ID: 1180664541

View in Genome Browser
Species Human (GRCh38)
Location 22:17499382-17499404
Sequence CAGAGCACGGAAAAGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180664541_1180664551 19 Left 1180664541 22:17499382-17499404 CCAAACCCCTTTTCCGTGCTCTG 0: 1
1: 0
2: 1
3: 22
4: 279
Right 1180664551 22:17499424-17499446 CAGTCTCCGTGTGGAGCCATTGG 0: 1
1: 0
2: 0
3: 8
4: 102
1180664541_1180664552 20 Left 1180664541 22:17499382-17499404 CCAAACCCCTTTTCCGTGCTCTG 0: 1
1: 0
2: 1
3: 22
4: 279
Right 1180664552 22:17499425-17499447 AGTCTCCGTGTGGAGCCATTGGG 0: 1
1: 0
2: 0
3: 4
4: 89
1180664541_1180664550 10 Left 1180664541 22:17499382-17499404 CCAAACCCCTTTTCCGTGCTCTG 0: 1
1: 0
2: 1
3: 22
4: 279
Right 1180664550 22:17499415-17499437 GGATGCAGACAGTCTCCGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180664541 Original CRISPR CAGAGCACGGAAAAGGGGTT TGG (reversed) Intronic
900932661 1:5746878-5746900 CAGAGCACAGAAGCGGGGTGAGG + Intergenic
902999717 1:20256456-20256478 CAGAGCACAGAAAAGTGAGTAGG - Intergenic
903206106 1:21783588-21783610 GAGGGCTCGGGAAAGGGGTTCGG - Exonic
904915647 1:33968425-33968447 CAGAACATGAAAAAGGGGATGGG + Intronic
906344033 1:45004192-45004214 CACAGCACAGCACAGGGGTTGGG - Intronic
907722685 1:56986812-56986834 CAGCACACAGAGAAGGGGTTTGG - Intergenic
908256916 1:62310453-62310475 CGGAGACCAGAAAAGGGGTTTGG + Intronic
910927616 1:92412772-92412794 CAGAGAAAGGGAAAGGGATTTGG - Intergenic
910952761 1:92668580-92668602 CAGAAGCCGTAAAAGGGGTTGGG - Intronic
911084996 1:93968924-93968946 CAGAGCAGAGTAAAGGGGCTGGG + Intergenic
911173736 1:94797190-94797212 CAGAGGAAGGAAGATGGGTTTGG + Intergenic
911751611 1:101502764-101502786 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
912631161 1:111247863-111247885 CAGAACACTGGAAAGGGGTTGGG - Intergenic
913267627 1:117060366-117060388 CAGAGCACGGTAAGGGGCTAGGG + Exonic
915012468 1:152700090-152700112 CAGAGTATGGAACAGGGGTCCGG + Intergenic
915260782 1:154675365-154675387 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
916083878 1:161254248-161254270 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
916114651 1:161476441-161476463 GAGAGCAGGGTATAGGGGTTAGG - Intergenic
916479729 1:165204015-165204037 CAGGTCATGGAAAAGGGGCTCGG + Exonic
916939740 1:169665885-169665907 GAGAGCAGGGTATAGGGGTTGGG - Intronic
917521857 1:175754304-175754326 CAGAGCAAGGAAGATGGGGTTGG - Intergenic
921019908 1:211226063-211226085 AAGAGCAGGGTATAGGGGTTGGG - Intergenic
921322473 1:213955328-213955350 CAGATCACAGACCAGGGGTTGGG + Intergenic
921977874 1:221222109-221222131 CAGAGCAGGGTAAAGGCTTTGGG + Intergenic
922969943 1:229727767-229727789 CGGAGGAGGGGAAAGGGGTTGGG + Intergenic
923892713 1:238234023-238234045 CAGGGCAGGGAAAAGAGTTTTGG - Intergenic
924440479 1:244081659-244081681 CAGAGCAGGGAAAATGGTTGTGG - Intergenic
1063928132 10:11000821-11000843 CAGAGCATGGAACTGGGGTCTGG + Intergenic
1064647914 10:17479013-17479035 CAGAGCGTGGAAAAGTGGTCAGG - Intergenic
1065082635 10:22142667-22142689 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1066614366 10:37280776-37280798 GAGAGCAGGGTATAGGGGTTGGG + Intronic
1067914800 10:50385877-50385899 CACAGCACATAACAGGGGTTCGG - Intronic
1069137129 10:64780943-64780965 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1069591075 10:69642330-69642352 CAGAACACGGCAAAGGGGAGGGG - Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1071506278 10:86233749-86233771 CAGAGCCTGGGACAGGGGTTGGG - Intronic
1071523997 10:86347623-86347645 GAGAGCAGGGACAAGGGGTGTGG + Intronic
1072371447 10:94769503-94769525 CAGAGCAGGGTTTAGGGGTTGGG + Intronic
1075223038 10:120600962-120600984 CAGAGGTTGGAAATGGGGTTGGG - Intergenic
1076007141 10:126956762-126956784 CAGGGCACAGAACAGGGGTTTGG + Intronic
1076026437 10:127118620-127118642 CAGAGCAAGTAAAAGGGTGTTGG - Intronic
1077565628 11:3297936-3297958 CAGAGCACGGGATAGAGGATAGG - Intergenic
1078857857 11:15221100-15221122 CACAGCAAGGAAGAGGGGATTGG + Intronic
1078927834 11:15890396-15890418 CAGAGGAGGGAGAAGGGCTTTGG - Intergenic
1079689298 11:23402440-23402462 TAGAGCAGGGAAGAGGGGTGAGG - Intergenic
1079731000 11:23937713-23937735 GAGAGCAAGGTATAGGGGTTGGG + Intergenic
1080619465 11:33975031-33975053 CAGAGCACGGCCATGGCGTTTGG - Intergenic
1083205636 11:61147155-61147177 CAGATCACAGAAAAGGGGGTGGG + Intronic
1086317610 11:85610359-85610381 GAGAGCAGGGTATAGGGGTTGGG - Intronic
1087075203 11:94122047-94122069 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1087683122 11:101236801-101236823 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1088492759 11:110403249-110403271 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1088618902 11:111662451-111662473 CAGAGCAGGGTAAAGGGGCCAGG + Intronic
1088928864 11:114328929-114328951 AAGAGGCAGGAAAAGGGGTTAGG - Intergenic
1088961289 11:114668154-114668176 CAGAGTACAGAAAAGTAGTTTGG - Intergenic
1090385962 11:126357696-126357718 TGGAGCACAGAAAGGGGGTTTGG - Intronic
1092472535 12:8792135-8792157 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1095996223 12:48087586-48087608 CACACCAAGGAAAAGGGATTGGG + Intronic
1096456123 12:51788581-51788603 GAGAACACAGAACAGGGGTTTGG - Intronic
1096755408 12:53795434-53795456 CAGAGCAGGGAGAATTGGTTTGG - Intergenic
1096800633 12:54108137-54108159 CAAAGCATGGAAGAGGGGTGGGG + Intergenic
1098567564 12:71953144-71953166 AAAAGCAGGGAAAAGGGGGTGGG - Intronic
1099887334 12:88548006-88548028 TAGAGCAAGGTAAAGGGGATTGG + Intronic
1102445898 12:113002618-113002640 CTGGGCATGGAAAAGGAGTTTGG + Intronic
1102516098 12:113447877-113447899 CAGAGCACGGGAGGGGGGTGGGG + Intergenic
1103261612 12:119593704-119593726 CAGAGGACGCAGAAGGGGTGAGG + Exonic
1103438829 12:120947920-120947942 CAAAGCACAGAAAAGGGGAGGGG - Intergenic
1103982656 12:124746526-124746548 CAGAGCACATAGAAAGGGTTTGG + Intergenic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105762709 13:23528702-23528724 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1106766301 13:32917121-32917143 CAAAGCAAGCAAAAGGGGATTGG - Intergenic
1108848825 13:54704105-54704127 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1109424670 13:62154120-62154142 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1112519352 13:100082137-100082159 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1112538604 13:100284656-100284678 GAGAGCAGGGTATAGGGGTTGGG - Intronic
1113240161 13:108328360-108328382 CAGATCACGGAAGAAGGATTTGG + Intergenic
1113551276 13:111194920-111194942 GAGAGCAGGGTATAGGGGTTGGG + Intronic
1114546732 14:23508494-23508516 TAGAGGAGGGTAAAGGGGTTGGG + Intronic
1115318865 14:32056701-32056723 GAGTGCAAGGAAAAGGGGTAAGG - Intergenic
1115496032 14:34005625-34005647 CAGAGCATGGCAAATGGGGTAGG + Intronic
1117531436 14:56664184-56664206 CAGAGCATGAAACAGGGGTCTGG + Intronic
1117644880 14:57841296-57841318 GAGACCAGGCAAAAGGGGTTTGG + Intronic
1121963835 14:98286194-98286216 GAGAGAACAGAAAAGGGGATAGG + Intergenic
1123830416 15:24130306-24130328 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123850671 15:24352912-24352934 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123935388 15:25191609-25191631 AGGAGCACGGAGAAGGGGTTGGG - Intergenic
1124020673 15:25919801-25919823 CAAAGCATGGAAAAAGGATTCGG - Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1129885759 15:79036026-79036048 CAGTGGATGGAAAACGGGTTGGG - Intronic
1133322888 16:4925170-4925192 CAGAGCCCAGAGAAGGGGCTGGG + Intronic
1133974886 16:10593608-10593630 CAGGGCACGTAAAAAGTGTTCGG - Intergenic
1135020079 16:18955978-18956000 CAGGGCACGGAAAACTGGTTAGG + Intergenic
1135045020 16:19148210-19148232 CAGAGCACAGTAATGGGGTTTGG - Intronic
1135339448 16:21633613-21633635 GAGAGCAGGGTATAGGGGTTGGG + Intronic
1135715663 16:24764107-24764129 CAGAGAACAGAATAGTGGTTAGG - Intronic
1135932902 16:26754332-26754354 CAGGGCATGGGAAAAGGGTTGGG + Intergenic
1138528952 16:57624729-57624751 CAGGACAGGGATAAGGGGTTAGG - Intronic
1139359776 16:66390370-66390392 CAGAGCACCCCAAAGGGCTTTGG - Intronic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143994188 17:10992551-10992573 CAGAGCAAAGAAAAAGAGTTTGG - Intergenic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1146310728 17:31766334-31766356 GAGAGCAGGGTACAGGGGTTGGG - Intergenic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1147237921 17:39071444-39071466 CAGAGCAGAGCAAAGGGGATGGG - Intronic
1147338947 17:39742612-39742634 CAGAGCTCAGGGAAGGGGTTGGG - Exonic
1147386953 17:40088630-40088652 CAGAGCAAGGAACAGGGGATAGG - Intronic
1149213210 17:54326945-54326967 CAGAGCAGTGAACAGGGGCTGGG + Intergenic
1151568242 17:74912218-74912240 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1152812032 17:82386683-82386705 GAGAGCACGGGAAGGGGGCTGGG + Intergenic
1152917701 17:83050710-83050732 CGGAGCACGGGGAAGGTGTTCGG + Intronic
1153257995 18:3192078-3192100 CAGAGCAGGGAGAAGATGTTAGG + Intronic
1155475901 18:26235787-26235809 GAGAGCAGGGTATAGGGGTTGGG + Intronic
1156090820 18:33466631-33466653 CAGAGCAGGAAAAAGGGGGGTGG - Intergenic
1156116822 18:33795675-33795697 CTGATCACTCAAAAGGGGTTAGG - Intergenic
1157264669 18:46207896-46207918 CAGAGCACTAAAAATGGGGTAGG - Intronic
1157857347 18:51114998-51115020 GAGAGCAGGGTATAGGGGTTTGG + Intergenic
1158517672 18:58144348-58144370 CAGAGCAGGAGCAAGGGGTTGGG + Intronic
1159136695 18:64345137-64345159 CAGAGTAGGGAAGAGGGGTTTGG - Intergenic
1161225941 19:3146028-3146050 CGGAGCACGGAGAAGGGGCGGGG - Intronic
1161598004 19:5162072-5162094 GAGAGCAGGGTATAGGGGTTGGG + Intronic
1161818575 19:6515549-6515571 CAGAACCCAGAAAAGGGGCTAGG + Intergenic
1161999648 19:7735179-7735201 AAGAGCAGGGACAAGAGGTTTGG + Intergenic
1162006466 19:7783566-7783588 AAGAGCAGGGACAAGAGGTTTGG - Intergenic
1162405904 19:10473671-10473693 CAGAGTCGGGAAAAGGGCTTTGG + Intergenic
1162999866 19:14360226-14360248 CAGAGCTCAGAAAAGGGTTGGGG - Intergenic
1163002329 19:14376024-14376046 CAGAGAACGGGAAAGAGGGTGGG - Intergenic
1163717723 19:18881637-18881659 CAGAGCAAGGAACAGGGACTTGG - Intronic
1164851894 19:31490970-31490992 CAGAGCTCTTAGAAGGGGTTGGG + Intergenic
1167684903 19:50950117-50950139 CTGGGAACGGAAAATGGGTTGGG + Intronic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925967046 2:9075836-9075858 CACAGAAAGGCAAAGGGGTTAGG - Intergenic
926631544 2:15141143-15141165 AAGAGAAGGGAAAAGGGGATGGG - Intergenic
927874913 2:26648798-26648820 CAGAGCAGGAATAAGGGGCTGGG - Intergenic
929191235 2:39142014-39142036 AAGAGTATGGAAAAGGGATTTGG - Intergenic
929777878 2:44939684-44939706 GAGAGCACTGAAATGGGGCTTGG + Intergenic
929915905 2:46135355-46135377 CAGAGCATGGAAGTGGGGTCAGG + Intronic
931936513 2:67203220-67203242 CAGAGCAGAGAGAAGGGTTTTGG + Intergenic
933759040 2:85661838-85661860 GAGAGCATGGAAAAGGGGGATGG - Intronic
934867343 2:97824957-97824979 GAGAGCAGGGTATAGGGGTTGGG - Intronic
935096758 2:99952251-99952273 CAGAGCAGGAGGAAGGGGTTTGG - Intronic
936032027 2:109080102-109080124 CAGAGGAGGGAAAAGGAGATGGG + Intergenic
936587049 2:113767270-113767292 GAGAGCAAGGCAAAGGGATTTGG - Intergenic
937432872 2:121854362-121854384 CACAGCACAGGAAAGGGGTGAGG - Intergenic
937897665 2:126990865-126990887 AAGAGGAAGGAAAAGGGATTTGG + Intergenic
937921632 2:127135586-127135608 CAGAGGAGGAAACAGGGGTTTGG + Intergenic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
940904970 2:159160922-159160944 GAGAGGAAGGAAAAGGGGTGGGG - Intronic
943117012 2:183685501-183685523 CAGAGGCCGGAAAAGGGAATGGG - Intergenic
943133966 2:183889296-183889318 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
943221466 2:185112599-185112621 CAGAGGAAGGAAGAGGTGTTGGG - Intergenic
943531214 2:189083300-189083322 CAGAGAACGGCAAAGGGGCCAGG + Intronic
944729217 2:202500768-202500790 GAGAGCAGGGTATAGGGGTTGGG - Intronic
946207155 2:218118081-218118103 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
946353269 2:219169279-219169301 CAGAGCAAGGGCAAGGGGTAAGG - Exonic
1168805407 20:669767-669789 CAGAGCTGGGCAAAGGGGCTGGG + Intronic
1168857119 20:1016569-1016591 CAGAGCTGGGAAAAGGATTTGGG - Intergenic
1168917889 20:1506262-1506284 TAGACCAGGGAAAGGGGGTTGGG + Intergenic
1170419474 20:16178524-16178546 CAGAGAACTGGAAAGGGGATTGG - Intergenic
1171795823 20:29566219-29566241 CAAAGCATGGAAGAGGGGTGGGG - Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175766143 20:61594193-61594215 CTGAGCAGGGGAAAGGGGTCAGG + Intronic
1175876300 20:62231837-62231859 CAGAGCAAGGGAAAGTTGTTTGG - Intergenic
1180626204 22:17195090-17195112 AAGATGAAGGAAAAGGGGTTTGG - Intronic
1180664541 22:17499382-17499404 CAGAGCACGGAAAAGGGGTTTGG - Intronic
1183202052 22:36392123-36392145 TAGAGGCTGGAAAAGGGGTTAGG - Intergenic
1183733335 22:39630234-39630256 CAGAGAAGGGAGAAAGGGTTGGG - Intronic
1184811344 22:46834634-46834656 AAGAGCAAGGAAAAGGGGCTGGG + Intronic
951020697 3:17778299-17778321 GAGAGCAGGGTATAGGGGTTGGG - Intronic
954076373 3:48184409-48184431 CAGAGCACAGAGTAAGGGTTTGG + Intronic
954155657 3:48683664-48683686 CAGAGCCTGGAACAGGGGCTAGG - Intronic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
956369137 3:68539312-68539334 CAGAGAACTGAAAAGGGTTTTGG + Intronic
957436514 3:80184158-80184180 TAGAACACGTAAGAGGGGTTTGG - Intergenic
958549025 3:95591627-95591649 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
959826794 3:110806875-110806897 GAGAGCAGGGAAGAGGGCTTGGG - Intergenic
960136551 3:114111583-114111605 CAGAGCAGGGAAGGGGGGTGTGG - Intergenic
962635867 3:137330795-137330817 AGGAGCACAGAAAAGAGGTTGGG - Intergenic
963296246 3:143549834-143549856 CAGAGAACCAAAAAGAGGTTAGG + Intronic
963702215 3:148640675-148640697 CACAGCACTGAAGAGGGGCTGGG + Intergenic
964064710 3:152563684-152563706 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
965139401 3:164815345-164815367 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
965463497 3:168998676-168998698 CAGAGTACAGAAAAGGCCTTAGG + Intergenic
966862374 3:184237491-184237513 CAGAGAATGGAAAAAGGGTTTGG - Intronic
967817248 3:193809905-193809927 CAGAGTCAGGGAAAGGGGTTAGG - Intergenic
970921448 4:21400035-21400057 CAGAGCAGGAAAAAGGGATTTGG - Intronic
971578667 4:28306880-28306902 GAGAGCAAGGTATAGGGGTTGGG - Intergenic
973757159 4:54086612-54086634 TAGAGCATGGAAAAGGGATTGGG + Intronic
974174705 4:58308215-58308237 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
975595624 4:76046322-76046344 GAGAGCAGGGTATAGGGGTTGGG + Intronic
976827557 4:89277613-89277635 CAGAGGATGAAAAAGGAGTTTGG - Intronic
977559425 4:98517396-98517418 CAGAGCCTGGGAAAGGGGTGAGG + Intronic
977884282 4:102239163-102239185 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
979005655 4:115292612-115292634 CAGAGCAGGGGAAGGGAGTTAGG - Intergenic
980290704 4:130845367-130845389 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
982701324 4:158661845-158661867 GAGAGCAAGGTATAGGGGTTGGG - Intergenic
983698734 4:170565618-170565640 CTGAGCAAGGCAAAGGGGCTTGG + Intergenic
983834743 4:172373327-172373349 GAGAGCAGGGAATAGGGGTTGGG + Intronic
984917649 4:184738301-184738323 GAGAGCACAGTATAGGGGTTGGG - Intergenic
985105020 4:186491439-186491461 GAGGGAACGAAAAAGGGGTTTGG - Intronic
985106747 4:186507103-186507125 CAGAGTATGGCAAAGGGGCTGGG - Intronic
985632688 5:1022181-1022203 AAGAGCAGGGACAATGGGTTGGG - Intronic
985633802 5:1026411-1026433 AAGAGCAGGGAAAAAGGGCTGGG - Intronic
986513395 5:8533529-8533551 CAGAGCACCGCAAAAGGGATGGG + Intergenic
987081759 5:14431535-14431557 CAGACTCCTGAAAAGGGGTTGGG - Intronic
987545048 5:19303481-19303503 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
987818066 5:22929977-22929999 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
988591812 5:32555997-32556019 GAGAGCAGGGTATAGGGGTTGGG + Intronic
989496370 5:42114724-42114746 CAGAGCAGGGTATAGGGGTTGGG - Intergenic
991090548 5:62690021-62690043 CAGGGCACGGAAGTGGGGTTGGG - Intergenic
993598723 5:89892470-89892492 AAGAGCAAGGAAAAGGGGCAGGG + Intergenic
994083175 5:95731021-95731043 CAGAGCCAGGAAAGGGGGGTGGG - Intronic
995076402 5:107989979-107990001 GAGAGAAATGAAAAGGGGTTAGG - Intronic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995369290 5:111400849-111400871 AAGTCCATGGAAAAGGGGTTTGG - Intronic
995583223 5:113621941-113621963 GAGAGCAAGGTATAGGGGTTGGG + Intergenic
998111651 5:139507188-139507210 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
998804089 5:145901586-145901608 CAGAGCAGGGTAAAGGGGATTGG + Intergenic
998825832 5:146100282-146100304 CAGAGCTTGGAAGAGGGGTTAGG + Intronic
999518060 5:152320842-152320864 GACAGCAGTGAAAAGGGGTTAGG + Intergenic
1001690016 5:173625945-173625967 CAGAGCACTGAAATGGAGGTAGG - Intergenic
1002408040 5:179051658-179051680 CAGAGGACGGCAAAGGTATTAGG - Intergenic
1002862384 6:1091637-1091659 CAGACCAGGGAAAAGGGGAAAGG - Intergenic
1004360835 6:14969344-14969366 TAGACAAAGGAAAAGGGGTTTGG + Intergenic
1004531563 6:16459545-16459567 GAGAGCAGGGTATAGGGGTTGGG - Intronic
1004812434 6:19275085-19275107 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1006514746 6:34539566-34539588 CAGGGCAAGGAGAGGGGGTTGGG + Intronic
1006780306 6:36627869-36627891 CAAGGCAGGGACAAGGGGTTAGG + Intergenic
1007171258 6:39865137-39865159 CAGAGCACTGCACAGGGCTTCGG - Intronic
1007616212 6:43181054-43181076 AAGAGCAGAGAAAAGGGGCTGGG - Exonic
1009407522 6:63329369-63329391 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1010270009 6:73907669-73907691 GAGAGCAAGGTATAGGGGTTGGG - Intergenic
1011374865 6:86677522-86677544 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1012569348 6:100702491-100702513 CAGAGCTCAGAAAAGAGGTCTGG + Intronic
1013061132 6:106635086-106635108 CAGAGCTCAGAAAAGAGGCTAGG + Intronic
1014283926 6:119474216-119474238 TAAAGCACGAAAAAGGTGTTAGG + Intergenic
1014700914 6:124686699-124686721 CAGAACACAGAAAAGGGGATAGG - Intronic
1015880099 6:137863764-137863786 CAGTGCAGGGAAAAGGGGAGGGG + Intergenic
1016795685 6:148114756-148114778 CAGAGCAGGGAACAGAGGTCTGG + Intergenic
1017293722 6:152770572-152770594 CAGAGCACAGAAAATTGTTTTGG + Intergenic
1018790470 6:167144098-167144120 CAGAATACGGAAGTGGGGTTTGG - Intergenic
1021356406 7:19657162-19657184 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1027966122 7:85010886-85010908 CAGAGAATGGAAAAGTGGCTGGG + Intronic
1028495042 7:91452466-91452488 GAGAGCAAGGTATAGGGGTTGGG + Intergenic
1030011572 7:105173728-105173750 CAGAGAACAGAAAAGGAGTATGG + Intronic
1031010958 7:116525324-116525346 GAGGACACGGAAAAGGGGATTGG + Intronic
1031546467 7:123056013-123056035 CAGAGAAGAGAAAAGGGATTGGG + Intergenic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1032686131 7:134235517-134235539 CAGAGCAGGGAAAAGGGGCTAGG - Intronic
1033759054 7:144421056-144421078 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1034579791 7:152032411-152032433 GAGAGCAGGGTATAGGGGTTGGG + Intronic
1035918201 8:3648551-3648573 CAGAGCACAGAAAATTGTTTTGG + Intronic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1038219033 8:25590124-25590146 CCGTGCACTGAAAAGGGCTTGGG + Intergenic
1038297153 8:26304423-26304445 CAGAGTAGGTAAAAGGGATTGGG + Intronic
1038430600 8:27496525-27496547 GAGAGCAGGGTATAGGGGTTGGG + Intronic
1038638972 8:29308836-29308858 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1039999502 8:42564288-42564310 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1040667691 8:49653147-49653169 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1040953586 8:52958519-52958541 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1040964880 8:53073228-53073250 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1040971280 8:53139713-53139735 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1041002096 8:53463449-53463471 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1041957690 8:63574414-63574436 CAGAGGAAGGAAGAGGAGTTGGG - Intergenic
1043257237 8:78151435-78151457 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1044456453 8:92397022-92397044 CAGAGCAGGGTATAGGGGTTGGG + Intergenic
1045698159 8:104834761-104834783 CAGATCGGGGATAAGGGGTTGGG - Intronic
1048275783 8:133064886-133064908 CGGTGCACGATAAAGGGGTTCGG - Intronic
1050945820 9:11515733-11515755 CACAGCATGGAAAAGAGTTTTGG - Intergenic
1051935449 9:22438411-22438433 GAGAGCAAGGTATAGGGGTTGGG - Intergenic
1052057596 9:23922006-23922028 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1052289682 9:26827224-26827246 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1054154945 9:61633541-61633563 CAAAGCATGGAAGAGGGGTAGGG - Intergenic
1056977081 9:91267804-91267826 CAGAGTAGAGAAAAGGGGCTAGG - Intronic
1057223513 9:93270994-93271016 GAGAGCACAGAAAAGGAGTTTGG + Intronic
1058851940 9:109020988-109021010 CAGTGCAGGAAAAATGGGTTAGG + Intronic
1059151875 9:111956382-111956404 CAGAGAGCAGAAAAGGGGTGAGG - Intergenic
1061377247 9:130233898-130233920 GGCAGCAGGGAAAAGGGGTTTGG - Exonic
1186197918 X:7128534-7128556 CAGAGCATGAAAAAGGGCTAGGG + Intronic
1188136696 X:26501336-26501358 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1188805195 X:34579289-34579311 CTGAGCATGGAAAAGGAATTTGG - Intergenic
1189745206 X:44161643-44161665 CAGAGCACGGTAGAGGGCTCTGG + Intronic
1189967900 X:46392986-46393008 TAGACCAAGGAAAAGGGATTTGG + Intergenic
1190310446 X:49113710-49113732 CAGAGCACGGAGCCGGGCTTTGG - Exonic
1190869109 X:54410344-54410366 CAGAGCATGGAAAAGCTGATGGG - Intergenic
1192001278 X:67154613-67154635 CAGAGCATCCAACAGGGGTTTGG + Intergenic
1192482577 X:71498342-71498364 GAGAGCAGGGTATAGGGGTTGGG + Intronic
1196127176 X:112112929-112112951 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1196786882 X:119428693-119428715 CAGGCCACGGACCAGGGGTTGGG - Intronic
1199716459 X:150510462-150510484 TAGGGAATGGAAAAGGGGTTGGG + Intronic
1200776380 Y:7173654-7173676 GAGAGCATGGTATAGGGGTTGGG - Intergenic
1201487746 Y:14510185-14510207 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1201555913 Y:15264576-15264598 GAGAGCAGGGTATAGGGGTTTGG - Intergenic
1202243053 Y:22790016-22790038 CAGAGCAGGGTATAGGGTTTGGG - Intergenic
1202253067 Y:22893023-22893045 GAGAGCAGGGAAAAGGTGTAGGG + Intergenic
1202258048 Y:22941172-22941194 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1202396040 Y:24423766-24423788 CAGAGCAGGGTATAGGGTTTGGG - Intergenic
1202406057 Y:24526772-24526794 GAGAGCAGGGAAAAGGTGTAGGG + Intergenic
1202411038 Y:24574930-24574952 GAGAGCAGGGTATAGGGGTTGGG - Intergenic
1202459743 Y:25095142-25095164 GAGAGCAGGGTATAGGGGTTGGG + Intergenic
1202464723 Y:25143309-25143331 GAGAGCAGGGAAAAGGTGTAGGG - Intergenic
1202474745 Y:25246326-25246348 CAGAGCAGGGTATAGGGTTTGGG + Intergenic