ID: 1180651079

View in Genome Browser
Species Human (GRCh38)
Location 22:17377693-17377715
Sequence AAATATGCAAATATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180651079_1180651084 -3 Left 1180651079 22:17377693-17377715 CCTTCCTCCATATTTGCATATTT No data
Right 1180651084 22:17377713-17377735 TTTCATGGGATGCTATCCCTTGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180651079 Original CRISPR AAATATGCAAATATGGAGGA AGG (reversed) Intronic
No off target data available for this crispr