ID: 1180657668

View in Genome Browser
Species Human (GRCh38)
Location 22:17436880-17436902
Sequence CTTTAGGCAGGAACTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180657658_1180657668 21 Left 1180657658 22:17436836-17436858 CCTTGGGCTCTTGCGCCTCTGGC 0: 1
1: 1
2: 0
3: 129
4: 430
Right 1180657668 22:17436880-17436902 CTTTAGGCAGGAACTGGGGGTGG 0: 1
1: 0
2: 0
3: 29
4: 244
1180657660_1180657668 6 Left 1180657660 22:17436851-17436873 CCTCTGGCTTTCAGGCCTGAATC 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1180657668 22:17436880-17436902 CTTTAGGCAGGAACTGGGGGTGG 0: 1
1: 0
2: 0
3: 29
4: 244
1180657662_1180657668 -9 Left 1180657662 22:17436866-17436888 CCTGAATCAGCAATCTTTAGGCA 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1180657668 22:17436880-17436902 CTTTAGGCAGGAACTGGGGGTGG 0: 1
1: 0
2: 0
3: 29
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180657668 Original CRISPR CTTTAGGCAGGAACTGGGGG TGG Intronic
900316634 1:2060368-2060390 TGTTGGGCGGGAACTGGGGGTGG + Intronic
900358793 1:2278088-2278110 CTGGAGGCAGGCACTTGGGGTGG + Intronic
900383543 1:2398064-2398086 CTTCAGGCAGGAGCAGGGGGCGG + Intronic
900684649 1:3940318-3940340 CTCTAGGCAGGTCCTGAGGGAGG - Intergenic
905280106 1:36843711-36843733 CTATAGGCAGGAACAGGGCAGGG - Intronic
905393966 1:37655613-37655635 CTCTAGCCAGGAACAGGGTGGGG + Intergenic
907652207 1:56305947-56305969 CTAGAGGCAGGTACTGGGGAGGG + Intergenic
908847859 1:68343042-68343064 CTCTAGGCAGGAACGGGGCGGGG + Intergenic
913277315 1:117151517-117151539 CAATAGGCAGGAAGTGGGCGGGG - Intronic
914420954 1:147527962-147527984 CATTAGGCAGGAACAGAGGATGG - Intergenic
914876114 1:151513644-151513666 CTTCTGGCAGGAAGTGGGGGTGG - Intronic
915082013 1:153358951-153358973 CCTCAGGCGGGAACTTGGGGTGG + Intronic
916567239 1:165991595-165991617 GTTCAGGCAAGAACTGGGGATGG + Intergenic
917171549 1:172181775-172181797 CTTCAGACAGGATATGGGGGAGG - Intronic
917661530 1:177181682-177181704 CGTTAGGCAGGAGCAGGGGCAGG + Intronic
920380420 1:205531760-205531782 CACTAGGCAGGTCCTGGGGGAGG - Exonic
920516305 1:206586924-206586946 GTTTAGGCAGAAACTGGAGGAGG + Exonic
920569093 1:207002817-207002839 CTTTGGGCAGGAAGGGGTGGAGG + Intergenic
921841755 1:219836127-219836149 CTTTCTGCAGGAAATGGGGCAGG - Intronic
922810485 1:228412893-228412915 TTTTAGGCAGCTAATGGGGGAGG - Intronic
923190578 1:231616377-231616399 CTTTAGTTAGGATTTGGGGGAGG + Intronic
923477666 1:234350264-234350286 CTTTAGGAAGGAAAGGCGGGTGG + Intergenic
924250580 1:242129008-242129030 CTTTAGGCAGGATCAGATGGAGG + Intronic
1064757332 10:18583069-18583091 GTTAAGGCAGGAACTGGCTGTGG - Intronic
1065382218 10:25101948-25101970 CTGTAGGCAGGAACAGGAGATGG + Intergenic
1067761214 10:49048477-49048499 CCTTTGGCAGGGACTGCGGGAGG + Exonic
1067800031 10:49352554-49352576 CATGAGGCAGGAACTGAGGGAGG - Intergenic
1068026840 10:51656659-51656681 CTTTAGGAAGAATCTGGGAGTGG - Intronic
1069313571 10:67069578-67069600 CTCTGGGCAGGGACTGGGTGGGG - Intronic
1069744302 10:70705325-70705347 CCTCAGGAGGGAACTGGGGGTGG - Intronic
1070143462 10:73756245-73756267 ATTTAAGCAGGTACTGGGGAAGG + Intronic
1070327774 10:75399558-75399580 CGTGTGGCAGGAACTGGGGCGGG + Exonic
1070579110 10:77705363-77705385 CCTTAGGGAGGAATTGTGGGAGG - Intergenic
1070679812 10:78440644-78440666 CTTGGGGCAGGAACTGGGACTGG - Intergenic
1071287403 10:84161796-84161818 CTTTAGGCTGAAACTTGGGCTGG + Intergenic
1073978502 10:109127309-109127331 GTTTATGCTGGGACTGGGGGAGG + Intergenic
1074031138 10:109689674-109689696 CCATAGGCAGGCACTGGGGCAGG - Intergenic
1075417846 10:122278634-122278656 CTGGAGGAAGGAACTGGGGAAGG - Intronic
1076605454 10:131686505-131686527 ATATATTCAGGAACTGGGGGCGG - Intergenic
1076799039 10:132812253-132812275 CTTTTGGCAGGAGGTGGGGATGG - Intronic
1077106398 11:844282-844304 CTGCAGGCAGGAACAGGGGCGGG - Intronic
1077134479 11:991688-991710 CTCCAGGCAGGGACTTGGGGTGG + Intronic
1079092423 11:17490436-17490458 CATTTGGCAAGAACTGGGGCTGG + Intergenic
1080769422 11:35326494-35326516 CACTAGGCAGAAACTGGGTGAGG + Intronic
1080774099 11:35369795-35369817 ATTCAGGCAGGAGCTGGGGCAGG + Intronic
1081614975 11:44585466-44585488 CTTTATGCAGGAAGAGTGGGAGG + Intronic
1082691995 11:56317019-56317041 GTTTAGTCATGAATTGGGGGAGG + Intergenic
1083771429 11:64869860-64869882 GTGTCGGCAGGAAGTGGGGGCGG + Intronic
1083872036 11:65494483-65494505 CTTTAGGCTGGAGCCGGGCGTGG - Intergenic
1083893995 11:65611225-65611247 CTTTTGGGGAGAACTGGGGGAGG + Intronic
1085689259 11:78652190-78652212 CTCTAAGCAGTGACTGGGGGTGG + Intergenic
1087102645 11:94380276-94380298 CTGAAGGAAGGAACTGGGGAGGG + Exonic
1087468913 11:98546348-98546370 CTCCAGGCTGGTACTGGGGGTGG - Intergenic
1088919155 11:114249108-114249130 CCTGAGGCTGGAATTGGGGGTGG - Intronic
1089270624 11:117299494-117299516 GTCTAAGCAGGCACTGGGGGAGG - Intronic
1092541139 12:9420383-9420405 CTGTAGTCAGGGACTGGGAGTGG + Intergenic
1092629690 12:10364211-10364233 CTGGAGACAGGAACTGGGAGTGG + Intergenic
1094511904 12:31102092-31102114 CTGTAGTCAGGGACTGGGAGCGG - Intronic
1095282119 12:40364933-40364955 CTTTGGATAGGAACTGGAGGAGG + Exonic
1096535402 12:52269180-52269202 CTTTAGGCAGGAAAGCGGAGAGG - Intronic
1096796018 12:54078029-54078051 GTTTAGGCAGGGACAGGGCGAGG - Intergenic
1097764053 12:63503363-63503385 CTGAGGGCAGTAACTGGGGGTGG - Intergenic
1100327783 12:93555626-93555648 CTATTGCCAGGAAATGGGGGTGG - Intergenic
1101909215 12:108849990-108850012 CTCTAGGAGGGAGCTGGGGGAGG + Intronic
1101909230 12:108850030-108850052 CTCCAGGAAGGAGCTGGGGGAGG + Intronic
1103064737 12:117888034-117888056 CTTCAGGTAGGCACTGGGTGTGG - Intronic
1103979864 12:124729828-124729850 TTTTGGGAATGAACTGGGGGCGG - Intergenic
1106021421 13:25919546-25919568 CTTAGGGCAGGAGCTGGAGGAGG - Intronic
1106868594 13:33994664-33994686 CTTTAGGCAGGAATGAGGGTAGG - Intergenic
1108114471 13:47111541-47111563 CTTAAGGCAGGAACTACGTGAGG + Intergenic
1110225158 13:73112009-73112031 CTTTAGATAGAAAGTGGGGGGGG - Intergenic
1110734545 13:78920840-78920862 CTTTGTGCATGAACTGGAGGGGG - Intergenic
1110767512 13:79297840-79297862 CTTTTGACTGGAACTGGGGCAGG - Intergenic
1111326227 13:86699808-86699830 CTATAGGTGGGAGCTGGGGGAGG + Intergenic
1113642997 13:111971649-111971671 CTGTGCGCAGGAGCTGGGGGTGG - Intergenic
1115358836 14:32478744-32478766 TTTTAGGCAGGAAATGGGGATGG + Intronic
1115659376 14:35476878-35476900 CTATTGGGAGAAACTGGGGGAGG - Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118410323 14:65470789-65470811 CCTGAGGCAGGAAGTGGGAGCGG - Intronic
1118888601 14:69887944-69887966 CCTTTTGCAGGAGCTGGGGGTGG + Intronic
1119169505 14:72523513-72523535 CTGGAAGCAGGGACTGGGGGTGG + Intronic
1119677778 14:76568946-76568968 CCTTAGGCAGGGGCTGGGGTAGG - Intergenic
1121027781 14:90629080-90629102 CTCTACCCATGAACTGGGGGAGG + Intronic
1121570010 14:94940447-94940469 TTTGAGGCAGGGGCTGGGGGTGG + Intergenic
1121979750 14:98444223-98444245 CTCTGGGCAGGAAGTGGGGGTGG + Intergenic
1122105471 14:99450612-99450634 CATAAGGCAGGAAAAGGGGGAGG + Intronic
1122940443 14:104978679-104978701 CTTTAGTCAGAAGCTGGGGTGGG + Intergenic
1124374966 15:29124045-29124067 CTTAAGACCAGAACTGGGGGTGG + Intronic
1124586562 15:31014987-31015009 CTTGAGGCAGGGGGTGGGGGTGG + Intronic
1126469402 15:48991814-48991836 CTTTAAAAAAGAACTGGGGGTGG - Exonic
1126953740 15:53911203-53911225 CTTGGAGCAGGACCTGGGGGTGG + Intergenic
1127765713 15:62184042-62184064 ATTTATGCAGGAACAAGGGGAGG - Intergenic
1128388369 15:67166236-67166258 CTTCAGTCAGGGTCTGGGGGAGG + Intronic
1128703161 15:69819067-69819089 GTTTGGGCAGAAACTGGTGGAGG - Intergenic
1129775699 15:78234980-78235002 CTCCATGCAGGACCTGGGGGAGG - Intronic
1130145986 15:81273927-81273949 CTTTAGGGTGGAGGTGGGGGTGG - Intronic
1130454745 15:84094471-84094493 CTTTATCCAGGAATTGGGGGAGG - Intergenic
1132865299 16:2090182-2090204 CTTTGTGGCGGAACTGGGGGCGG + Exonic
1133291903 16:4727969-4727991 CTGCAGGCAAGAACTGGGGAAGG - Intronic
1133744668 16:8676974-8676996 CTTTAGCTGGGAACTGGGTGGGG - Intronic
1135074896 16:19384760-19384782 CTGCAGGCTGGGACTGGGGGTGG - Intergenic
1136009742 16:27355792-27355814 CTGTAGGCTGGAAGTGGGAGGGG - Exonic
1139493098 16:67297651-67297673 CTCTGGGCAGGAACTGGCTGGGG - Exonic
1142293270 16:89202123-89202145 CTTTCGGCTGGTACTGCGGGAGG + Intergenic
1142299461 16:89247853-89247875 CTTTCGGCTGGTACTGCGGGAGG + Intergenic
1142898345 17:2996421-2996443 CTCTGAGCAGGAACTGGGGAGGG + Intronic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1145782530 17:27572428-27572450 CTTTAGACAGAAGCTGGGGTGGG + Intronic
1145974064 17:28974228-28974250 CTGTAGCCAGCATCTGGGGGTGG - Intronic
1147169107 17:38607702-38607724 CCTTAGGCACAAAGTGGGGGAGG - Intergenic
1147212185 17:38878076-38878098 CTTTATGCCAGAACTGGGGATGG - Exonic
1148165504 17:45481643-45481665 GATTCGGCAGGCACTGGGGGTGG + Intronic
1150396731 17:64828359-64828381 GATTCGGCAGGCACTGGGGGTGG + Intergenic
1152526620 17:80891710-80891732 CTCTCGGCAGGAGCTGGTGGTGG + Exonic
1152937994 17:83151901-83151923 TTTTATGCAGGAACTGCGGGTGG + Intergenic
1155349977 18:24896898-24896920 GTTTAGGATGGACCTGGGGGTGG + Intergenic
1156944725 18:42814859-42814881 CTCCAGGCTGGTACTGGGGGTGG - Intronic
1157422094 18:47555913-47555935 CATGAGGCAGGAACAAGGGGCGG - Intergenic
1157811569 18:50700774-50700796 CTCTAGGCGGGAGTTGGGGGTGG + Intronic
1158065933 18:53408417-53408439 TTTGTGGCAGGAACTGAGGGTGG - Intronic
1158449527 18:57551598-57551620 CTTTAGGAAGGTAATGGGGAAGG - Intronic
1160828340 19:1091037-1091059 CTTGAGGCAGGAAATGGGGTTGG - Intronic
1160847184 19:1171748-1171770 CCTTAGGCAGCAAGTGGGTGGGG + Intronic
1160863108 19:1245877-1245899 CCTGGGGCTGGAACTGGGGGCGG - Intergenic
1161811824 19:6475784-6475806 CTGTGGGCAGGCCCTGGGGGCGG - Intronic
1162484899 19:10953800-10953822 CTTTGGGCGGGAACCGGGGAGGG - Intergenic
1162789083 19:13053877-13053899 CTTGAGGGTGGGACTGGGGGAGG - Intronic
1165471462 19:36007006-36007028 CTTTGGATAGGAAATGGGGGAGG - Intronic
1166698231 19:44866499-44866521 ATTTAGGCAGAAACTAGGAGAGG + Intronic
1166996298 19:46721184-46721206 CCTGAGGCAGGAGGTGGGGGTGG + Intronic
1167498443 19:49832230-49832252 CATGAGGCAGGGAGTGGGGGTGG - Intronic
1167749101 19:51369051-51369073 CTTTAAACAGCCACTGGGGGAGG - Intergenic
1168061955 19:53898173-53898195 TCTTAGGGAGGAAGTGGGGGTGG + Intronic
1168096046 19:54115451-54115473 CTTTAAGCAGGGATTCGGGGTGG - Exonic
927482847 2:23468159-23468181 CTTGAGGCAGGGACTGGGAGTGG + Intronic
927504123 2:23602284-23602306 CTTTGGGCAGGCCCTGGGGCAGG - Intronic
927525217 2:23733805-23733827 CTATAGGCCGGGACTGGGGAAGG - Intergenic
933849679 2:86355840-86355862 CTTTGGGCAGGAAATGGAGGGGG + Intergenic
934109225 2:88726197-88726219 CTTTGGTCAGGTACTGGGGTGGG + Intronic
934734845 2:96684906-96684928 AGTTCGGCAGGATCTGGGGGAGG + Intergenic
936762858 2:115806845-115806867 CTTGCTTCAGGAACTGGGGGTGG - Intronic
937121305 2:119441587-119441609 CTTCTGGCAGGGACTGGTGGTGG - Exonic
939025168 2:137004007-137004029 CTTTAGGAAGCAACAGGGGAGGG - Intronic
940884036 2:158973344-158973366 CTTTGGGTAGGAGATGGGGGTGG + Intronic
945008945 2:205441347-205441369 CTTTTGGCAGGAGGTGGGGTTGG - Intronic
945836274 2:214839178-214839200 CTTTAGGCAGGAAAGGGGGAGGG + Intergenic
946365441 2:219246062-219246084 CTTCATCCAGAAACTGGGGGAGG + Exonic
947612572 2:231532994-231533016 CTGTAGGCAGTAAGTGGGGTGGG - Intergenic
947885546 2:233566670-233566692 CTTTAGGCAGTAAGTGCGGCTGG - Intronic
949003098 2:241628568-241628590 CTTTAGGGAGGAAGTGGCGGTGG - Intronic
1169109980 20:3026368-3026390 CCTTAGGCAGCCTCTGGGGGTGG + Intronic
1170369313 20:15631544-15631566 CATTTGGTAGGAACTGGAGGTGG + Intronic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1175517637 20:59579008-59579030 CTCTGTGCAGGCACTGGGGGAGG - Intronic
1178884524 21:36474965-36474987 CTTGAGACAGGAGATGGGGGAGG + Intronic
1180657668 22:17436880-17436902 CTTTAGGCAGGAACTGGGGGTGG + Intronic
1181782112 22:25200989-25201011 CTTTAGCCAGGTTCTGGGGGTGG + Intronic
1182620468 22:31615864-31615886 CTGGAAGAAGGAACTGGGGGTGG + Intronic
1183094629 22:35544615-35544637 CTTTAGGTGGGAGCTGGGTGGGG + Intronic
1183324235 22:37182883-37182905 CTTTAGGCAGGCATGTGGGGAGG - Intronic
1184215761 22:43066279-43066301 CATCAGGAAGGAAATGGGGGTGG + Intronic
1184359283 22:44004649-44004671 CTTAAGGCAGGAACTACGTGAGG - Intronic
1185047270 22:48534712-48534734 CTTTACCCTGGAACGGGGGGAGG + Intronic
950638121 3:14330406-14330428 TTTTAGGAAGGAATTAGGGGAGG - Intergenic
951187694 3:19733465-19733487 CTTTAGTCAGTCACTGGGTGAGG - Intergenic
952567707 3:34679402-34679424 CTTAAGGCAGGAACTACGTGAGG - Intergenic
954009576 3:47623901-47623923 ATTTATGCAGGAACTTGGTGGGG + Intronic
954391459 3:50270059-50270081 CACCAGGCAGGACCTGGGGGAGG + Intronic
954639047 3:52087162-52087184 GCTTTGGCAGGAAGTGGGGGCGG + Intronic
954660348 3:52223745-52223767 CTGCAGGCAGGCACTGGAGGTGG - Exonic
954868295 3:53748231-53748253 CTGATGGCAGGAGCTGGGGGTGG - Intronic
955755071 3:62218015-62218037 CTTTTGGAAGGATCTGGGGTAGG + Intronic
957107224 3:75906551-75906573 CTGGAGACAGGAACTGGAGGAGG - Intergenic
957179956 3:76863793-76863815 CTTGAGGCAGTAACTGGTAGGGG - Intronic
959094348 3:101936981-101937003 CAGAAGGCAGGAACTGGGTGAGG + Intergenic
959701382 3:109302146-109302168 ATGTAGGAAGGAACTGAGGGAGG - Intronic
959892201 3:111570034-111570056 CGGTAGGCAGGAATTGGGGTGGG + Intronic
960811276 3:121629682-121629704 CTGAAGGCAGCAACTGGAGGGGG - Exonic
961830819 3:129622234-129622256 TTTCAGGCAGGATCTGGGAGTGG - Intergenic
962527732 3:136251438-136251460 CATGAGGGAGGCACTGGGGGAGG + Intronic
966112187 3:176416635-176416657 CTTTAGTCAGGAGTAGGGGGAGG - Intergenic
967364636 3:188672130-188672152 ATTTAAGCAAGAACTGGGAGGGG + Intronic
968975937 4:3822114-3822136 CTTCAGGCAGGACCTGCGTGGGG - Intergenic
970609640 4:17713138-17713160 CTTGAGCCAGGCACTGGGGATGG - Intronic
972496142 4:39636710-39636732 CTTTAGGCATCCACTGGGGGGGG - Intronic
972775903 4:42240247-42240269 CTTCTCCCAGGAACTGGGGGAGG + Intergenic
974414102 4:61582335-61582357 CTGGAGGCAGGAGCGGGGGGAGG - Intronic
975669462 4:76766386-76766408 CTGTAGGCAGGAAGTGGGGAAGG + Intronic
976449231 4:85167361-85167383 CTAGAGGCAGGAAGTGAGGGAGG - Intergenic
978093559 4:104747326-104747348 CTTGTGGCTGGAACTGGGGCTGG - Intergenic
982581759 4:157187942-157187964 CCTTAGGTAGGCAGTGGGGGAGG - Intergenic
983225530 4:165082588-165082610 CTTTTGGAAGGATCTGGGGAGGG + Intronic
985695979 5:1340433-1340455 CTTTAGGTAGGAAATGGGTGAGG - Intronic
987091208 5:14509156-14509178 CTTGGGGCAGGAACAGGGGGAGG - Exonic
989103883 5:37842801-37842823 CTGTAGGCTGGAAGTGGTGGTGG + Intergenic
994451392 5:99949487-99949509 CTCCAGGCGGGAGCTGGGGGAGG - Intergenic
997951565 5:138246585-138246607 TATTAGGCAGAAATTGGGGGAGG - Intergenic
997977609 5:138449515-138449537 CTTTGGGTAGGGACTGGGGCAGG + Intergenic
998142412 5:139707614-139707636 CTTCAGGCAGGCAGTGGGGGAGG + Intergenic
998173767 5:139887595-139887617 CTTTGGGCTGGAACTGGGGAAGG + Intronic
998486361 5:142505937-142505959 CTGTAGGCAGGGTCTGGAGGCGG + Intergenic
999855862 5:155593109-155593131 GTTTAGGCAGAGACTGGGGTTGG - Intergenic
1003034825 6:2633391-2633413 CTGTCTGCAGGAGCTGGGGGAGG - Intronic
1003933738 6:10954389-10954411 CTTTGGGCAGGAACTCAGAGAGG + Intronic
1005211276 6:23467002-23467024 TTTGAGGCAGCAACTGGGAGTGG + Intergenic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1007838305 6:44694799-44694821 AGTTTGGCAGGAACTGGGTGGGG + Intergenic
1014450309 6:121574103-121574125 ATTTAGGAAGGAAGAGGGGGTGG + Intergenic
1015186775 6:130426223-130426245 CTTAAGGCTGGAGCTGGGCGAGG - Intronic
1015862528 6:137695823-137695845 CTGTAGGCAGGAAGGGTGGGCGG - Intergenic
1016843145 6:148544420-148544442 TTTTTGGCAGGAACAGGTGGAGG - Exonic
1017513741 6:155137479-155137501 CTTTGAGAAGGAACAGGGGGTGG + Exonic
1019021139 6:168918684-168918706 CTTCGGGCAGGAGATGGGGGAGG + Intergenic
1019078554 6:169411590-169411612 CATAAGGCAGGGACTGGGGCAGG - Intergenic
1020642064 7:10767890-10767912 CCTTGGGAAGGAAGTGGGGGAGG - Intergenic
1021115360 7:16740860-16740882 AAATAGGCAGGAACTGAGGGTGG + Intergenic
1022229931 7:28404870-28404892 CTTCAGGCAGGCACTGGGACAGG + Intronic
1022300773 7:29100216-29100238 GTTTAGGAAGGAAGTGGGGCTGG - Intronic
1024000014 7:45183853-45183875 ATGTAGGCAGGAGCTGGGGCTGG - Exonic
1024498025 7:50070167-50070189 CTGGAGACAGGAACTGGGAGTGG - Intronic
1025251997 7:57357635-57357657 CCTTAGGCAAGAGCTTGGGGAGG + Intergenic
1028713724 7:93940108-93940130 CTACAGGGAGGAACTGGGGGTGG - Intergenic
1028968753 7:96832603-96832625 CTTTAGGAAGGAACTGGCAGAGG - Intergenic
1028983223 7:96989793-96989815 CTTCAGGTAGGAGCTTGGGGTGG - Intergenic
1029217700 7:98963294-98963316 CTTCAGGCAGCAGCTGGGTGCGG + Intronic
1029410255 7:100405054-100405076 CTGCAGCCAGAAACTGGGGGTGG - Exonic
1029456490 7:100674776-100674798 CTGGAGGAAGAAACTGGGGGCGG - Intronic
1031492155 7:122402406-122402428 CTAGAGGCAGGAACTCGGGCGGG - Intronic
1032116589 7:129122864-129122886 CCTTAGTAAGGAACTGGTGGAGG + Intergenic
1035176326 7:157054689-157054711 CTGTTGGCAGGGTCTGGGGGAGG - Intergenic
1035546770 8:487533-487555 CTTTAGGCAGGAATGCAGGGAGG - Intergenic
1037407155 8:18555050-18555072 CTTCAGGAGGTAACTGGGGGAGG + Intronic
1037436308 8:18867314-18867336 CTTTAGTCTGGCACTGAGGGTGG - Intronic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1037957043 8:23068346-23068368 ATTAAGGCAGGAACTGAGCGAGG + Intronic
1038400023 8:27277601-27277623 CTTTAAGCAGGAACAGAGGGAGG - Intergenic
1038626923 8:29203005-29203027 CTTTATGTAGGAATTGGGGAAGG - Intronic
1038711956 8:29955554-29955576 CTTGTGGTAGGAACTGGAGGTGG - Intergenic
1041637134 8:60156638-60156660 GCTTAGGGAGGAACTGGTGGTGG - Intergenic
1042088540 8:65133611-65133633 CTCTTGGCCAGAACTGGGGGAGG + Intergenic
1043866377 8:85379866-85379888 CTTTAGGCAGGAGAAGTGGGTGG + Intronic
1044115274 8:88327595-88327617 CTTCCCGCAGGAGCTGGGGGCGG - Intronic
1045357878 8:101405408-101405430 GTTGAGGCAGCAAATGGGGGAGG - Intergenic
1047362288 8:124180000-124180022 CTTATGGCAGGGACTGGGGCTGG + Intergenic
1048876118 8:138837995-138838017 CTTGAGGTGGGAGCTGGGGGAGG + Intronic
1049472687 8:142783410-142783432 CCCTTGGCTGGAACTGGGGGTGG - Intergenic
1050199866 9:3132777-3132799 ATTTAGGTGGGAACTGGGGTGGG + Intergenic
1051882454 9:21853289-21853311 CTTTAGGGGGGAAAAGGGGGTGG + Intronic
1054174353 9:61864671-61864693 GTTTAGGCAGGGACAGGGCGAGG - Intergenic
1054663185 9:67716120-67716142 GTTTAGGCAGGGACAGGGTGAGG + Intergenic
1055336747 9:75239443-75239465 CTTTAGTCAGGAACAGGCCGAGG - Intergenic
1055604185 9:77950592-77950614 CTCTAGGGAGGAAATGGGGAAGG + Intronic
1056367303 9:85918560-85918582 CTACAGGCAGGAACCAGGGGAGG + Intergenic
1057598925 9:96440284-96440306 TTGTAGGTAGGAACTGGGGTGGG + Intergenic
1057855348 9:98596923-98596945 CCTTAGGCAAGCACTGAGGGAGG + Intronic
1058419203 9:104818693-104818715 GTTTCTGCAGGAACTGAGGGAGG + Exonic
1058555563 9:106163193-106163215 CTTTAGGCATGAACTTTGGGTGG - Intergenic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1059441694 9:114310993-114311015 CTTTGGGCAGGAAGCTGGGGAGG - Exonic
1060587428 9:124795246-124795268 CTCCAGCCAGGAGCTGGGGGAGG + Intronic
1060999375 9:127894438-127894460 CTTTAGGAAAGAACAGGTGGAGG + Intronic
1061518788 9:131105088-131105110 CCTTTGGCAGGGACGGGGGGAGG + Intronic
1062532148 9:137006730-137006752 CTGTGGGCAGGAGATGGGGGAGG - Intergenic
1062564600 9:137158611-137158633 CATTAGGGATGACCTGGGGGTGG - Exonic
1185908564 X:3960904-3960926 CTCTAGGGAGGAACTGAGTGTGG - Intergenic
1187786653 X:22895975-22895997 CTTTGGGCAGGAAGGGGTGGTGG + Intergenic
1187943965 X:24408616-24408638 CTTCAGCCAGCAACTGGGTGTGG + Intergenic
1189757060 X:44282789-44282811 CTTTTGGAAGAAACTGAGGGTGG + Intronic
1192337812 X:70236608-70236630 ATTTAGGCAGGCACTGGAAGGGG + Intronic
1192340571 X:70260095-70260117 CTGTAGGCAGGCAGTGGGGAAGG - Intergenic
1192896385 X:75447013-75447035 CATTGGGCAGTAACTGGGGTGGG - Intronic
1197903778 X:131401411-131401433 CTGTAAGCAGGAACTGGAGGAGG - Intergenic
1199863648 X:151823748-151823770 CTTTGGGGAGAAACTGAGGGAGG + Intergenic
1201064578 Y:10083616-10083638 CTTTTTGCAGGATCTGAGGGTGG - Intergenic