ID: 1180657756

View in Genome Browser
Species Human (GRCh38)
Location 22:17437559-17437581
Sequence CCCCATCCATACCATCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180657753_1180657756 25 Left 1180657753 22:17437511-17437533 CCTCGACATGTTTTTGATCATAT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1180657756 22:17437559-17437581 CCCCATCCATACCATCACTGAGG 0: 1
1: 0
2: 1
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180657756 Original CRISPR CCCCATCCATACCATCACTG AGG Intronic
902231400 1:15029911-15029933 CCCCAGCCATGCTATCACTGTGG - Intronic
904662436 1:32095339-32095361 CCCAATCCATACCAGGCCTGTGG + Intronic
905358889 1:37404687-37404709 CCCCATTTCCACCATCACTGGGG + Intergenic
905528924 1:38661114-38661136 CCCCATCCATACAATCACCATGG - Intergenic
906534126 1:46542368-46542390 CCACATCCCTGGCATCACTGTGG + Intergenic
908586760 1:65578190-65578212 CCTTATCCAGTCCATCACTGAGG + Intronic
909604652 1:77496258-77496280 TCCCATCCATCTCATCTCTGAGG - Intronic
910909701 1:92220049-92220071 CCCCATCAATGCCATCTGTGTGG + Intronic
912649975 1:111429446-111429468 CCCACTCTGTACCATCACTGAGG + Intergenic
915551634 1:156638657-156638679 CCCCATCCATGCCAAAGCTGAGG - Intergenic
916388844 1:164307744-164307766 TCCCAGCCATGCCATCACTGTGG - Intergenic
918675249 1:187276487-187276509 ACCCAGCCATCCCATTACTGGGG - Intergenic
923239938 1:232073892-232073914 CCCCATACCTGCTATCACTGGGG - Intergenic
1063384797 10:5609423-5609445 CACCACCCATCCCATCACTCTGG + Intergenic
1066291109 10:34015200-34015222 ACCCATCTATAACATCAGTGAGG - Intergenic
1066462667 10:35625194-35625216 CCCCATTCATCCTACCACTGAGG - Intergenic
1069966866 10:72126389-72126411 CTACATTCATATCATCACTGGGG + Intronic
1072309195 10:94138292-94138314 CCTCTTCCATGCCATCACCGTGG - Intronic
1074566477 10:114583598-114583620 ACCCAGCAATACCATCACTGGGG + Intronic
1078066382 11:8081643-8081665 CCCCACCTATCCCAGCACTGGGG + Intronic
1078442719 11:11380646-11380668 CCTCCTCCATCCCATCTCTGTGG + Intronic
1079013640 11:16850438-16850460 CCCCATCCTTACCTTCCCTGGGG + Intronic
1079106120 11:17573454-17573476 CCCCATCCCCTCCATCACTCAGG + Intronic
1079142638 11:17822787-17822809 CCCAAGTCATACCATCAGTGAGG + Intronic
1083780182 11:64913684-64913706 CCCCAACCCTACCACCACCGAGG + Intronic
1085309254 11:75506567-75506589 CCCCAGGCACACCATCACAGCGG + Intronic
1088911099 11:114193119-114193141 CCCCATCCACAAGATCTCTGGGG - Intronic
1089216342 11:116836872-116836894 CTCCATCCAGACCATCTGTGGGG + Intronic
1090116276 11:123977535-123977557 CCTCATCTACAGCATCACTGTGG - Exonic
1091935029 12:4428219-4428241 CCCCTTTCATGCCATCTCTGGGG - Intronic
1095618131 12:44216898-44216920 CCCCATCCACACCATTACACTGG - Intronic
1095892581 12:47248671-47248693 TACCATCCATACCCTCTCTGTGG - Intergenic
1097736807 12:63191588-63191610 ACCCAGCCATCCCATTACTGGGG + Intergenic
1100033354 12:90220346-90220368 GCCCAGCCATCCCATTACTGGGG - Intergenic
1101412454 12:104480796-104480818 GCCCATCCATGCCCTCTCTGAGG - Intronic
1101857140 12:108453162-108453184 CCCCATCCTGACCACCAGTGGGG + Intergenic
1102573748 12:113843325-113843347 CCTCATCCATCCCTTCTCTGTGG - Intronic
1103136125 12:118509402-118509424 CCCCACCCATACCCTTGCTGAGG - Intergenic
1107197604 13:37672009-37672031 CCCCCTCCTTTTCATCACTGGGG + Intronic
1112125081 13:96456688-96456710 CAGCATAAATACCATCACTGGGG - Intronic
1116031981 14:39584778-39584800 ACCCAGCCATCCCATTACTGGGG - Intergenic
1118661843 14:68022445-68022467 ACCCATCCATCCCAATACTGGGG - Intronic
1119674726 14:76545238-76545260 TCCCATCTCTACCCTCACTGCGG + Intergenic
1122634183 14:103122609-103122631 CCCCATCCACACCGTCTCTCAGG - Intergenic
1125370350 15:38969263-38969285 CCACATCCATGCCAACACTGTGG - Intergenic
1127216627 15:56830249-56830271 CCACATCCTTACCAACACTTGGG - Intronic
1128799238 15:70487039-70487061 ACCCAGCCACACCATGACTGAGG + Intergenic
1129314294 15:74731904-74731926 ACCCATGCCCACCATCACTGGGG - Intergenic
1129669436 15:77598955-77598977 CCCCAGCCCTACCACCCCTGTGG + Intergenic
1130017838 15:80201401-80201423 CCCCATCCATCACATAACAGTGG - Intergenic
1130160842 15:81398421-81398443 CCCCATCCTTCCCAACAATGAGG + Intergenic
1130306340 15:82714334-82714356 CCCCACCCCCACCAGCACTGGGG - Intergenic
1134009284 16:10839169-10839191 CTCCACCCAGACCATCACTACGG - Intergenic
1134550143 16:15135024-15135046 CCCCAGCAATACCAACAGTGAGG - Intronic
1134591698 16:15459765-15459787 CCCCATCAAGACCACCACTATGG - Intronic
1134718326 16:16367971-16367993 CCCCAGCAATACCAACAGTGAGG + Intergenic
1134956426 16:18384188-18384210 CCCCAGCAATACCAACAGTGAGG - Intergenic
1141467381 16:84215210-84215232 AGCCATCCAGACCATCTCTGAGG - Intergenic
1144188493 17:12820647-12820669 CCACATGGATACCTTCACTGAGG + Intronic
1144620621 17:16816211-16816233 CCCACTCCATCCCCTCACTGTGG - Intergenic
1144727576 17:17509587-17509609 CCCTGGCCACACCATCACTGAGG + Intronic
1144885020 17:18451936-18451958 CCCACTCCATCCCCTCACTGTGG + Intergenic
1145147199 17:20492441-20492463 CCCACTCCATCCCCTCACTGTGG - Intergenic
1145798837 17:27670987-27671009 CCACCCCCATACCATGACTGTGG + Intergenic
1147572010 17:41577111-41577133 CCCACTCCATCCCCTCACTGTGG - Intergenic
1148902431 17:50888367-50888389 GCCCATCCACGCCATCACAGTGG - Intergenic
1151047062 17:70933185-70933207 CACCATCAATATCATCACTTGGG - Intergenic
1152232641 17:79122007-79122029 CCCCATCAAACCCATCTCTGAGG + Intronic
1152993124 18:380698-380720 TCACATCCATATTATCACTGGGG - Intronic
1154996194 18:21642441-21642463 GCCTAGCCATACCATCACTTTGG - Intergenic
1155923635 18:31630498-31630520 GGCCCTCCAAACCATCACTGGGG + Intronic
1156124559 18:33887931-33887953 ACCCAGCCATCCCATTACTGGGG - Intronic
1156143250 18:34142310-34142332 ACCCAGCCATCCCATTACTGGGG + Intronic
1156688388 18:39677011-39677033 CCCACTCCATACCATCTCTGAGG + Intergenic
1158122588 18:54065890-54065912 ACCCAGCCATCCCATTACTGGGG + Intergenic
1162439160 19:10682099-10682121 CCCCATCTTTACCATGTCTGTGG + Exonic
1163419518 19:17206276-17206298 CCCCATCCACGCCATCACAGGGG + Exonic
1163491094 19:17617595-17617617 CCCCATCCATGACGTCACAGGGG + Intronic
1163856768 19:19708496-19708518 TCCCATCCAAACCCACACTGTGG - Intergenic
1166362616 19:42260561-42260583 CACCATCTCTACCATCTCTGGGG - Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
926225408 2:10963680-10963702 CCCCATCCAGACCCTCACAATGG + Intergenic
927005902 2:18848172-18848194 CTTCATCTATACCATCACAGTGG - Intergenic
927150949 2:20195701-20195723 CCCCATTCATATAATGACTGCGG - Intergenic
929573855 2:43040087-43040109 CCCCATCCCTTCATTCACTGAGG + Intergenic
930240673 2:48932821-48932843 CCCCACCAATACCCTCTCTGAGG - Intergenic
932797422 2:74708903-74708925 CCCCATTAATACCAGCACTTTGG + Intergenic
933151097 2:78916128-78916150 CTCGCTCCAAACCATCACTGGGG + Intergenic
933529566 2:83489710-83489732 ACCCAGCCATCCCATTACTGGGG + Intergenic
933530023 2:83496853-83496875 ACCCAGCCATCCCATTACTGGGG - Intergenic
934662247 2:96149151-96149173 CTGCATCCAGACCAGCACTGAGG + Intergenic
935709515 2:105885000-105885022 CCACATCCATAGAATCAATGTGG - Intronic
936606681 2:113964964-113964986 ACCAATCCATGCCATCACTTAGG - Intergenic
938102601 2:128507314-128507336 CTCCATCCTTCCCATCACTCAGG - Intergenic
939625840 2:144476264-144476286 CCACAGCCATACCACCATTGGGG - Intronic
944299000 2:198101104-198101126 CCCCATCCATCCTAACACTGAGG - Intronic
946292309 2:218754552-218754574 CCCCATCACTACCATCCCTCCGG - Exonic
948812845 2:240493717-240493739 CCCCATCCTTGCCACCTCTGGGG - Intronic
1168948904 20:1783155-1783177 CCCCAGCCATCCCATCTCTTTGG + Intergenic
1169018841 20:2313494-2313516 CCCCATCTAGACCATGAATGAGG - Intronic
1169300202 20:4435703-4435725 CACCCTCCTTACCATCCCTGCGG - Intergenic
1169527911 20:6450324-6450346 ACCCAGCCATCCCATTACTGGGG - Intergenic
1170337894 20:15291239-15291261 ACCCATCTATGCCATCACTGGGG + Intronic
1170800323 20:19584979-19585001 CCCCAGCCACATCTTCACTGAGG - Exonic
1171235314 20:23519630-23519652 CCCCAACCCTACCATTAGTGGGG - Intergenic
1173073838 20:39797092-39797114 ACCCTTCAATCCCATCACTGGGG - Intergenic
1173569784 20:44068689-44068711 CCGCCTCCCTACCATCCCTGAGG + Exonic
1174414070 20:50355670-50355692 TCCCATCCTTCCCATCACTTGGG + Intergenic
1175837653 20:62006498-62006520 CCCCTTCCATACCAGCGGTGTGG + Exonic
1175858329 20:62134740-62134762 CCCCAACCTTGACATCACTGTGG - Exonic
1176025808 20:62985061-62985083 CCTCATCCATTCCAGAACTGTGG - Intergenic
1180657756 22:17437559-17437581 CCCCATCCATACCATCACTGAGG + Intronic
1180706476 22:17813385-17813407 CTCCATCCATCCCATCTGTGGGG + Intronic
1181098748 22:20524558-20524580 CTCCATCCATACTCTGACTGTGG + Intronic
1181469569 22:23129364-23129386 CCCCACCCTGACCCTCACTGAGG + Intronic
1182996953 22:34822405-34822427 ACCCAGCCATCCCATTACTGGGG + Intergenic
949349010 3:3105227-3105249 CCCCATACACACCTTTACTGAGG - Intronic
949855042 3:8453491-8453513 CCCCATCCAGACCTCCACTTAGG + Intergenic
950172688 3:10850571-10850593 TCCCATCCTTCCCATCACAGAGG - Intronic
950582293 3:13870536-13870558 CCCCACCCAGACCATCTCTCAGG - Intronic
951348217 3:21572419-21572441 CCCCATCAATACAATCATTTAGG - Intronic
952919463 3:38274983-38275005 CCCCACCCATTCTGTCACTGTGG - Exonic
954575609 3:51674427-51674449 CCCCATCCGCAACGTCACTGTGG + Exonic
954812325 3:53255846-53255868 CTCCATCCAGGCCACCACTGCGG - Exonic
955065099 3:55527005-55527027 CCCCATCCAGGCCAGAACTGGGG - Intronic
955734149 3:62018799-62018821 ACTGATCCATACCATAACTGTGG - Intronic
958706587 3:97663846-97663868 ACCCAGCCATCCCATTACTGGGG - Intronic
958960794 3:100507681-100507703 CGCCATCCAGACCATCATGGTGG - Intronic
961575645 3:127833879-127833901 TCCCATCTCTACAATCACTGTGG + Intergenic
963123427 3:141794796-141794818 CCGTATCCAAACCATCACTGAGG - Intronic
964376599 3:156054221-156054243 CCCAATCAAGACCATCACTGAGG - Intronic
964385616 3:156144680-156144702 CACCATCACTACCACCACTGAGG - Intronic
964869156 3:161294006-161294028 CCCCATCCTTAGCATTACTGAGG - Intergenic
969872755 4:10115204-10115226 CCCCACCAATTCCATCACTCAGG + Intronic
974150875 4:58007774-58007796 ACCCAGCCATCCCATTACTGGGG - Intergenic
974225960 4:59045089-59045111 CCCCATCTCTACCTTCACTTTGG + Intergenic
974288296 4:59897590-59897612 ACCCAGCCATCCCATTACTGGGG + Intergenic
974488145 4:62530220-62530242 ACCCAGCCATCCCATTACTGCGG + Intergenic
974688713 4:65267357-65267379 CCTCTTCCTTACCTTCACTGTGG - Intergenic
974739900 4:65993812-65993834 ACCCAGCCATCCCATTACTGGGG - Intergenic
974844044 4:67329893-67329915 ACCCAGCCATCCCATTACTGGGG + Intergenic
982922669 4:161294748-161294770 CCCCATCCAAACCTTGACTTGGG - Intergenic
984116106 4:175683127-175683149 GCCCATCCCTTCCATCAGTGTGG + Intronic
984605415 4:181780148-181780170 ACCCAGCCATCCCATTACTGGGG - Intergenic
985620831 5:954279-954301 CTCCATCCACACCATCAGTCAGG + Intergenic
985717338 5:1470009-1470031 CCCTCTCCATAGCAACACTGGGG - Intronic
985923843 5:3000449-3000471 CTTCCTCCACACCATCACTGAGG + Intergenic
986081912 5:4403509-4403531 CTCCATCCACACCATGACTAGGG + Intergenic
986469744 5:8061866-8061888 CCCCTTACACACCCTCACTGTGG + Intergenic
989109742 5:37896006-37896028 CCCCATGCTTGCAATCACTGAGG + Intergenic
989128138 5:38076728-38076750 ACCCAGCCATCCCATTACTGGGG + Intergenic
989301885 5:39904480-39904502 ACCCAGCCATCCCATTACTGGGG + Intergenic
989648416 5:43661923-43661945 ACCCAGCCATCCCATTACTGGGG - Intronic
989649135 5:43667780-43667802 ACCCAGCCATCCCATTACTGGGG - Intronic
990682646 5:58262834-58262856 TCCCAACAATCCCATCACTGAGG + Intergenic
993878730 5:93339013-93339035 ACCCAGCCATCCCATTACTGGGG - Intergenic
993895473 5:93528528-93528550 ACCCAGCCATCCCATTACTGGGG + Intergenic
993922682 5:93827107-93827129 ACCCAGCCATCCCATTACTGGGG - Intronic
994143037 5:96362345-96362367 ACCCAGCCATCCCATTACTGGGG - Intergenic
996128416 5:119752753-119752775 CCCCAAACACACCCTCACTGGGG + Intergenic
996174905 5:120344427-120344449 CCTCATCCAGTCTATCACTGAGG - Intergenic
996241765 5:121212953-121212975 CCCCATCCACAGTGTCACTGGGG - Intergenic
996595796 5:125201307-125201329 CCACAGCCATACCCCCACTGTGG - Intergenic
996690082 5:126331030-126331052 CCCCACCCATGCCACCTCTGGGG - Intergenic
997793390 5:136783313-136783335 ACCCAGCCATCCCATTACTGGGG - Intergenic
997805473 5:136913076-136913098 ACCCAGCCATCCCATTACTGGGG - Intergenic
998520204 5:142793444-142793466 CCCCATCTATTCCATCTCTCTGG - Intronic
999367714 5:151033750-151033772 CCCCACCCAGAACATCTCTGCGG - Exonic
999518429 5:152324423-152324445 CCCCATCCAGACCTTGACTTGGG + Intergenic
1003296196 6:4831115-4831137 ACCCAGCCATCCCATTACTGGGG - Intronic
1003564822 6:7214174-7214196 CACCAGCCCTACCATCACTGTGG - Intronic
1003730153 6:8812724-8812746 ACCCAGCCATCCCATTACTGGGG + Intergenic
1004549940 6:16636975-16636997 ACCCAGCCATCCCATTACTGGGG + Intronic
1004717660 6:18233825-18233847 ACCCAGCCATCCCATTACTGGGG + Intronic
1005441222 6:25871118-25871140 ACCCAGCCATCCCATTACTGGGG + Intronic
1007377537 6:41466989-41467011 CCCCACCCATATCCTCACAGGGG + Intergenic
1007462615 6:42029535-42029557 CCCCACACATACTCTCACTGGGG + Intronic
1014058605 6:117044723-117044745 CCACATCCTTGCCATCACTTGGG - Intergenic
1014248604 6:119093783-119093805 CCTCATCCATATCCTCACAGAGG + Intronic
1015908590 6:138144163-138144185 GCCCTTCCCTACCATTACTGTGG + Intergenic
1018223371 6:161604409-161604431 CCCCATCCATATCACCATGGTGG - Intronic
1022501112 7:30882922-30882944 CACCACCCAAACCATCTCTGAGG + Exonic
1022530455 7:31063700-31063722 CCCCATCCCCACCTTCACTCAGG - Intronic
1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG + Intronic
1024718315 7:52106108-52106130 ACCCAGCCATCCCATTACTGTGG + Intergenic
1024747807 7:52428316-52428338 CTCCATCCAAACCTTCACTCAGG + Intergenic
1025112119 7:56226651-56226673 TCACATTCATACCATTACTGAGG + Intergenic
1027229641 7:76264726-76264748 CCCGGGCCACACCATCACTGTGG + Intronic
1027571699 7:79876384-79876406 TCCCAGCCATCCCATTACTGGGG + Intergenic
1030655292 7:112160926-112160948 CCCCATCAAGATCACCACTGTGG + Intronic
1032717155 7:134519143-134519165 CCCAATACATAAAATCACTGCGG - Intergenic
1035565678 8:639226-639248 TCCCACTCATCCCATCACTGAGG + Intronic
1036436760 8:8742182-8742204 CCCCATCCATACCAACAGTGTGG + Intergenic
1036700546 8:11010854-11010876 CCCCACTCATACCACGACTGTGG - Intronic
1036747256 8:11418600-11418622 CCCCATCACTGCCATCACGGTGG + Intronic
1037662915 8:20942414-20942436 CCCCATCCATAACGTAACTCAGG - Intergenic
1040123226 8:43705690-43705712 ACCCAGCCATCCCATTACTGGGG - Intergenic
1040364355 8:46699729-46699751 ACCCAGCCATCCCATTACTGGGG - Intergenic
1040368059 8:46740402-46740424 ACCCAGCCATCCCATTACTGGGG - Intergenic
1043312972 8:78885787-78885809 CACCATCCATCCCAGCACTGAGG - Intergenic
1044073457 8:87790303-87790325 ACCCAGCAATCCCATCACTGGGG + Intergenic
1045143027 8:99308691-99308713 ACCCAGCCATCCCATTACTGGGG - Intronic
1045221018 8:100200458-100200480 ACCCAGCCATCCCATTACTGGGG - Intronic
1045979838 8:108171879-108171901 ACCCAGCCATCCCATTACTGGGG + Intergenic
1046293052 8:112187503-112187525 ACCCAGCCATCCCATTACTGGGG + Intergenic
1046357064 8:113101161-113101183 CCCCATCAGTTCCATTACTGTGG + Intronic
1046874774 8:119241933-119241955 ACCCACCCATATCATCCCTGAGG + Intronic
1049403256 8:142440314-142440336 CCCCATGCATACGTTCACTGGGG - Intergenic
1051141546 9:13984695-13984717 ACCCAGCCATCCCATTACTGGGG - Intergenic
1051976990 9:22962673-22962695 ACCCAGCCATCCCATTACTGGGG + Intergenic
1055281583 9:74680546-74680568 CCCCATCCTTAGCATCCGTGTGG - Intronic
1056176944 9:84044966-84044988 GCCCATCACTACCACCACTGAGG - Intergenic
1060984979 9:127814753-127814775 CCCCATCCACACTCTCACTCTGG - Intergenic
1062401950 9:136376677-136376699 CCCCATCCAAGCCATCCCTCTGG + Intronic
1062568930 9:137175619-137175641 CCCAAACCACACCCTCACTGGGG + Intronic
1187892430 X:23948744-23948766 CCCCATCTCTACCATCACACTGG + Intergenic
1188131174 X:26434345-26434367 CCCCACCCATAGCAGCAGTGGGG - Intergenic
1190347078 X:49347720-49347742 CCCAAGCCATCCCATTACTGGGG - Intergenic
1194847854 X:98833843-98833865 ACCCATCAATCCCATCACTGGGG - Intergenic
1198601179 X:138285762-138285784 CCCTATCCTTACAATCATTGAGG + Intergenic