 CCGCCCCTCCCCCCCCGCCACGG - Exonic
1163442442 19:17328731-17328753 GCGCCCCGCAGCCCCCGCTGAGG + Exonic
1163513087 19:17747728-17747750 CCGCCCCGCCCCTCCCTCCGCGG - Exonic
1163597078 19:18226388-18226410 GGGCCCCCCCGCGCCCGCCCCGG - Intronic
1163630966 19:18417747-18417769 GCGTCCCCCCTCCCGCGCCGAGG + Intergenic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1163635094 19:18433880-18433902 GCCCCCCGGCCGCCCCGCCGGGG - Intronic
1163663921 19:18594408-18594430 ACGCCCCGCCGCCCGGGCCCGGG + Exonic
1163720454 19:18896034-18896056 GGGCCCCGTCGGCCCCGCCGCGG + Exonic
1163830712 19:19545978-19546000 GGTCCCCTCCGCACCCGCCGGGG + Exonic
1163843936 19:19628245-19628267 GCGCCCCGCCCCCACCACCTGGG + Intronic
1165058645 19:33194469-33194491 GCGCCCCGGGAGCCCCGCCGCGG - Intronic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165242988 19:34482062-34482084 GGCCCCCGCCGCCCCCGACCGGG - Exonic
1165495821 19:36151598-36151620 GCGCCCCGCCTGCCCCGGCTCGG + Intronic
1165928588 19:39342377-39342399 GCGCGCGGCGGCCCCCGTCGGGG + Intronic
1165941729 19:39417873-39417895 GCGCCCCGGCGCACCTGGCGGGG + Intronic
1166106685 19:40601237-40601259 GCGCCCCCGCGCGGCCGCCGGGG + Intronic
1166366407 19:42280630-42280652 GCGCCCCGCCGCGGCCCGCGTGG + Intronic
1166882922 19:45940163-45940185 GCCCCCGGCCGCCCCGGCCGCGG + Exonic
1167074387 19:47239908-47239930 GTTCCCCGCCCCCCGCGCCGAGG - Intergenic
1168073072 19:53963340-53963362 AGGCGCCGCCGCCCCCGCGGTGG - Exonic
1168315152 19:55481868-55481890 GCACGGCGCCGCCCCCGCCCCGG + Exonic
1168335043 19:55592779-55592801 CCTCCCCGCCGCCCTCACCGTGG + Exonic
1168345474 19:55648476-55648498 GCGCCCAGCCCCCACCACCGGGG + Exonic
1168401684 19:56088989-56089011 CCGGCCCGCCTCCCCGGCCGCGG - Exonic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
925959853 2:9004051-9004073 GCGCCTCGGCGCCCTCGCCCGGG - Intergenic
926216944 2:10911774-10911796 GCGCACCGCCGGCCCCTCCTCGG - Intergenic
926250948 2:11155299-11155321 CCGCCCCGCCCCTCCCGCCCGGG - Intronic
926250965 2:11155328-11155350 CCGCCCCGCCCCTCCCGCCCGGG - Intronic
926422931 2:12716832-12716854 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
927181097 2:20447284-20447306 CGCCCCCACCGCCCCCGCCGCGG + Exonic
929452884 2:42048343-42048365 GCTCCCCGCGGCCCCCGCGACGG - Exonic
930011420 2:46941034-46941056 CCCCGCCGCCGCCCCCGCCGCGG - Intronic
930089403 2:47520883-47520905 CCGCCCGTCCGCCCGCGCCGGGG - Exonic
930700834 2:54456689-54456711 TCCCCGCGCCGCCCCCGCCCGGG - Intronic
931517805 2:63059861-63059883 GTCCCCCGCCGCCCCCGGCCCGG - Intergenic
932306353 2:70706358-70706380 CCTCGCCGCCGCCCCCGCAGGGG - Exonic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934618524 2:95790073-95790095 GCGCCCCACAGCCCCCGCCCAGG - Intergenic
934642369 2:96034486-96034508 GCGCCCCACAGCCCCCGCCCAGG + Intronic
936467204 2:112764364-112764386 GCGCACAGCCTCCCCCGCCCAGG + Intronic
937152368 2:119694741-119694763 GCTCCCCGCCACCCTCACCGGGG - Intergenic
938034834 2:128027499-128027521 GCTCCCCGCCCCCTTCGCCGGGG - Intronic
938392412 2:130916241-130916263 GCGCCCCCGCGTCCCCGCCTTGG + Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
940265134 2:151828359-151828381 AGGCCCCGCCGCTGCCGCCGCGG + Exonic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
941951310 2:171160202-171160224 CCCCCCCGCCCCCCCCGCCCCGG - Intronic
942450919 2:176107631-176107653 CGCCGCCGCCGCCCCCGCCGGGG - Exonic
942748634 2:179264362-179264384 CCGCCCCGCGGCCCGCGCAGGGG + Intronic
942890521 2:180981095-180981117 CAGCCCAGCCGGCCCCGCCGCGG - Intronic
943060499 2:183037949-183037971 GGGCCCGCCCGCCTCCGCCGCGG + Intronic
943669773 2:190648807-190648829 CCTTCCCGCCGCCCCCTCCGCGG - Intronic
944221718 2:197310384-197310406 CCGCCGCGCCGTCCCCGCCCTGG - Intronic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
944843117 2:203642957-203642979 CCTCCCCCCCGCCCCCTCCGTGG - Intergenic
945102506 2:206274954-206274976 GCCGCGCCCCGCCCCCGCCGCGG - Intronic
945241554 2:207681459-207681481 CCCCGCCGCCGCCCTCGCCGCGG + Intergenic
945673761 2:212832133-212832155 GCGCCCTGCCTCCGCCGCCATGG + Intergenic
945833111 2:214809676-214809698 GCGGCCCGCCGTCCCAGACGCGG - Exonic
946185641 2:217979011-217979033 GCCCCCTGCCTCCCCGGCCGCGG - Intronic
946354924 2:219178483-219178505 GCGTCCCACCGCCTCGGCCGTGG - Exonic
946386878 2:219388581-219388603 GCGACCCGCAGCCGCCGCCAGGG + Intronic
946395569 2:219442210-219442232 CCGGCCCGCCGCCCTCGGCGGGG - Intronic
946422214 2:219571303-219571325 GCGCCCCGACCCCGCCGCCCCGG - Intronic
947117942 2:226791672-226791694 GCCCCGCCCCGCGCCCGCCGCGG + Intronic
947506658 2:230713050-230713072 CCGCGCAGCCGCCGCCGCCGCGG + Exonic
947641162 2:231708602-231708624 GCGCGCCTCCTCCGCCGCCGCGG + Exonic
948115939 2:235494388-235494410 GGGGCCGGCCGCACCCGCCGCGG + Exonic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948487251 2:238288752-238288774 CAGCGCCGCCGCCTCCGCCGCGG + Intronic
948801632 2:240435900-240435922 GGGCGCCGCCGGCCCCGCCATGG + Exonic
1168756772 20:324177-324199 CCACCCCGCCCCCCGCGCCGCGG + Intergenic
1168760643 20:347582-347604 GCGCCCCTTCTCCCCCGCCCGGG + Intronic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169220595 20:3820255-3820277 GCGCCCCCTCGCGGCCGCCGGGG + Intergenic
1172320929 20:33994462-33994484 GTGCCCCGCCCCGCCCGGCGAGG + Intronic
1173166079 20:40688242-40688264 GCCGCCCGCCGCCGTCGCCGAGG + Exonic
1173250575 20:41362317-41362339 GGGCCCCGGTGCCCCGGCCGGGG - Exonic
1173626339 20:44475848-44475870 GAGCCCCGCCTCCCACGCCCTGG + Intergenic
1173741734 20:45406662-45406684 TCGCTCCCACGCCCCCGCCGCGG + Intronic
1173803732 20:45911092-45911114 GGGCCCCGCCTCCACCGCCGAGG + Intronic
1174607036 20:51768456-51768478 GCGCCGCGCCGCCCCGGGGGAGG + Exonic
1174607081 20:51768621-51768643 GCGCCGCGCCGCGCCTGCCACGG + Exonic
1175715823 20:61253410-61253432 CCGCCCCTCCGCCTCCGCCCAGG - Intronic
1175795355 20:61767325-61767347 GGGCCCTGCTGCCCCCACCGGGG + Intronic
1175847315 20:62065570-62065592 AGGGCCGGCCGCCCCCGCCGAGG - Exonic
1175856278 20:62122541-62122563 GCCCGCCGCCGCCTCCGCCTGGG - Exonic
1176062639 20:63178995-63179017 CCGCCCCGCCGCCAGCACCGCGG - Intergenic
1176131726 20:63499184-63499206 GCGCCCCGCCCCCTCCCGCGCGG - Exonic
1176221155 20:63969853-63969875 GCGCCCCGCGCCCCCCGCCCCGG - Intronic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1177833841 21:26169727-26169749 GCGACACCCCGCCCTCGCCGTGG - Intronic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1179054181 21:37916218-37916240 GCGCCCCTCCGCCCCTCCCTTGG - Exonic
1179150744 21:38806186-38806208 GCCCCCCGCGACCCCCGCCCAGG - Intronic
1179209344 21:39312938-39312960 GCCCCCCGCCCCCCCCGCGCCGG - Intronic
1179213654 21:39348834-39348856 GCGCCCCGCCGGGCCCCGCGAGG - Intronic
1179411812 21:41168239-41168261 GCGCCCCCCGGGCCCCGCCGTGG + Exonic
1179786464 21:43733258-43733280 CCCCCCCGCCCCCCCCGCCCTGG + Intronic
1179882575 21:44299774-44299796 GCGCCCCTTCGCCAGCGCCGAGG - Intergenic
1179988035 21:44932087-44932109 GCGCGGAGCCTCCCCCGCCGCGG + Intergenic
1180534540 22:16386771-16386793 GCCCCCCACCCCCGCCGCCGCGG + Intergenic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1180843446 22:18969832-18969854 ACGCCCCCCCGGCCCCGCTGGGG + Intergenic
1180843598 22:18970352-18970374 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180843612 22:18970378-18970400 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180950449 22:19718414-19718436 GCCCCCCGCCGCGCGCTCCGCGG + Intronic
1181067354 22:20313216-20313238 GCACCCCCCCGCCCCCGCCCAGG + Intergenic
1181167528 22:20991663-20991685 GCTCCCCACCACCCCCGCAGCGG + Exonic
1181280593 22:21717130-21717152 GCCCCCCGCCCCCCCAGCCCCGG - Intronic
1181457939 22:23070309-23070331 GCGCCGCGCCGCCGCCGGCAGGG - Intronic
1181467577 22:23118470-23118492 CCGCCCCGCCCCACCCCCCGCGG + Intronic
1181934620 22:26429610-26429632 CGCCGCCGCCGCCCCCGCCGAGG + Intronic
1182335556 22:29581123-29581145 GCGCCCCGCCTCCGCCACCAGGG - Exonic
1182576475 22:31276574-31276596 CCCCGCCGCCGCCCTCGCCGCGG + Intronic
1182586323 22:31346097-31346119 CCGCTCCGGCGCCCCCGCCCCGG - Exonic
1182665761 22:31958711-31958733 GAGCCCCGCCCCCCATGCCGGGG + Intergenic
1183525001 22:38317492-38317514 CCGGCCCGCCGCCGCCGCCCCGG + Intronic
1184451333 22:44584431-44584453 GCGCCCCCCTGCCCCAACCGTGG - Intergenic
1184698021 22:46150541-46150563 GCCGCCCGCTGCCCCCGCCGCGG - Intronic
1185055395 22:48576243-48576265 GCCCCCGCCCGCCCCCTCCGCGG + Intronic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
950729854 3:14947827-14947849 GCGCCCTGCCCTCCGCGCCGGGG + Intronic
952942608 3:38455263-38455285 ACGTCCCGGCGCGCCCGCCGGGG - Intronic
953518825 3:43622087-43622109 AGGCCCCGCCTCTCCCGCCGCGG - Intronic
953598342 3:44338525-44338547 GCGCCCTGCCGCCGCCGGAGCGG + Exonic
954437492 3:50503736-50503758 GCCCCCGCGCGCCCCCGCCGCGG + Intronic
954615641 3:51967603-51967625 CCGCCCCGCCCCGCGCGCCGCGG + Intronic
954803197 3:53199314-53199336 GAGGCCAGCCGCCCCAGCCGAGG + Intergenic
955368741 3:58332960-58332982 ACGCCCGGCCGCCGCCGCCTAGG - Exonic
956659154 3:71582371-71582393 CGGCGCCGCCGCCACCGCCGTGG + Intronic
956678190 3:71754300-71754322 GCCCGGCGGCGCCCCCGCCGCGG - Exonic
956761304 3:72447214-72447236 GCGCCCCGCCTCCGCCCTCGCGG - Intergenic
958425414 3:93973719-93973741 GCGCCCCGCAGCGCCCACCCAGG + Exonic
958638517 3:96776801-96776823 CTGCCCCGCCGCGCACGCCGCGG + Intergenic
958711218 3:97719093-97719115 CCCCCCCACCCCCCCCGCCGCGG + Intronic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
960120872 3:113947885-113947907 GTGCCCCGCCCCCGGCGCCGGGG - Exonic
961305611 3:125958065-125958087 GCCCCCCGCCCCCCCCCCCAGGG + Intergenic
961792287 3:129384893-129384915 GCCCCCCCCGCCCCCCGCCGAGG + Intergenic
963091402 3:141486936-141486958 CCGCCCCGCCCCGCCCGCCGCGG - Intergenic
963236720 3:142963603-142963625 GCGCGCGGCCGCCCGCGCTGCGG + Exonic
963602579 3:147390951-147390973 ACGCGCCGCCACCGCCGCCGAGG + Exonic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
965520375 3:169663799-169663821 GCCCCCCGCCGCCCTCCCCGCGG - Intergenic
965609194 3:170526887-170526909 GCTCCCCACTGCACCCGCCGGGG + Exonic
966182290 3:177197848-177197870 CCGCCCCGCCCCCACCGCCGCGG + Intergenic
966866136 3:184260058-184260080 GCGCCCCCCCGCCCCGGCCCAGG - Exonic
967857805 3:194131445-194131467 GCGTCCCCCCACCCCCGCCCCGG - Intergenic
967904030 3:194486585-194486607 CCGCCGCGCCGCCTCCTCCGCGG + Intronic
967904181 3:194487040-194487062 GCGCCCCTCCGCCCTCCGCGCGG - Intronic
968230661 3:197003067-197003089 GCTTCCCGCCGCCCGCCCCGCGG - Exonic
968382269 4:107397-107419 GCGCCCCGCAGCCCCGCACGAGG + Intergenic
968514981 4:1012014-1012036 GCCCCTCCCCGCCCCCGCCCCGG - Intronic
968573209 4:1353268-1353290 GTGCCCCGCCGCCCGCTCTGGGG - Exonic
968659642 4:1793711-1793733 GCCCGCCGCCGCCGCCGCCCAGG - Intronic
968809534 4:2793585-2793607 GCGCCCCTCTGGCCCCGCGGCGG + Intronic
968835792 4:2963577-2963599 GCCCCTCGCCGCCGCGGCCGGGG - Intergenic
968850737 4:3075627-3075649 CTGCCCCGCCACTCCCGCCGAGG - Intronic
968907978 4:3463325-3463347 TCGCCCCGGCGCCCCAGCCCAGG - Exonic
969460492 4:7326433-7326455 CAGCCCTGCCGCCCCAGCCGTGG + Intronic
969714179 4:8860593-8860615 GAGCCCCGCGTCCCCCGCCACGG + Intronic
971635141 4:29047799-29047821 CCCAGCCGCCGCCCCCGCCGTGG + Intergenic
972396453 4:38663529-38663551 GCGCCGCGCCGCGCCGGCCGCGG + Intergenic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975870774 4:78776363-78776385 GGGCCCCGCCGCCCGCTCCGCGG - Exonic
976390018 4:84497707-84497729 GCCCGCCGCCGCCGCCGCCCGGG - Exonic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
978795803 4:112706186-112706208 CCACCCCGCCGAACCCGCCGCGG + Intergenic
979455464 4:120922287-120922309 GCACCCCGCCGCCACCTACGTGG + Intronic
979674692 4:123398406-123398428 CCGCCTCGCCCTCCCCGCCGCGG + Intronic
980698775 4:136395589-136395611 CCCCCCCGCCCCGCCCGCCGAGG + Intergenic
980930412 4:139177932-139177954 GCGCGACGCCGGCCCCGCCCCGG + Intergenic
981128402 4:141132623-141132645 GCCGCCCGCCGCCCCGGCCCCGG + Exonic
982157295 4:152535479-152535501 GGTCCCCGCCCCCCCGGCCGGGG + Exonic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984923410 4:184785594-184785616 CCCCCCCCCCGCCCCCGCCCAGG - Intronic
985467702 5:12989-13011 AAGCCACCCCGCCCCCGCCGGGG - Intergenic
985593620 5:777904-777926 ACGCCCCCCCTCCCCCGCCCCGG - Intergenic
985660817 5:1155819-1155841 GGGCCCCGCACCCCCCGCCGCGG + Intergenic
985696695 5:1344951-1344973 GCGCGCCACCGCCACCGCCGCGG + Exonic
985897317 5:2756445-2756467 GCGCCCCGCCCCCTCCCCCCAGG + Intergenic
986330680 5:6714138-6714160 CCGCCCGGCCGCCCCCGCCGCGG - Intergenic
986330851 5:6714717-6714739 GGGCCCCGCCCCCGCCCCCGCGG - Intronic
986912513 5:12574602-12574624 GCTTCCCCCCGCCCCCGCCGTGG - Intergenic
987088103 5:14487912-14487934 GAGCCCAGACGCCCCCGCCAAGG + Exonic
988796468 5:34656895-34656917 GCGCCTCGCTGCCCCCGCGTCGG + Intronic
990557778 5:56952294-56952316 GCCCCTCGCCGCCCCCGCGCCGG + Intronic
991054385 5:62306155-62306177 GCGCCCCGCCTCCCCAGCGTCGG + Intronic
991298200 5:65103117-65103139 GCGCCCCGACGCTGCCGGCGCGG + Intergenic
992102321 5:73419502-73419524 GCGCCCGGCCGCTCCCGCGCCGG - Intergenic
992269940 5:75053567-75053589 GCAACCCTCGGCCCCCGCCGGGG - Intergenic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
994353835 5:98773860-98773882 GCGCCCCGCTGCTGCCGCCGCGG + Intronic
997177793 5:131797043-131797065 GCGCCCCGCCCCGCGCGCCGTGG - Intronic
997584323 5:135035475-135035497 GCGCCTTGCCGCCCCAGCTGTGG - Intronic
997963333 5:138338585-138338607 GCGCACCCCCCCCCCCGCCCCGG + Intronic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
997975410 5:138439065-138439087 GCGCTCCGCTGCCCCCGCGGCGG + Exonic
997984480 5:138492013-138492035 GCGCCCCTGCGCCCCGCCCGCGG + Intergenic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998435918 5:142108795-142108817 AAGCACCGCCGCCGCCGCCGAGG - Exonic
999248196 5:150166718-150166740 GCCGCCCGCGGCCCCAGCCGAGG - Intergenic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1002281209 5:178131031-178131053 TCGCCCCGCAGCCCCGGCCCCGG - Exonic
1002526766 5:179819547-179819569 GAGCCACGTGGCCCCCGCCGAGG - Intronic
1002662776 5:180802849-180802871 CCGCCCCGCCCCGCCTGCCGGGG - Intronic
1002666771 5:180831184-180831206 GCCCGCCGCCGCCGCCGCCTCGG + Intergenic
1002928781 6:1619814-1619836 GCGGCCCGCCACTCCCGCCCGGG + Intergenic
1003545013 6:7051855-7051877 GCGCCGCGCAGCCCCCGGCCCGG + Intergenic
1003869406 6:10390302-10390324 CAGCCTCCCCGCCCCCGCCGGGG + Intergenic
1004220602 6:13743305-13743327 CGGCCCTGCCGGCCCCGCCGGGG + Intergenic
1004241349 6:13925045-13925067 GCGTCCCGCCGACCCCTCCCCGG - Intronic
1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG + Intergenic
1006472662 6:34237336-34237358 CCCCTCCGCCGCCGCCGCCGCGG - Intronic
1006477157 6:34263694-34263716 CCGCCGCGCCGCCCGCTCCGAGG + Intergenic
1007444511 6:41895019-41895041 GCCTCCCGCCGCCCCCGCCCCGG + Intronic
1007451140 6:41941081-41941103 GGGCTCGGCCGCCCCCGCCCGGG - Intronic
1007644358 6:43369144-43369166 GGGCCTCGCCGTCCCCGCCACGG - Exonic
1007902045 6:45422031-45422053 CCGCGCCGCCGCCTCCGCGGCGG - Intronic
1011044401 6:83065924-83065946 GCGCCCCGCCCCGGCCTCCGGGG - Intergenic
1011128735 6:84033707-84033729 GCCCCGCGCCGCCTCCGCTGCGG + Intergenic
1011258671 6:85450029-85450051 GGGCCCCGCCCCTCCAGCCGGGG + Intronic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1013459057 6:110358120-110358142 GCGCCCCGCCGGGCCCGGCCTGG - Exonic
1013538774 6:111087631-111087653 GGGCTCCGCCGCCCTCGCCTCGG + Exonic
1014586328 6:123202227-123202249 GTCCCCCCCCGCCCCCACCGTGG + Intergenic
1014632416 6:123803463-123803485 GCTCCCTGCCGCCCCCTCCCAGG - Intergenic
1015181511 6:130366242-130366264 GCGCCCCTATGCCCGCGCCGGGG - Intronic
1015845810 6:137519730-137519752 CCGCCCCCCCGCCCCTGCCATGG + Intergenic
1015910186 6:138161872-138161894 CCGCCCCGCCCCGCCCGCCTGGG - Intergenic
1017324582 6:153130967-153130989 CCGCGCAGCCGCCCCCGCCGGGG + Intronic
1017497635 6:154995559-154995581 GCGCGCCGCCCCGCCCGCAGGGG - Intronic
1017877404 6:158536416-158536438 GCGCCCATCCGCCGCCGCCCCGG - Exonic
1017877650 6:158537224-158537246 CCGCCTCGCCGCCCCCGCTCGGG + Intronic
1018955942 6:168410717-168410739 GCTCCCCACTGCCCCCGCCCTGG - Intergenic
1019197811 6:170292091-170292113 GCTCCCCTCCGCGCGCGCCGCGG + Intergenic
1019343753 7:519994-520016 GGGCCCGGGCGCCGCCGCCGCGG + Intronic
1019536261 7:1531162-1531184 GCGCCCTGGGGCCCCCGGCGCGG - Intronic
1019562202 7:1664708-1664730 GCGCCGCGCCCCTCCGGCCGGGG - Intergenic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1021086002 7:16421386-16421408 TCGCCCCGCGACCCCGGCCGAGG - Intergenic
1021827888 7:24573163-24573185 GGGCCCCGCCCCTCCCGCCGCGG - Intergenic
1022410447 7:30135425-30135447 GCGCCCCGCGTGCTCCGCCGGGG + Intronic
1023842272 7:44104317-44104339 AAGCCCCGGCGCCCCCGCCCCGG + Intergenic
1023937261 7:44748854-44748876 TCGCGCCGCCGCCCGCTCCGAGG - Intronic
1024802854 7:53101125-53101147 ACCCCCCGCCCCCCCCGCCGCGG + Intergenic
1025198620 7:56949188-56949210 GCGCCCCGCTCCCCCAGCCTCGG + Intergenic
1025673332 7:63627748-63627770 GCGCCCCGCTCCCCCAGCCTCGG - Intergenic
1025738956 7:64181636-64181658 GCGCCGGGCCGGCCCCGCGGTGG + Intronic
1025929254 7:65981629-65981651 GCGCCACTCCGCCCCAGCCTGGG + Intronic
1027219835 7:76206810-76206832 GCCTCCTGCCGCCCCCGCCCTGG + Intronic
1029445949 7:100612840-100612862 GCGCCCCGGGACCCCCGCCCAGG - Exonic
1030176609 7:106660842-106660864 GCGCCCGGTCGCCCCGGCCACGG - Exonic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1032011852 7:128352170-128352192 TGGCCCGGCCGCGCCCGCCGCGG - Exonic
1032117003 7:129126308-129126330 GCGAGCCGCCGCCGCTGCCGAGG - Intergenic
1032194667 7:129781941-129781963 GCGCCCCGCCCCCCGCGCTCCGG + Intergenic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1034224971 7:149474971-149474993 GCACCCCGCGGCGCCCCCCGGGG - Exonic
1034951079 7:155297619-155297641 GCGCCCCGCAGTCCGTGCCGAGG + Intergenic
1035153186 7:156892583-156892605 GCGCACCGCAGCCCTCCCCGCGG + Intronic
1035476290 7:159145726-159145748 CCGCCCCGCCGCGCCCCACGCGG + Intergenic
1036390296 8:8318864-8318886 GCCCGCCCCCGCCCCCGCCCCGG - Exonic
1036930461 8:12951508-12951530 GGGCCGCGCCCGCCCCGCCGGGG - Intronic
1037903826 8:22703770-22703792 GCCCCCCGCCGCCCGGGCCGCGG + Intergenic
1038613202 8:29071980-29072002 GCCCACGGCCGTCCCCGCCGAGG - Exonic
1039903131 8:41767189-41767211 GCGCGCACCCGCACCCGCCGGGG + Intronic
1040585291 8:48735174-48735196 GCGCCCAGAGACCCCCGCCGCGG - Exonic
1041552597 8:59118792-59118814 CCGCCAAGCCGGCCCCGCCGCGG + Intronic
1042859086 8:73295153-73295175 GCGCCCCGCGCCCGCCCCCGAGG - Exonic
1042916178 8:73878382-73878404 GCCCCCCGCCGCCCCTGCCCCGG + Intronic
1043464035 8:80487185-80487207 GACCCCCGCCGCCGCCGCCTCGG - Exonic
1044335976 8:90985232-90985254 GCCCCCCGCCGCCGCCACCGCGG - Exonic
1044712804 8:95073412-95073434 GCGCCCCGCTGCCCCAGCCGGGG + Intronic
1045222577 8:100213258-100213280 GCCCGCCGCCGCCGCCGCAGAGG - Exonic
1045247981 8:100460040-100460062 GCTCCCAGCCGCCCCAGGCGTGG + Intergenic
1045443635 8:102239072-102239094 CGGCCCCGCCTCCCCCGCCTCGG + Exonic
1045489179 8:102656045-102656067 TCGCCGCGCCTCCCCGGCCGCGG - Intergenic
1045815100 8:106270059-106270081 GCCTCCCCCCGCCCCCGGCGTGG + Intergenic
1046031468 8:108787614-108787636 CCGCCCCACCCCGCCCGCCGTGG - Exonic
1047100163 8:121667533-121667555 CCCCCGCCCCGCCCCCGCCGGGG - Intergenic
1047292286 8:123541109-123541131 CCGCCCCGCCGCCCCCGTCGCGG - Exonic
1049405268 8:142449580-142449602 GCGCCGCCCCGCCCCCGGCTCGG + Exonic
1049759863 8:144327041-144327063 GCGGCCCGCAGCCCCGGCCCTGG - Intergenic
1049867885 8:144950656-144950678 GCGCGGCTCCGCCCCCGCCCGGG + Intronic
1051079694 9:13279665-13279687 GGGCCCCGCCACCGCCTCCGCGG - Intergenic
1051287394 9:15510775-15510797 TCGCCCCGCCCCCCCCTCGGTGG - Intronic
1053011793 9:34637791-34637813 GCGCTCCCCCGCCACCGCCGTGG + Intronic
1053072927 9:35111609-35111631 GTGCCCCACCACCCGCGCCGCGG + Intronic
1053239945 9:36487408-36487430 GCCCCCCACCGCCGCCGCCCCGG - Intronic
1053381223 9:37650942-37650964 GGGCTCCGCCTCCCGCGCCGAGG - Intronic
1053434869 9:38068120-38068142 GCGGCCCGCCACGCCGGCCGAGG - Exonic
1054308897 9:63450848-63450870 GCCCCCCCCCGCCGCCGCCACGG - Intergenic
1054440859 9:65258896-65258918 ACCCCCCCCCGCCGCCGCCGCGG - Intergenic
1054489418 9:65762591-65762613 CCCCCCCCCCGCCGCCGCCGCGG + Intergenic
1054798649 9:69325452-69325474 GCGCGCTGCAGCCCCCGTCGCGG + Intronic
1054842626 9:69759823-69759845 GCGCGCCTCCGCCGCCTCCGAGG - Intronic
1055090979 9:72364784-72364806 GCGCCCTGGTGCCGCCGCCGCGG + Intronic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057619106 9:96619421-96619443 GCGCGCCCGCGCGCCCGCCGAGG + Exonic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG + Exonic
1057773086 9:97984207-97984229 GCGCCGGGCCGCGCCCGCCCAGG - Intronic
1057781797 9:98056584-98056606 CCGCCCCGCCGCCCTTCCCGCGG + Intergenic
1058053275 9:100427213-100427235 AGGCCCCGCCGCGCGCGCCGCGG - Intronic
1058225090 9:102350391-102350413 GCGCCCCCCAGCCCCCGACAGGG - Intergenic
1058412313 9:104747632-104747654 CCGCCGCGCCTCCCGCGCCGGGG + Intergenic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060514572 9:124257904-124257926 GCGCCCGCCCCTCCCCGCCGCGG - Intronic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1061190756 9:129081285-129081307 GTCCCCCGGCGCCCCCTCCGCGG - Intronic
1061231614 9:129319046-129319068 GCCCCCCGTCGCCCCCGCCCTGG + Intergenic
1061237600 9:129351708-129351730 GAACCCCCCCGCCCCCGCCTTGG + Intergenic
1061293592 9:129665833-129665855 GACCCCCGCCGGCCCCCCCGGGG + Exonic
1061608943 9:131733353-131733375 CCCCCCCCCCGCCCCCGCCCCGG - Intronic
1061961664 9:133991954-133991976 GAGCCCGGCCGCCCCAGCCAGGG + Intronic
1062022605 9:134326535-134326557 GCTCCCCGCCGCCCGGGCCCGGG + Intronic
1062146536 9:134992511-134992533 GGCCCCCCCCCCCCCCGCCGCGG + Intergenic
1062314821 9:135961443-135961465 GCGCCTCGCTCCCGCCGCCGGGG + Intergenic
1062332300 9:136050053-136050075 GCAGCCGGCCGCCGCCGCCGCGG - Exonic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062349600 9:136132558-136132580 GCGCCCCGCCGCCCAGTCCTGGG + Intergenic
1062499673 9:136846984-136847006 CCGCGCGGCCGCCCCCGGCGCGG + Exonic
1062529043 9:136991983-136992005 GCCCCCTCCCGCCCCCGCCCCGG - Intergenic
1062556352 9:137114868-137114890 GCGCCCCGCGGCCGCTGCCCAGG + Intronic
1062596269 9:137301313-137301335 GCGCCCCGCCCCCACCCGCGAGG + Exonic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185469416 X:373717-373739 GCGCCCCGCCGGCCCCGGCCCGG - Intronic
1185737376 X:2503742-2503764 GCACCCCCCAGCCCCTGCCGAGG + Intergenic
1186747369 X:12583658-12583680 GCGCCCCGCCGCCCTGTCTGCGG + Intronic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1189322646 X:40096102-40096124 GCGCCTCGCCCTCCCCGCCTTGG + Intronic
1189534512 X:41923174-41923196 CGGCCCCGCCGCCCGCGCCGGGG - Intronic
1192657117 X:73003464-73003486 GGGCCCCGCAGCCTCCGCTGCGG - Intergenic
1192665003 X:73079537-73079559 GGGCCCCGCAGCCTCCGCTGCGG + Intergenic
1197745706 X:129931574-129931596 GCGCCCCCCCGCCCCCAACAGGG + Intergenic
1197745996 X:129932465-129932487 GCGCTCCGCCCTCCCCCCCGCGG + Intergenic
1197774637 X:130111061-130111083 CCGCCCCGGCCCGCCCGCCGCGG + Intergenic
1200128824 X:153830400-153830422 GCGGCCCGCCCCCCGCGCCAGGG - Exonic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic
1200229513 X:154437072-154437094 GCGCCCCGCCGCAACCGGCAGGG - Exonic