ID: 1180651079 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:17377693-17377715 |
| Sequence | AAATATGCAAATATGGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180651079_1180651084 | -3 | Left | 1180651079 | 22:17377693-17377715 | CCTTCCTCCATATTTGCATATTT | No data | ||
| Right | 1180651084 | 22:17377713-17377735 | TTTCATGGGATGCTATCCCTTGG | 0: 1 1: 0 2: 0 3: 5 4: 106 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180651079 | Original CRISPR | AAATATGCAAATATGGAGGA AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||