ID: 1180665322

View in Genome Browser
Species Human (GRCh38)
Location 22:17506263-17506285
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 986
Summary {0: 2, 1: 11, 2: 79, 3: 239, 4: 655}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180665322_1180665328 11 Left 1180665322 22:17506263-17506285 CCTGCAGGCACATGCCACCACGC 0: 2
1: 11
2: 79
3: 239
4: 655
Right 1180665328 22:17506297-17506319 TTTAATTTTATCTGTGCGTAGGG 0: 1
1: 0
2: 0
3: 23
4: 291
1180665322_1180665330 30 Left 1180665322 22:17506263-17506285 CCTGCAGGCACATGCCACCACGC 0: 2
1: 11
2: 79
3: 239
4: 655
Right 1180665330 22:17506316-17506338 AGGGTTTCCCTATGTTGCCTGGG 0: 6
1: 224
2: 3055
3: 24466
4: 113874
1180665322_1180665329 29 Left 1180665322 22:17506263-17506285 CCTGCAGGCACATGCCACCACGC 0: 2
1: 11
2: 79
3: 239
4: 655
Right 1180665329 22:17506315-17506337 TAGGGTTTCCCTATGTTGCCTGG 0: 3
1: 18
2: 203
3: 1545
4: 5707
1180665322_1180665327 10 Left 1180665322 22:17506263-17506285 CCTGCAGGCACATGCCACCACGC 0: 2
1: 11
2: 79
3: 239
4: 655
Right 1180665327 22:17506296-17506318 TTTTAATTTTATCTGTGCGTAGG 0: 1
1: 0
2: 0
3: 17
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180665322 Original CRISPR GCGTGGTGGCATGTGCCTGC AGG (reversed) Intronic
900187696 1:1339998-1340020 GCGGGGTGACATGTAGCTGCGGG - Intronic
900984771 1:6066833-6066855 GCCTGGCTGCCTGTGCCTGCTGG - Intronic
901042732 1:6375136-6375158 GCGTGGTGGCGGGCGCCTGTAGG + Intronic
901097990 1:6697927-6697949 GCGTGGTGGCGGGCGCCTGTAGG - Intronic
901316508 1:8313639-8313661 GCGTGGTGGCGTGCACCTGTAGG - Intergenic
901693861 1:10991968-10991990 GCATGGTGGCATGTAACTGTAGG + Intergenic
901906136 1:12413343-12413365 GCGTGGTGGTATGTACCTGTAGG + Intronic
902424048 1:16305247-16305269 GCGTGGTGGCATGCACCTGTGGG + Intronic
902497357 1:16882736-16882758 GCGTGATGGCATGCGCCTATAGG - Intronic
902775144 1:18669943-18669965 GCGTGGTGGCACGTGCCTGTAGG + Intronic
903578624 1:24354528-24354550 GCGTGGGGCCACGTCCCTGCTGG - Intronic
903594120 1:24480937-24480959 GCGTGGTGGCGTATGCCTGTAGG - Intergenic
903612711 1:24627964-24627986 GTGTGGTGGCATGTGCCCATGGG + Intergenic
903769316 1:25753995-25754017 GGATGGTGTGATGTGCCTGCTGG - Intronic
903772213 1:25771069-25771091 CCCTGGTGGCCTCTGCCTGCTGG - Intronic
904097828 1:27995271-27995293 GTATGGTGGCATGCGCCTGTGGG + Intronic
904110018 1:28118512-28118534 GTGTAGTGGCTTGTGCCTGGTGG + Intergenic
904207436 1:28864127-28864149 GCATGGTGGTGTGTACCTGCAGG + Intergenic
904507157 1:30966947-30966969 GAGGGGTGGCATGTGCCAGCTGG - Intronic
904690417 1:32289694-32289716 GCGTGGTGGTGTGTGCCTGTAGG - Intergenic
904799205 1:33081153-33081175 GCGTGGGGGTCTGTGGCTGCTGG + Exonic
905114039 1:35621855-35621877 GTATGGTGGCATGTGCCTGTAGG + Intronic
905185032 1:36190139-36190161 GCATGGTGGCATATGCCTGTAGG - Intergenic
905454731 1:38080408-38080430 GCATTGTGGCAGGTGCCTGTAGG - Intergenic
905679977 1:39863324-39863346 GTGTGGTGGCACGTGCCTCCCGG + Intronic
905759186 1:40539357-40539379 GTGTGGTGGCATGTGCCTGTAGG + Intronic
906215145 1:44034154-44034176 GAGTGGTGTCATCAGCCTGCAGG + Intergenic
906785193 1:48609559-48609581 GTGCGGTGGCATGTGCCTATAGG - Intronic
907074182 1:51563943-51563965 GTGTGGTGGCATGCACCTGGTGG + Intergenic
907900202 1:58734343-58734365 GCATGGTGGCATCTGCTTCCGGG + Intergenic
908705423 1:66948758-66948780 GCATGGTGGCATGCACCTGTAGG + Intronic
909687273 1:78364341-78364363 GCGTGGTGGCACGCACCTGTAGG - Intronic
909896735 1:81080658-81080680 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
910584670 1:88866226-88866248 GCGTGGTGGCATGTGCCTGTAGG + Intronic
910908769 1:92211727-92211749 GCGTGGTGGCACACGCCTGTAGG - Intergenic
910952698 1:92667752-92667774 GCGTGGTGGCATGTGCCTGTAGG - Intronic
911406590 1:97448083-97448105 GCATGGTGGCATGCACCTGTAGG + Intronic
912047191 1:105473523-105473545 GCATGGTGGCACGTGCCTCGTGG - Intergenic
912161617 1:106992622-106992644 GCGTGATGGCGGGCGCCTGCAGG + Intergenic
912655760 1:111485220-111485242 GCATGGTGGCAGGCGCCTGTGGG + Intronic
912780495 1:112542614-112542636 GCATGGTGGTGTGTGCCTGTAGG + Intronic
912989840 1:114474433-114474455 GTGTGGTGGTATTTGCCTGCAGG + Intronic
913454184 1:119014332-119014354 GCATGGTGGCACATGCCTGTAGG - Intergenic
913504536 1:119504339-119504361 GCATGGTGGCAGGTGCCTGGAGG + Intergenic
914597348 1:149166643-149166665 GTGTGGTGGTGTGTGCCTGTAGG - Intergenic
914761298 1:150600757-150600779 GCATGGTGGCACGTGCCTGTAGG + Intergenic
915752609 1:158226315-158226337 GTGTGGTGGTGTGTGCCTACAGG - Intergenic
916609051 1:166372234-166372256 GCGTGGTGGGAAGTTCTTGCTGG - Intergenic
916810493 1:168301399-168301421 GCATGGTGGCACATGCCTGTGGG - Intronic
917427047 1:174925224-174925246 GCGTGGTGGCGGGCGCCTGGAGG + Intronic
917427533 1:174930454-174930476 GCATGGTGGCATGTGACTGCAGG - Intronic
917551984 1:176041971-176041993 ACATGGTGGCACGTGCCTGTAGG + Intronic
917683994 1:177397274-177397296 CCTGGGTGGCATTTGCCTGCTGG - Intergenic
917823288 1:178789043-178789065 GCGTGGTGGCATGCACCTGGAGG - Intronic
917876753 1:179293463-179293485 GCGTGGTAGCATGGAGCTGCAGG - Intergenic
918096282 1:181337292-181337314 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
918603961 1:186399342-186399364 GCATCATGGCATGTGCCTGCAGG - Intronic
918761948 1:188420984-188421006 GTGTGGTGGCGTGTGCCTGTAGG - Intergenic
919168482 1:193925475-193925497 GCATGATGGCATGTGCCTGAAGG - Intergenic
919204768 1:194407646-194407668 GCGTGGTGGCATGTACAGGTGGG + Intergenic
919680024 1:200425052-200425074 GTGTGGTGGCACGTGCCTATAGG + Intergenic
919689839 1:200519433-200519455 GCGTGGTGGCATAGGCGTGGTGG + Intergenic
919810118 1:201404040-201404062 GCCTGGTGGAATGTCCCTGGAGG - Intronic
919912380 1:202119423-202119445 GCATGGTGGCATGTGCCTGTGGG + Intergenic
920076036 1:203337539-203337561 GCGTGGTGGTGGGTGCCTGTAGG - Intergenic
920453345 1:206077631-206077653 GCATGGTGGTGAGTGCCTGCAGG + Intronic
920586110 1:207163007-207163029 ACGTGGTGGCAGGTGCCTGTAGG + Intergenic
920778460 1:208964560-208964582 GCGTGGTGGCACGTGCCTGTTGG - Intergenic
922426691 1:225503412-225503434 GCATGGTTGCATGTGCCTGTGGG - Intronic
922831335 1:228556064-228556086 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
922831845 1:228558108-228558130 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922832326 1:228610090-228610112 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922832886 1:228612331-228612353 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922833447 1:228614572-228614594 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922834007 1:228616813-228616835 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922834564 1:228619054-228619076 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922835116 1:228621269-228621291 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922835675 1:228623489-228623511 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922836233 1:228625731-228625753 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922836791 1:228627970-228627992 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922837350 1:228630212-228630234 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922837911 1:228632453-228632475 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922838469 1:228634693-228634715 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922839027 1:228636918-228636940 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922839587 1:228639159-228639181 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922840148 1:228641390-228641412 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922840708 1:228643631-228643653 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922841271 1:228645862-228645884 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
922879456 1:228969650-228969672 GCAAAGTGGCATGTGCCTGTAGG + Intergenic
923282288 1:232455540-232455562 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
923478790 1:234363219-234363241 GCATGGTGGCGTGTGCCTGTAGG + Intergenic
923585636 1:235267691-235267713 GTGTGGTGGCGGGTGCCTGTAGG + Intronic
923607548 1:235458177-235458199 GGCTGGTGGCTTATGCCTGCCGG - Intronic
923609521 1:235477627-235477649 GGGTGGTGTCCTGTGGCTGCAGG + Intronic
923658393 1:235938107-235938129 GCATGGTGGCGGGCGCCTGCAGG - Intergenic
923669578 1:236029036-236029058 GTGTGGTGGCATGTGCCTGTAGG + Intronic
923862443 1:237905025-237905047 GCGTGGTGGCGTGTGCCCTGTGG + Intergenic
924248841 1:242110669-242110691 GTGTGGTGGCATGTGCCTGCAGG + Intronic
924789910 1:247236524-247236546 GTGTGGTGGCAGGCGCCTGGTGG + Intergenic
924928959 1:248710147-248710169 GAATGGTGGCGTGTGCCTGTAGG - Intergenic
1063072092 10:2676896-2676918 GCATGGTGGCACATGCCTGTGGG + Intergenic
1063890188 10:10620765-10620787 GAGTGGTGGCAGGCGCCTGTAGG + Intergenic
1063895040 10:10671026-10671048 GCACGGTGGCATGTACCTGCAGG + Intergenic
1064053736 10:12080139-12080161 GCGTGGTGGCGGGTGCCTGTGGG + Intronic
1064451498 10:15445987-15446009 GCGCGGTGGCGGGTGCCTGTAGG - Intergenic
1064768966 10:18704020-18704042 GCATGGTGGCACGTGCCTATAGG - Intergenic
1064998955 10:21319922-21319944 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
1065451751 10:25866382-25866404 GCACAGTGGCATGTGCCTGTAGG - Intergenic
1065836844 10:29666054-29666076 GCATGATGGCATGTGCCTACAGG - Intronic
1065958663 10:30715577-30715599 GCATGGTGGCATGCACCTGCAGG + Intergenic
1066114396 10:32226797-32226819 GCATGGTGCCAAGTGCCTGCAGG - Intergenic
1066382831 10:34916067-34916089 GCATGGTGGCTAGTGCCTGTAGG - Intergenic
1066419284 10:35249069-35249091 GAGTGGTGGCATGCACCTGTTGG - Intronic
1066536489 10:36397723-36397745 GCATGGTGGCACGTGCCTGTAGG - Intergenic
1068322216 10:55434204-55434226 GCGTGGCGGCAGGCGCCTGTAGG - Intronic
1068349303 10:55822614-55822636 GCATGGTGGCATACACCTGCAGG - Intergenic
1068454161 10:57233803-57233825 GCGTGGTGGCTGGTGCCTGTAGG + Intergenic
1069397259 10:68003298-68003320 GCATGGTGGCAGGCGCCTGCAGG - Intronic
1069479645 10:68769800-68769822 GCGTGGTGGCAGGCGCTTGTAGG + Intronic
1069521010 10:69121511-69121533 GAGTGGTGGCATGTGCCTATTGG - Intergenic
1069669672 10:70191084-70191106 GCGTGGTGGCGTGCGCATGTAGG + Intergenic
1069691938 10:70359413-70359435 GTGTGGTGGCATGCACCTGTGGG + Intronic
1069971019 10:72169295-72169317 GTGTGGTGGCACATGCATGCCGG + Intronic
1070629492 10:78074858-78074880 GCGTGGTGGCATGCACCTGTAGG - Intergenic
1072115210 10:92364172-92364194 GTGTGGTGGCACATGCCTGTAGG + Intergenic
1072757913 10:98032620-98032642 AGGTGGTGGCATGTTCCAGCAGG - Intergenic
1073305283 10:102498601-102498623 GCTTGGTGGCATGCACCTGTAGG - Intronic
1073370218 10:102981527-102981549 GTGTGGTGGCATGCACCTGTGGG - Intronic
1073525312 10:104175736-104175758 GCGTGGTGGCACATGTCTGCAGG - Intronic
1073601511 10:104850444-104850466 GCATGGCGGCATGTGCCTGTAGG + Intronic
1074154108 10:110783226-110783248 GGGTGGAGGGATGTGTCTGCAGG + Intronic
1074292002 10:112144668-112144690 GTGTGGTGGCACGCGCCTGTAGG + Intergenic
1074804117 10:117030025-117030047 GCGTGATGGCATGCACCTGTAGG - Intronic
1075109507 10:119566741-119566763 GCATGGTGGCATGCCCCTGTGGG - Intergenic
1075342298 10:121656918-121656940 GTATGGTGGCATGTGCCTATAGG - Intergenic
1075463686 10:122635692-122635714 GCGTGGTGGCACAAGCCTGTAGG - Intronic
1075724845 10:124605950-124605972 GCTGGGAGGCATGTGGCTGCAGG - Intronic
1075789043 10:125070210-125070232 GTGTGGTGGCACGTGCCTGCAGG + Intronic
1076064065 10:127434789-127434811 GCATGGTGGCATGTGCCTGTAGG - Intronic
1076852702 10:133100865-133100887 AGGTGGTGGGAGGTGCCTGCCGG + Intronic
1076988823 11:258303-258325 GGGTGGTGCCATGTGCCCACAGG - Intergenic
1077625838 11:3770350-3770372 GTGTGGTGGCACATGCCTGTAGG + Intronic
1078104592 11:8350747-8350769 GTGGGCTGGTATGTGCCTGCAGG + Intergenic
1079464375 11:20714659-20714681 GTGTGGTGGCACATGCCTGTGGG - Intronic
1079695865 11:23481979-23482001 GCATGGTGGCATGCACCTGTAGG + Intergenic
1079782380 11:24623706-24623728 GAGTGGTGGCCGGTGCCTGTAGG + Intronic
1080399504 11:31921036-31921058 GCATGGTGGCATATGCCTGTAGG - Intronic
1080617026 11:33953450-33953472 GCGTGGTGGCTCATGCCTGGAGG - Intergenic
1080645519 11:34184949-34184971 GGGTGGTGGCAGGTGCCCTCGGG - Intronic
1081727048 11:45337475-45337497 GTGTGGTGGCACGTACCTACAGG - Intergenic
1081798427 11:45839355-45839377 GTGTGGCGGCACGTGCCTGCAGG + Intergenic
1081812078 11:45919802-45919824 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
1081875242 11:46404065-46404087 GCGTGGTGGCGTGTGCCAGGAGG + Intronic
1081879824 11:46439133-46439155 ATATGGTGGCATGTGCCTGTAGG + Intronic
1082766604 11:57173574-57173596 GCATGGTGGCATGCACCTGTGGG - Intergenic
1082869655 11:57932290-57932312 GAGTTGAGGAATGTGCCTGCGGG + Intergenic
1083039779 11:59674289-59674311 ATGTGGTGGCACGTGCCTGAAGG - Intergenic
1083211032 11:61186290-61186312 ACGTGGTGGCACGTGCCTGTAGG - Intergenic
1083275342 11:61593994-61594016 GTGTGGTGGCACATGCCTGTAGG - Intergenic
1083308444 11:61772572-61772594 GCCTGGGGGCATCTGGCTGCTGG + Intronic
1083370520 11:62175377-62175399 GTGTGGTGGCACTTGCCTGTAGG - Intergenic
1084076438 11:66781674-66781696 GCGTGGTGGTACATGCCTGTGGG - Intronic
1084662645 11:70555585-70555607 ACATGGTGGCATGTGCTTGTAGG + Intronic
1084913161 11:72407783-72407805 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1084976570 11:72803052-72803074 GTGTGATGGCATGCCCCTGCAGG + Intergenic
1085059627 11:73433048-73433070 GCGTGGTGGCACGCACCTGTAGG - Intronic
1085158359 11:74317687-74317709 GTGTGGTGGCATGGGCCTGTGGG - Intergenic
1085519378 11:77129233-77129255 GCCCGGTGGCAACTGCCTGCTGG + Intronic
1085586885 11:77717037-77717059 GCATGGTGGCTTGTGCCTGTAGG + Intronic
1085649487 11:78254658-78254680 GCGTGGTGGTGTGTGCCTGTAGG + Intronic
1085970872 11:81589069-81589091 GCATGGTGGCATGCGCCTGGTGG - Intergenic
1086258734 11:84912292-84912314 GCGTGGTGGCGGGTGCCTGTAGG - Intronic
1086332938 11:85772039-85772061 GCGTTGTGTCATATGCCTGTAGG - Intronic
1086460233 11:86998751-86998773 CCATGGTAGCATGTGCCTGTAGG - Intergenic
1086903573 11:92394331-92394353 GGGTGGTGGCATGCACCTGTAGG + Intronic
1087046689 11:93849294-93849316 GTGTGGTGGCCTGTGCCTGTAGG - Intronic
1087375094 11:97329759-97329781 GCGTGGTGGTGGGTGCCTGTAGG + Intergenic
1088297520 11:108316785-108316807 GTGTGGTGGCGGGTGCCTGTAGG + Intronic
1088493306 11:110407212-110407234 GTGTGGTGGCTTGTGCCTGTAGG - Intergenic
1089474707 11:118749577-118749599 GCGTGGTGCCACATGCCTGTGGG - Exonic
1089716579 11:120366115-120366137 ATGTGGTGGCATATGCCTGTGGG + Intronic
1090724185 11:129508213-129508235 GCACGGTGGCATGGGCCTGTAGG + Intergenic
1090956175 11:131514725-131514747 GCGTGGTAGCATGGACCTGTAGG - Intronic
1090966852 11:131606189-131606211 GCATGGTGGTGTGTGCCTGAAGG - Intronic
1091226653 11:133960770-133960792 ATGTGGTGGCATGTGCCTGTAGG - Intergenic
1091313751 11:134596238-134596260 GCATGGTGGCATGTGACTGTAGG - Intergenic
1091570061 12:1677318-1677340 GCATGGTGGCATGTACCCGTAGG - Intergenic
1091730873 12:2879140-2879162 GTGTAGTGGCATGTGCCTGTAGG - Intronic
1091749964 12:3016164-3016186 GTGTGGTGGTGTGTGCCTGCAGG - Intronic
1092138220 12:6164412-6164434 GCATGGTGGCATGCGCCTGTAGG + Intergenic
1092253030 12:6911868-6911890 GTGTGGTGGCACATGCCTGGAGG + Intronic
1092345169 12:7708728-7708750 GTGTGGTGGCACATGCCTGTAGG - Intergenic
1092644953 12:10560477-10560499 GCGTGGTGGCGTATGCCTTTAGG - Intergenic
1093399838 12:18732288-18732310 GCCTGGTGGTGTGTGCCTGTGGG - Intronic
1093733083 12:22587877-22587899 GTGTGATGGTGTGTGCCTGCAGG - Intergenic
1093876029 12:24350480-24350502 GCATGGTGGCACGTGCCTATAGG - Intergenic
1093938546 12:25027531-25027553 GTGTGGTGGCGGGTGCCTGTAGG - Intronic
1094527787 12:31243989-31244011 GTGTGGTGGCAGGTGCCTGTGGG - Intergenic
1096325228 12:50654491-50654513 ATGTGGTGGCATGTGCCTGTAGG - Intronic
1096354149 12:50925898-50925920 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1096378380 12:51133786-51133808 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1097238787 12:57558913-57558935 GTGTGGTGGCATGGGCCTTGTGG - Intronic
1097638799 12:62154052-62154074 GTGTGGTGGCAGGTGCCTGTAGG - Intronic
1097648440 12:62264121-62264143 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1097939027 12:65283568-65283590 GCATGGTGGCAGGTGCCTGTAGG - Intronic
1098032423 12:66268235-66268257 ATGTAGTGGCATGTGTCTGCTGG - Intergenic
1098256158 12:68617900-68617922 GCATGGTGGCATGCGCCTGTAGG - Intronic
1098333577 12:69379550-69379572 TAGTGGTGGCATGTGCCTGTGGG - Intronic
1098729580 12:74016246-74016268 GCGTGGTGGCTCATGCCTGTGGG + Intergenic
1098849420 12:75577647-75577669 GCGTGGTGGCATTCACCTGCAGG - Intergenic
1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG + Intergenic
1099890105 12:88580146-88580168 GCGTGCAGGGCTGTGCCTGCCGG - Intronic
1099934675 12:89110789-89110811 GCGTAATGGCATGCGCCTGGGGG + Intergenic
1099983679 12:89637535-89637557 GCGTGGTGGCATGCGCCTTGTGG - Intronic
1100334777 12:93618949-93618971 GTGTGCTGGTGTGTGCCTGCAGG - Intergenic
1100631084 12:96390265-96390287 GCGTGTTGGCACGTGCCTGAAGG - Intronic
1100698019 12:97116844-97116866 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
1101064650 12:101007212-101007234 GTGTGATGGCATGCGCCTGTAGG + Intronic
1101627336 12:106458259-106458281 GCATGGTGGCACGTGCCTATGGG - Intronic
1102332225 12:112044064-112044086 GCGTGGTGGCAGGCGCCTGTAGG - Intronic
1103119528 12:118370011-118370033 CCGTGGTGGTGTGTGCCTGTAGG - Intronic
1103366044 12:120384172-120384194 GCATGGTGGCACTTGCCTGTAGG + Intergenic
1103444756 12:120987334-120987356 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
1103584452 12:121941470-121941492 GTGTGGTGGCACGTGCCTGTGGG - Intronic
1103774608 12:123357600-123357622 GCATGGTGGCGGGTGCCTGGTGG + Intronic
1104352652 12:128058205-128058227 GTGTGGTGGCAAGTGCGTGTAGG - Intergenic
1104693332 12:130843194-130843216 GCATGGTGGCATGTGCCTGTAGG + Intergenic
1105302360 13:19147471-19147493 GCGTGGTGGCGCGTGGCTGTAGG + Intergenic
1105381771 13:19893910-19893932 ACGTGGTGGTGTGTGCCTGTAGG - Intergenic
1105712708 13:23028396-23028418 GGGTGCTGGAATGTGCCTTCAGG + Intergenic
1105825492 13:24119042-24119064 GAGCGGTGGCAGGCGCCTGCAGG - Intronic
1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG + Intergenic
1106547206 13:30741242-30741264 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1108035277 13:46284723-46284745 GCGTGGTGGTGCGTGCCTGTGGG + Intergenic
1108073457 13:46653690-46653712 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1108102441 13:46970917-46970939 GTGTGGTGGCATGCACCTGTAGG + Intergenic
1108355770 13:49627724-49627746 GCGTGGTGGCACCTACCTGTAGG - Intergenic
1108373666 13:49793872-49793894 GCGTGGTGGCGCATGCCTGGAGG + Intergenic
1108398105 13:50009596-50009618 GTGTGGTGGTATGTGCCTGTAGG + Intronic
1108420078 13:50239913-50239935 GCGTGGTGGCACGTGCCTGTAGG - Intronic
1109082634 13:57925202-57925224 GCATGGTGGCACATACCTGCAGG - Intergenic
1110339713 13:74375180-74375202 GTGCGGTGCCATGTGCCTCCAGG + Intergenic
1111099209 13:83559396-83559418 GCGTGGTGGTGTGTGCCTATAGG + Intergenic
1111677585 13:91405908-91405930 GCATGGTGGCATGCACCTACGGG - Intronic
1111797890 13:92946550-92946572 GCGTGGTGGCAGGCGCCTGTGGG - Intergenic
1111885736 13:94018426-94018448 ATGTGGTGGCATGTGCCTGTAGG - Intronic
1112180794 13:97078041-97078063 GCGTGGTGGCACATGCCTGGAGG + Intergenic
1112334605 13:98503839-98503861 GAGTCGTGGCATGTTCCTGGGGG - Intronic
1112453773 13:99538651-99538673 GCATGGTGGCATGTGCCTGTAGG + Intronic
1112672067 13:101652278-101652300 GTGTGGTGGCATGCACCTGCAGG - Intronic
1112943395 13:104894199-104894221 GCATGGTGGCACGTGCCTGGTGG - Intergenic
1112960502 13:105119997-105120019 GCGTGGTGGCATGAGCCTATGGG + Intergenic
1113143553 13:107182411-107182433 GCGTGGTGGCATTCACCTGTAGG - Intronic
1113156448 13:107328057-107328079 GCATGGTGGCACATGCCTGTAGG - Intronic
1113483607 13:110639059-110639081 GCTTGGTGGTATCTGGCTGCTGG + Exonic
1113877903 13:113606108-113606130 GCGTGGTGGTGAGTGTCTGCAGG + Intronic
1113892502 13:113743794-113743816 GCTTGGTGGCGTGTGTGTGCAGG + Intergenic
1113981522 13:114281137-114281159 GGGTGGTGGCGCGTGCCTGTAGG + Intergenic
1114309276 14:21452177-21452199 GCGTGGTGGCGTGGTCCTGTAGG - Intronic
1114329646 14:21623619-21623641 GCGTGGTGGCCGATGCCTGTAGG - Intergenic
1114464637 14:22912859-22912881 ACGTGGTGGCACGCGCCTGTAGG + Intronic
1115482064 14:33870169-33870191 GCGTGGTGGTGCGTGCCTGTAGG + Intergenic
1115639833 14:35327280-35327302 GCATGGTGGTGTGTGCCTGAGGG + Intergenic
1116089517 14:40287100-40287122 AAGTGGTGACATGTGCATGCTGG - Intergenic
1116213468 14:41978212-41978234 GTGTGGTGGCAGGTGCCTGTAGG - Intergenic
1116567469 14:46467642-46467664 GCGTGGTGGCGGGTGCCTGTAGG + Intergenic
1116821428 14:49631484-49631506 GCGTGGTGGCAGGTGCCTGTAGG + Intronic
1116924688 14:50622253-50622275 GCACGGTGGCATGTGCCTGTAGG + Intronic
1117144444 14:52822886-52822908 GCATGGTGACAGGTGCCTGTAGG + Intergenic
1117277800 14:54207168-54207190 ACATGGTGGCGTGTGCCTGTAGG - Intergenic
1117295647 14:54376791-54376813 GAGTGGTGGCACGTGCCTATAGG + Intergenic
1117381623 14:55169837-55169859 GTGTGGTGGCTCATGCCTGCGGG + Intronic
1117876535 14:60256278-60256300 GCGTGGTGGCACGGGCATGGTGG + Intronic
1117912433 14:60648537-60648559 ACTTGGTGGCTGGTGCCTGCGGG + Intronic
1118015602 14:61657300-61657322 GGGTGGTGGCATTTACCTGTAGG - Intronic
1118406530 14:65429722-65429744 GTGTGGTGGTGTGTGCCTGTAGG + Intronic
1119012325 14:71006059-71006081 GTGTGGTGGCATGTGCCCATGGG - Intronic
1119136582 14:72226822-72226844 GCATGGTGGAATGCGCCTGGAGG - Intronic
1119284133 14:73437182-73437204 GCATGGTGGTGTGTGCCTGTAGG - Intronic
1119634197 14:76260889-76260911 GCCTGGTGGCATGCACCTGTAGG + Intergenic
1119820736 14:77614523-77614545 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
1120782440 14:88497638-88497660 GCGTGGTAGCAGGTACCTGTAGG + Intronic
1121056121 14:90855574-90855596 GCGTGGTGGTGGGTGCCTGTGGG - Exonic
1121069446 14:91004222-91004244 GCGTGGTGGCGGGCGCCTGTAGG - Intronic
1121133523 14:91472601-91472623 GCGTGGTGGCAGGTGCCTTGTGG - Intronic
1122596507 14:102896932-102896954 TGGTGGTGGCATGTACCTGTAGG + Intronic
1122733844 14:103823197-103823219 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
1122943105 14:104991923-104991945 GCGTGGTGGCATGTGCGTGGCGG - Intronic
1122943107 14:104991937-104991959 GCGTGGCGGCGTGTGCGTGGTGG - Intronic
1122943119 14:104992019-104992041 GCGTGGCGGCGTGTGCATGGCGG - Intronic
1122943121 14:104992033-104992055 GCGTGGTGGCGTGTGCGTGGCGG - Intronic
1122943123 14:104992047-104992069 GCGTGGCGGCGTGTGCGTGGTGG - Intronic
1122943134 14:104992108-104992130 GCGTGGTGGCGTGTGCATGGCGG - Intronic
1122943149 14:104992206-104992228 GCGTGGCGGCATGTGAGTGGTGG - Intronic
1122943151 14:104992220-104992242 GCTTGGTGGCGTGTGCGTGGCGG - Intronic
1122961557 14:105096243-105096265 GCGTGCTGGCCTGTGCCTGGTGG - Intergenic
1123782916 15:23645138-23645160 GAGTGGTGGCAGTTGCCTGGGGG + Exonic
1123807842 15:23893609-23893631 GCATGGTGGCATGCACCTGTAGG - Intergenic
1124358231 15:29014843-29014865 GCCTGGTGCCATGTACCTGTAGG - Intronic
1124377685 15:29139046-29139068 GCGTGGTAGGAGGTGCCTTCTGG + Intronic
1124473718 15:30011965-30011987 GCATGGTGGCCTGTGCCTATAGG - Intergenic
1124701402 15:31916109-31916131 GCATGTTGTCATGTGCCTGTAGG + Intergenic
1124709151 15:31990948-31990970 GCATGGTGGCACGTGCCTATAGG - Intergenic
1124798041 15:32801654-32801676 GCGTGGTGGTAGGCACCTGCAGG + Intronic
1124912622 15:33937392-33937414 GCGTGGTGGCAGGCGCCTGTAGG + Intronic
1125558487 15:40606896-40606918 GCATGGTGGCATGTTCCTGTAGG - Intronic
1125710553 15:41782121-41782143 GCGTGGTGGCGGGCGCCTGTAGG + Intronic
1125764696 15:42126761-42126783 GTGTGGTCGCAGGTGCCTGATGG - Intergenic
1125864662 15:43034301-43034323 GCGTGGTGGCTTATCCCTGCAGG + Intronic
1125950149 15:43745608-43745630 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
1125955748 15:43790001-43790023 GCGTGGTGGCACGCACCTGTAGG + Intronic
1126613970 15:50557780-50557802 GTGTGGTGGCGCGTGCCTGTAGG - Exonic
1127259594 15:57318481-57318503 GTGTGGTGGTGTGTGCCTGTAGG + Intergenic
1127660838 15:61098477-61098499 GCATGATGGCATGTGCCTGTAGG - Intronic
1128180629 15:65600488-65600510 GCATGGTGGTGCGTGCCTGCAGG + Intronic
1128828922 15:70748575-70748597 GTGTGCAGGCATGTGACTGCAGG - Intronic
1128835850 15:70808475-70808497 GCGTGGTGGCATATGCGTGGTGG - Intergenic
1129050072 15:72773978-72774000 GCATGGTGGCATGTGCCTGTGGG - Intronic
1129147795 15:73664837-73664859 GTGTGGTGGCACAAGCCTGCAGG - Intergenic
1129238868 15:74240105-74240127 GCTTGCAGGCATGTGCCCGCTGG - Intronic
1129338442 15:74868679-74868701 GTGTGGTGGCATGCACCTGTGGG - Intronic
1129644031 15:77413960-77413982 GTGTGGTGGCATGTGCCTGTGGG - Intronic
1129901946 15:79158025-79158047 GGGTGGTGGCACATGCCAGCCGG - Intergenic
1129976656 15:79828071-79828093 GAGTGGTGGCATGTGCCTGTAGG + Intergenic
1130211485 15:81926895-81926917 GCGTAGTGGCACATGCCTGTAGG + Intergenic
1130942475 15:88523019-88523041 GTGTGGTGGCATGCGCCTGTCGG - Intronic
1130962000 15:88666248-88666270 GCGTGGTGGCAGGCGCCTGTAGG + Intergenic
1131088843 15:89603444-89603466 GCATGGTGGCACATGCCTGTAGG + Intronic
1131101969 15:89698994-89699016 GCGTGGTGGCATGTGCTTGGAGG - Intronic
1131319097 15:91368969-91368991 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
1131504354 15:93003144-93003166 GCATTGCGGCATGTGCCTACGGG + Intronic
1131546582 15:93320893-93320915 GTGTGGTGGCGGGTGCCTGTAGG + Intergenic
1132222132 15:100112861-100112883 ACGTGGTCACATGTGCCCGCTGG + Intronic
1132486579 16:195560-195582 GCATGGTGGTGTGTGCCTGTAGG - Intronic
1132500716 16:283478-283500 CAGTGGGGGCAAGTGCCTGCGGG - Intronic
1132505454 16:306104-306126 GTGTGTACGCATGTGCCTGCCGG - Intronic
1132525848 16:414274-414296 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1132528525 16:431143-431165 GTGTGGGAGCATGTGTCTGCAGG + Intronic
1132536065 16:481573-481595 GTGTGGTGGCACCTGCCTGTAGG - Intronic
1132536077 16:481635-481657 GTGTGGTGGCACCTGCCTGTAGG - Intronic
1132536089 16:481697-481719 GTGTGGTGGCACCTGCCTGTAGG - Intronic
1132536101 16:481759-481781 GTGTGGTGGCACCTGCCTGTAGG - Intronic
1132536113 16:481821-481843 GTGTGGTGGCACCTGCCTGTAGG - Intronic
1132536138 16:481945-481967 GTGCGGTGGCACCTGCCTGCAGG - Intronic
1132536150 16:482007-482029 GTGCGGTGGCACCTGCCTGCAGG - Intronic
1132536162 16:482069-482091 GTGCGGTGGCACCTGCCTGCAGG - Intronic
1132536174 16:482131-482153 GTGCGGTGGCACCTGCCTGCAGG - Intronic
1132784697 16:1649626-1649648 GCGTGGTGGTGGGTGCCTGTAGG - Intronic
1132795530 16:1719705-1719727 ATGTGGTGGCACGTGCCTGTGGG + Intronic
1133502207 16:6377134-6377156 GCACGGTGGCCTGTGCCTGTAGG + Intronic
1133687940 16:8184520-8184542 GCATGGTGGCACGCACCTGCAGG + Intergenic
1133844752 16:9443483-9443505 GCATGGTGGCACATGCCTGTAGG + Intergenic
1133934097 16:10255045-10255067 GCATGGTGGTCTGTGTCTGCAGG - Intergenic
1134058365 16:11183883-11183905 GTGTGGTGGCACTTGCCTGTAGG - Intergenic
1134140068 16:11710700-11710722 GTGTGATGGCGTGAGCCTGCAGG + Intronic
1134251310 16:12576016-12576038 GCATGGAGGCATTTGCCTGTAGG - Intergenic
1134323456 16:13185338-13185360 GCATGGTGTCATGTCCCTGTAGG - Intronic
1134602112 16:15541738-15541760 GCATGGTGGCAGGCGCCTGTAGG - Intronic
1134605968 16:15571491-15571513 GCGTGGTGGCAGGTGCCTACAGG - Intronic
1134655741 16:15947257-15947279 GTGTGGTGGCAGGCACCTGCAGG - Intergenic
1134678918 16:16110220-16110242 GCGTGGGGGCACATGCCTGTAGG - Intronic
1135411391 16:22237497-22237519 GCGTGGTGGCGTGTGCCCATAGG + Intronic
1135661958 16:24304697-24304719 GCATGGTGGCGTGTACCTGTAGG - Intronic
1136178274 16:28533509-28533531 GTGTGGTGGCTTGTGCCTGTGGG - Intronic
1136488431 16:30588427-30588449 GCGAGGTGGCAGGCGCCTGTAGG + Intergenic
1136543674 16:30943326-30943348 GCGTGGTGGCACACGCCTGTAGG - Intronic
1137238458 16:46634212-46634234 GCATGGTGGTGTGTGCCTGTAGG + Intergenic
1137454469 16:48607998-48608020 GCGTGGTGGTACGCGCCTGTAGG - Intronic
1137544921 16:49396101-49396123 GAGTGGAGGCATGTGCCTATAGG + Intronic
1137623832 16:49895092-49895114 GCATGGTGGCATGTGCCTATAGG + Intergenic
1138059282 16:53872749-53872771 GCCTGGTGGCATTTGCCTCTTGG + Intronic
1138112187 16:54332785-54332807 GGGAGGTGGCAAGTGCCTGTGGG + Intergenic
1138635204 16:58332812-58332834 GCATGGTGGTGTGTGCCTGCAGG - Intronic
1138725597 16:59135315-59135337 GCATGGTGGCATGCACCTGTAGG + Intergenic
1138940225 16:61781480-61781502 GCATGATGGCTTGTGCCTGTAGG + Intronic
1139164592 16:64550975-64550997 GCATGGTGGCATGAGCCTATAGG + Intergenic
1139718199 16:68831215-68831237 GCTTGATGGCAGGTGCCTGTAGG - Intronic
1139801314 16:69525301-69525323 GTTTGGTGGCATGTGCCTATAGG - Intergenic
1139810312 16:69609864-69609886 ACATGGTGGCATGAGCCTGTAGG + Intronic
1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG + Intronic
1140046849 16:71445303-71445325 GCGTGGTGGCGGGTGCCTGTAGG + Intergenic
1140306483 16:73807593-73807615 GCATGGTGGAATGTGCCTGTAGG - Intergenic
1140671903 16:77287608-77287630 GTGTGGTGGCAGGTGCCCGTAGG - Intronic
1140859904 16:79009587-79009609 GTGTGGTGGCATGTGCCTATGGG - Intronic
1141706098 16:85665560-85665582 GTGTGGCGGCAGGTGCCGGCAGG - Intronic
1142144874 16:88488725-88488747 GCGACGGCGCATGTGCCTGCTGG + Intronic
1142407160 16:89896690-89896712 GCGTTGTGGCACGTGCCTGTAGG - Intronic
1142543556 17:681273-681295 GTGTGGTGGCATGCACCTGTAGG - Intronic
1142553678 17:757206-757228 GTGTGGTGGCACGTGGCTGTGGG + Intronic
1142774813 17:2128683-2128705 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1142816749 17:2432428-2432450 GCATGGTGGCACATGCCTGTAGG + Intronic
1142961164 17:3553339-3553361 GCATGGTGAGATGTGCCTTCTGG - Intronic
1143006973 17:3843369-3843391 GCATGGTGGCATATGCCTGAGGG - Intronic
1143224971 17:5293543-5293565 GCATGGTGGCATGTGCCTATAGG - Intronic
1143615668 17:8047779-8047801 GGGTGGTGGCAGCTGCATGCTGG - Exonic
1143657201 17:8302301-8302323 GCGTGGTGGCGGGGGCCTGTAGG - Intergenic
1144178818 17:12733169-12733191 ATGTGGTGGCAGGTGCCTGTAGG + Intronic
1144455492 17:15415069-15415091 GCTTGGAGCCCTGTGCCTGCTGG - Intergenic
1144539474 17:16125561-16125583 GCATGGTGGCAGATGCCTGTAGG + Intronic
1144762796 17:17716906-17716928 GCCTGGTGGAATGTGCCCACGGG + Intronic
1145112670 17:20177846-20177868 GCGTGGTGGCACATGCCTGTGGG - Intronic
1145233690 17:21193535-21193557 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
1145869347 17:28260581-28260603 GCATGGTGGTAGGTGCCTACAGG + Intergenic
1146230815 17:31107401-31107423 GCATGGTGGCATGCACCTGTGGG - Intronic
1146719167 17:35111240-35111262 GCCTGGTGGCATGTGCCTGTAGG + Intronic
1146851336 17:36224426-36224448 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1146867249 17:36348299-36348321 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1147070124 17:37948910-37948932 GCGTGGTGGCAGGTGCCTGTAGG - Intergenic
1147081645 17:38028436-38028458 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1147097596 17:38152406-38152428 GCGTGGTGGCAGGTGCCTGTAGG - Intergenic
1148105648 17:45117382-45117404 GTGTGGGGGCATGTGCCTGTAGG - Intronic
1148512728 17:48186605-48186627 GCATGGTGGCATGTGCCTGTAGG - Intronic
1148789110 17:50163264-50163286 GCATGGTGGCACGTGCCTGTAGG + Intergenic
1148933801 17:51148698-51148720 GCATGGTGGCACATGCCTGTAGG - Intergenic
1149055376 17:52356921-52356943 GAGTGGTGGTATATGCCTGTAGG + Intergenic
1150079297 17:62222526-62222548 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
1150109826 17:62488962-62488984 GTGTGGTGGTGTGTGCCTGTAGG - Intronic
1150578236 17:66449148-66449170 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1150704929 17:67477962-67477984 GAGTGATGGCATGTCACTGCTGG + Intronic
1150740302 17:67774151-67774173 GCGTGGTGGCGGGAGCCTGTAGG - Intergenic
1150881019 17:69028303-69028325 GCATGGTGGCAGGTGCCTGTAGG - Intronic
1151139314 17:71976335-71976357 GCGTCGTGGGACCTGCCTGCTGG - Intergenic
1151408370 17:73903927-73903949 GCGTGCTTGCTTGTGTCTGCAGG + Intergenic
1151467045 17:74292553-74292575 GTGTGGTGGCACATGCCTGTAGG - Intronic
1151609083 17:75159617-75159639 GTGTGGTGGCATGTGCCTGTAGG - Intronic
1151722774 17:75867420-75867442 GGGTGGTGGTGCGTGCCTGCAGG - Intergenic
1151880292 17:76890640-76890662 GGATGGTGGCATGCACCTGCAGG - Intronic
1151905363 17:77044819-77044841 GCGTGGTGGCGCGTGTCTGTAGG + Intergenic
1152013362 17:77734565-77734587 GGGTCCTGGCATGTGCCAGCAGG + Intergenic
1152415887 17:80161610-80161632 GCATGGTGGCATGTGCTTGTGGG - Intergenic
1152483968 17:80577414-80577436 GTGTGGTGGCATGCACCTGTAGG - Intronic
1152729686 17:81963319-81963341 GCGTGATGGCATCTTCCAGCTGG + Intergenic
1152811380 17:82384310-82384332 GTCTGGTGGCAGGTGCCTGGCGG + Intergenic
1153029764 18:702599-702621 GCATGGTGGCTTGTGCCTGTGGG + Intronic
1153034256 18:744526-744548 GCGTGGTGGCATGCACCTGTAGG - Intronic
1153287527 18:3470231-3470253 GCATGGTGGCCTATGCCTGGTGG + Intergenic
1154248657 18:12723528-12723550 GCATGGTGGCATGTGCCTGTAGG - Intronic
1155460745 18:26079719-26079741 GTGTGGTGGTATGTGCCTGTGGG - Intronic
1155867590 18:30984875-30984897 GTGTGGTGGCACATGCCTGTAGG - Intergenic
1156284191 18:35674842-35674864 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1156328586 18:36097872-36097894 GCATGGTGGCATGTGCCTGTGGG - Intergenic
1156458583 18:37308444-37308466 GAGGGGTGGCCTGTGCCCGCTGG - Intronic
1156537017 18:37873934-37873956 GCCTGGTGGCGTGAGCCTGGTGG - Intergenic
1158512944 18:58107578-58107600 AAGTGGTGGCTTGTGCCTGTAGG + Intronic
1158794638 18:60829555-60829577 GTGTGGTGGCAGGCGCCTGTAGG - Intergenic
1159043125 18:63344036-63344058 GTGTGGTGGCACATGCCTGTAGG + Intronic
1159446717 18:68549905-68549927 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1159506983 18:69351432-69351454 GTGTGCTGGCATGTACCTGTGGG + Intergenic
1159736102 18:72099770-72099792 GCATGGTGGCATGTGTCTGTAGG + Intergenic
1159747446 18:72255302-72255324 GCATGGTGGCATGTACCTTATGG + Intergenic
1159937079 18:74377533-74377555 GTGTGGTGGTGTGTGCCTGCAGG + Intergenic
1160540941 18:79622185-79622207 GCATGAGGGCATTTGCCTGCCGG - Intergenic
1160818181 19:1045866-1045888 GCGTGGTAGCACGCGCCTGTAGG + Intronic
1161244371 19:3241212-3241234 GCGCGGTGGCTTGTGCGTGGTGG - Intronic
1161569264 19:5021454-5021476 GTGTGGTGGCATGTACCTGTGGG + Intronic
1162110786 19:8398536-8398558 GGGTGGTGGGAGGTGGCTGCAGG + Intronic
1162163355 19:8735754-8735776 GCATGGTAGCAGGTGCCTGTAGG - Intergenic
1162358233 19:10200692-10200714 GCCTGGTGGTGTGTGCCTGTGGG - Intronic
1162611954 19:11762737-11762759 CCATGGTGGCATGTCCCTGTAGG + Intergenic
1162996992 19:14342520-14342542 GCGTGGTGGCACTTGCCTGTAGG - Intergenic
1163065288 19:14787839-14787861 GCATGGTGGCACGCGCCTGTAGG - Intergenic
1163170340 19:15526889-15526911 GCGTGGGGGCATGCACTTGCAGG - Intronic
1163475987 19:17526507-17526529 TGGTGGTGGCGTGTGCCTGTGGG + Intronic
1163555720 19:17991592-17991614 GCATGGTGGCACGTGCCTGTAGG + Intronic
1163922622 19:20306483-20306505 GCATGGTGGCACATGCCTGGAGG + Intergenic
1164905755 19:31966645-31966667 GAGTGGGGCCATGTACCTGCCGG - Intergenic
1164993352 19:32700566-32700588 GCGTGGTTGCAGGTGCCTGTGGG - Intronic
1165094174 19:33401645-33401667 GCTATGTGGCAGGTGCCTGCAGG - Intronic
1165176051 19:33930650-33930672 GTGTGGTGGCGTGTGTCTGTAGG - Intergenic
1165199028 19:34130400-34130422 GCATGGTGGCACGCGCCTGTAGG + Intergenic
1165355451 19:35301005-35301027 GTGTGGTGGCACCTGCCTGTGGG - Intronic
1165439573 19:35817086-35817108 GCATGGTGGCGTGTGCCTCATGG - Intergenic
1165620019 19:37237999-37238021 GCGTGGTGACGTGTGCCTGTGGG - Intronic
1165666092 19:37629733-37629755 GCGTGGTGGCGGGCGCCTGTAGG - Intronic
1166186882 19:41145624-41145646 GTGTGGTGGCGCGTGCCTGTAGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166691472 19:44823825-44823847 GTGTGATGGCATGTGCCTGTGGG - Intergenic
1166717237 19:44976344-44976366 GCACAGTGGCATGTGCCTGTAGG + Intronic
1167140298 19:47645957-47645979 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1167155776 19:47738017-47738039 ACGTGGTGGCACATGCCTGCAGG - Intronic
1167446041 19:49538129-49538151 ACATGGTGGCTTGTGCCTGGTGG - Intronic
1167612444 19:50513961-50513983 GCGTGGGGGCGTGGGCCTGCGGG + Intronic
1167922874 19:52796603-52796625 GCATGGTGGCACATGTCTGCTGG - Intronic
1167927988 19:52837727-52837749 GCATGGTGGCACATGCCTGCTGG - Intronic
1168002316 19:53459037-53459059 GCATGGTGGCATCTGACTGCAGG + Intergenic
1168025857 19:53643185-53643207 GCATGGTGGCATGTACCTGTTGG - Intergenic
1168095231 19:54110587-54110609 GCGTGGTGGCAGGTGCCTGCAGG + Intronic
1168221189 19:54961685-54961707 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1168334350 19:55588864-55588886 GTGTGGTGGCGTGTGCCTGTAGG - Intergenic
925809032 2:7680297-7680319 GCGTGGTGGTGTGTGTCTGTGGG - Intergenic
925948662 2:8890656-8890678 GTGTGGTAGCATGTACCTGTAGG - Intronic
925962234 2:9028434-9028456 GCGTGGTGGCATGGGTCTTCAGG - Intergenic
926240633 2:11082120-11082142 GCGTGGTGGCATGTGCCTGTAGG - Intergenic
926289719 2:11518959-11518981 GCGTGGTGGTAGGTGCCTGTAGG + Intergenic
926714809 2:15915773-15915795 GCATGGTAACATGTGCCTGTAGG + Intergenic
927224900 2:20754614-20754636 GCTGGATGTCATGTGCCTGCAGG + Intronic
927274278 2:21248723-21248745 GCATGGTGGCATGCACCTGTAGG - Intergenic
927585951 2:24305455-24305477 GCGTGGTGGCGTGTGCCTGTAGG + Intronic
928050358 2:27987674-27987696 GCATGGTGACATGTTCCTGTAGG + Intronic
928497690 2:31850848-31850870 GCATGGTGGCGTGCGCCTGCAGG + Intergenic
928513954 2:32027765-32027787 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
928668555 2:33576763-33576785 GCATGGTGGCACATGCCTGTAGG - Intergenic
928688403 2:33773869-33773891 GCATGGTAGCATGTCCCTGTAGG - Intergenic
928988426 2:37204414-37204436 GCGTGGTGGCATGCACTTGTAGG - Exonic
929237813 2:39625071-39625093 GCGTGGTGGCACGTGCCTATAGG + Intergenic
929736387 2:44554735-44554757 GTGTGGTGGCATATGTCTGTAGG + Intronic
929747422 2:44673286-44673308 GTATGGTGGCATGTACCTGTGGG + Intronic
930086480 2:47501228-47501250 GCATGGTGGCACATGCCTGTAGG - Intronic
930111670 2:47684111-47684133 GCGTGGTGGCAGGCGCCTGTAGG + Intergenic
930561901 2:52969992-52970014 GCGTGGTGGCGGGTGCCTGTGGG + Intergenic
930657327 2:54019203-54019225 GTGTGGTGGCATGCACCTACAGG - Intronic
930807461 2:55505422-55505444 GCCTGGTGGCATGTGCCTGTAGG - Intergenic
931372154 2:61673641-61673663 GTGTGGTGGTATGTGCCTGTAGG - Intergenic
931423720 2:62151768-62151790 GCCTGGTGGCACGTGCCTGCGGG - Intergenic
931731440 2:65157007-65157029 GTGTGGTGGCAGGTGCCTGTGGG + Intergenic
933251435 2:80033432-80033454 GCTTGGTGGCATGCACCTGTAGG + Intronic
933756922 2:85647025-85647047 GCCTGGTGGCAGGTGCCTGTAGG - Intronic
933855300 2:86407895-86407917 GCATGGTGGCACATGCCTGTGGG + Intergenic
936345877 2:111674510-111674532 GCGTGGTGGTACGTGCCTGCAGG + Intergenic
936501021 2:113066415-113066437 GCATGGTGGCATGCACCTGTAGG - Intergenic
936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG + Intergenic
937226148 2:120370574-120370596 GCGTGGTGGCACCTGCCTCTCGG - Intergenic
937696899 2:124818382-124818404 GCATGGTGACATGTGACTGTAGG + Intronic
940771301 2:157841886-157841908 GCGTTGTGGCAGGCGCCTGTAGG + Intronic
940974877 2:159931393-159931415 GCATGGTGGTATGTGCCTGCGGG + Intergenic
942005125 2:171690791-171690813 GCATAGTGACATGTGCCTGTAGG - Intronic
942452482 2:176116928-176116950 AGGTGGTGGCATGTACATGCTGG - Exonic
942471364 2:176264110-176264132 GCGTGGTGGTATGCACCTGGCGG - Intergenic
943625851 2:190198492-190198514 GCATGGTGACTTGTGCCTGCAGG + Intronic
944229925 2:197382304-197382326 GCATGGTGGCGGGTGCCTGTAGG + Intergenic
944557929 2:200906348-200906370 GGGTGGTGGCAGGTGCCTGTAGG - Intergenic
945069129 2:205973416-205973438 GTGTGGTGGCACATGCCTGTAGG + Intergenic
945149325 2:206771696-206771718 GCGTGGTGGTACATGCCTGTAGG + Intronic
945316176 2:208372945-208372967 GCGTGATGGCACATGCCTGTAGG + Intronic
945386869 2:209211958-209211980 GCGTGGTGGCCCTTGCCTGTAGG - Intergenic
946709934 2:222495273-222495295 GTGTGGTGGCATGTGCCTGTGGG + Intronic
946846724 2:223865709-223865731 GCATGGTGGCATGTGCCTATAGG + Intronic
947153580 2:227138177-227138199 GTGTAGTGGCATGTACCTGTAGG + Intronic
947221615 2:227798706-227798728 GCGTGGTGGCATGTGCCTGTTGG - Intergenic
948380812 2:237548738-237548760 GCGTGGTGGCGGGCGCCTGTAGG + Intronic
948634946 2:239329020-239329042 GCCTGGTGGCCTGGGCCTGGAGG - Intronic
948664954 2:239528954-239528976 GGGAGGTGGCATGGCCCTGCTGG + Intergenic
1169094129 20:2881166-2881188 GCGTGGTGGCGTGTGCCTCTGGG + Intronic
1169107227 20:3006768-3006790 GTGTGGTGGCATGTGCCTATAGG - Intronic
1169192683 20:3668113-3668135 GCGTGGTGGTGTGTACCTGTAGG - Exonic
1169272929 20:4214557-4214579 GTATGGTGGCATGTGCCTATAGG + Intergenic
1169423643 20:5479467-5479489 GTATGGTGGCATGTGCTTGTAGG + Intergenic
1169432427 20:5550052-5550074 GCATGGTGGCGTGCGCCTGTAGG + Intronic
1170072367 20:12382394-12382416 GCATGGTGGCAGGTGCCTGGAGG + Intergenic
1170467422 20:16635583-16635605 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1170687604 20:18583561-18583583 GCATGGTGGCAGGCGCCTGTAGG + Intronic
1170906855 20:20524093-20524115 GCGTGGTGGCGGGTGCCTGTAGG - Intronic
1171057990 20:21926474-21926496 GCATGGTGGTATGTGCTTGTAGG + Intergenic
1171260474 20:23727642-23727664 GGGTGCTGGCATGTGGCTTCGGG - Intergenic
1172135919 20:32686628-32686650 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1172255250 20:33512036-33512058 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1172381463 20:34496530-34496552 GTGTGGTGGCTCGTGCCTGTAGG + Intronic
1172400045 20:34642346-34642368 GAGTGGTGGTATGTGCCTGTAGG - Intronic
1172470786 20:35193312-35193334 GCGTGGTGGCATGCGCCTGTAGG - Intergenic
1172914365 20:38432790-38432812 GTGTGGTGGCATGCGCCAGGAGG - Intergenic
1173938820 20:46893213-46893235 GGGTGGTGTCAGGTGGCTGCTGG - Intergenic
1174247065 20:49189060-49189082 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
1174302200 20:49590410-49590432 GCATGGTGGCATCTGCTTCCTGG - Intergenic
1174347602 20:49942118-49942140 GTGTGGTGGTATGTACCTGTAGG + Intronic
1174378653 20:50142575-50142597 CCGTGGTGGCAGGCGCCTGTAGG - Intronic
1174486059 20:50861990-50862012 GCATGGTGGCATGTGCCTGTGGG - Intronic
1174532657 20:51226319-51226341 GCGTGGTGGCGCGTGCCTGTAGG + Intergenic
1174602855 20:51738941-51738963 GCGTGGTGGCAGGTGCCTGTAGG + Intronic
1174609554 20:51787958-51787980 GCGTGGTGGCATGCGCCTGTAGG - Intronic
1175093482 20:56523604-56523626 GCATGGTGGCATAGGCCTGTAGG - Intronic
1175171611 20:57085069-57085091 GCGGGGTGGCATCTTCCTACTGG + Intergenic
1175585323 20:60134538-60134560 GCATGGTGGCATATGCCTGTAGG - Intergenic
1175837047 20:62002627-62002649 GCTTGGTGGTGTGTGCCTGTGGG - Intronic
1176116465 20:63433780-63433802 GCTTGGTGGCAGGTGCCCGGCGG + Intronic
1176154306 20:63610380-63610402 GCGTGGTGGCGGGCGCCTGTAGG + Intronic
1178077038 21:29021962-29021984 GTGTGGGGGCGTGTGCCTGTAGG + Intergenic
1178578014 21:33812635-33812657 GCATGGTGGCATGCACCTGTAGG - Intronic
1178591901 21:33917935-33917957 GCTTGGTAGCATGTGTCTGTAGG - Intergenic
1178824262 21:36002322-36002344 GCATGGTGGCATGCACCTGTGGG + Intronic
1179033036 21:37736626-37736648 GCATGGTGGCATGTCCATCCAGG + Intronic
1179977623 21:44878305-44878327 GCGAGCTGGAATGTGCCTGTGGG + Intergenic
1180172809 21:46068664-46068686 GCGTGTGCGCATGTGCCTGGGGG + Intergenic
1180665322 22:17506263-17506285 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1180742583 22:18064241-18064263 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
1180795358 22:18601451-18601473 GCATGGTGGCATGCACCTGCAGG + Intergenic
1181157081 22:20929600-20929622 GTGTGGTGGCGTGTGCCTGTAGG - Intronic
1181157188 22:20930516-20930538 GTGTGGTGGCGTGCGCCTGTAGG - Intronic
1181226382 22:21393861-21393883 GCATGGTGGCATGCACCTGCAGG - Intergenic
1181252268 22:21540977-21540999 GCATGGTGGCATGCACCTGCAGG + Intergenic
1181293948 22:21819885-21819907 GCTTGGTGGCTTGTGCCTGTAGG - Intronic
1181384291 22:22532632-22532654 GCGTGGTGGCATATGCCTGCAGG - Intergenic
1182209102 22:28659405-28659427 ACGTGGTGGCATGAACCTGTAGG - Intronic
1182264602 22:29104293-29104315 GTGTGATGGCATGTGCCTGTAGG - Intronic
1182593832 22:31402646-31402668 GCATGGTGGCATATGCCTGTAGG - Intronic
1182786551 22:32912580-32912602 GGGTGGTGGCATGCACCTGTAGG + Intronic
1182858420 22:33538088-33538110 GCATGGAGGCATGATCCTGCAGG - Intronic
1183081050 22:35456872-35456894 GCGTGGTGGCACATGCCTGTGGG - Intergenic
1183166354 22:36149943-36149965 GCGTGGTGGTATGTACCTGTAGG - Intronic
1183699375 22:39441902-39441924 GCGTGGTGGTGGGTGCCTGTAGG + Intergenic
1183833663 22:40434581-40434603 GCGTGGTGGCGGGAGCCTGTAGG + Intronic
1183883883 22:40860213-40860235 GTGTGGTGGTACGTGCCTGTAGG - Exonic
1183907693 22:41054694-41054716 GCGTGGGGGTGTGGGCCTGCTGG - Intergenic
1184614517 22:45629053-45629075 GCGTGGTGGCACGCGCTTGGAGG + Intergenic
1184772021 22:46602879-46602901 GCGTGGTGGCATGTGCCTGTAGG - Intronic
1184964561 22:47961305-47961327 GTGTGGTGGCGGGTGCCTGTAGG + Intergenic
949344658 3:3065631-3065653 CTGTGGTGGCACGTGCCTGTAGG + Intergenic
950047751 3:9960261-9960283 GCATGGTGGCGGGTGCCTGTAGG - Intergenic
950078815 3:10206692-10206714 GCATGGTGGCACATGCCTGTAGG - Intronic
950728671 3:14936987-14937009 GCGTGGTGGCACATGCCTGTGGG - Intergenic
951927210 3:27921596-27921618 GAGTGGAGGCATTTGGCTGCTGG + Intergenic
952100906 3:30011933-30011955 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
952364063 3:32659501-32659523 GCGCGGTGGCAGGTGCCTGTAGG + Intergenic
953078666 3:39594787-39594809 GCGTGGTGGCACATGCTTGTGGG - Intergenic
953572221 3:44080054-44080076 ACTTGGTGGCATGAGCCTCCAGG + Intergenic
953673454 3:44981767-44981789 GTGTGGTGGTGTGTGCCTGTAGG + Intronic
953739846 3:45528196-45528218 ATGTGGTGGCATGTGTCTGTAGG + Intronic
953860134 3:46537237-46537259 GCATGATGGCGTGTGCCTGTGGG - Intronic
953860760 3:46542355-46542377 GTGTGGTGGCATGCACCTGTTGG + Intronic
953954415 3:47220352-47220374 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
954159802 3:48712872-48712894 GCGTGGTGGCAGATGCCTGTAGG + Intronic
954315144 3:49797121-49797143 GGGTGTAGGCAGGTGCCTGCTGG - Intronic
954349298 3:50029592-50029614 GCGTGGTGGCGTGTACCTGTAGG + Intronic
954898586 3:53998721-53998743 GCTTGGTGGCAGGGGTCTGCTGG + Intergenic
954917603 3:54162281-54162303 GAGGGGTGGCCTGTGTCTGCTGG + Intronic
955190446 3:56756686-56756708 GCGTGGTGGCGGGCGCCTGTAGG - Intronic
956039498 3:65131400-65131422 GCATGGTGGTACATGCCTGCAGG + Intergenic
956150392 3:66236048-66236070 GCATGGTGGCACATGCCTGTAGG - Intronic
956236595 3:67079183-67079205 GCGTGGTGGCATACACCTGTGGG - Intergenic
956420049 3:69078610-69078632 GTATGGTGGCATGTACCTGTAGG - Intronic
957550463 3:81697436-81697458 GCATGGTGGCAGGTGCCTGTAGG - Intronic
958542578 3:95498412-95498434 ACGTGGTGGCGGGTGCCTGTAGG + Intergenic
958577269 3:95967164-95967186 GCATGGTGGCGTGTGCCTGCAGG + Intergenic
959061806 3:101623056-101623078 GCATGGTGGCATGCACCTGTAGG - Intergenic
959540507 3:107532054-107532076 GGGTGGTGGTGTGTGCCTGTAGG + Intronic
960111075 3:113845558-113845580 GCGTGGTGGCACATGCCTACAGG + Intronic
960512952 3:118572216-118572238 GCGTGGTGGCGGGTGCCTTATGG - Intergenic
960565729 3:119129844-119129866 GTGTGGTGGCAAATGCCTGTAGG + Intronic
960635183 3:119777918-119777940 GCATGGTGACATGTGCCTGTAGG + Intergenic
960760434 3:121068146-121068168 GCATGGTGGTGTGTGCCTGTAGG - Intronic
960888293 3:122419067-122419089 GCATGGTGGCGGGTGCCTGTGGG - Intergenic
960964647 3:123096323-123096345 GCGTGGTGGTACGCGCCTACTGG - Intronic
961437788 3:126931367-126931389 GGCTGGTGGGATGTGCTTGCTGG + Intronic
961654147 3:128432459-128432481 GCGTGGAGGCCGGTGCCTGCGGG + Intergenic
962113724 3:132478629-132478651 ACGTGGTGGCATGTACCTGGTGG + Intronic
962133618 3:132709419-132709441 GTGTGGTGGCGTGTGCCTGTGGG - Intronic
962293397 3:134156808-134156830 GAGTAGTGGCAGGTACCTGCAGG + Intronic
962578598 3:136777008-136777030 GTGTGGTGGCATGTACCTGTAGG + Intergenic
962725767 3:138225247-138225269 GCGTGGTGGCACATGCCTGTAGG - Intronic
963116168 3:141731029-141731051 CTGTGGTGGCATGTGCCCGTAGG + Intergenic
963256014 3:143145580-143145602 GCATGGTGGCATGTGCCTGGAGG + Intergenic
965227657 3:166010284-166010306 GCATAGTGGCATGTGCCTTTAGG - Intergenic
965576044 3:170219773-170219795 GTGTGGTGGCATATGCCTATGGG + Intergenic
965579250 3:170249651-170249673 GCATGGTGGCATGAGCCTGTGGG + Intronic
965587764 3:170334247-170334269 GCATGGTGGCACATGCCTGAAGG + Intergenic
965933139 3:174071565-174071587 GCGTGGTGGTATGGGCCAGTAGG + Intronic
966613486 3:181891029-181891051 GCATGGTGGCGAGTGCCTGTAGG + Intergenic
966721905 3:183072005-183072027 GCATGGTGGCACGTGCCTGTGGG - Intronic
967009278 3:185416758-185416780 GCATGGTGGCATGTGCCTGTAGG - Intronic
967300587 3:188008646-188008668 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
967544367 3:190707019-190707041 GCATGGTGGCACATGCCTGTAGG - Intergenic
967592059 3:191289268-191289290 GCATGGTGGCAGGCGCCTGTAGG + Intronic
968191028 3:196667313-196667335 GCATGGTAGCATGCGCCTGCAGG + Intronic
968425165 4:518452-518474 GCATGGTGGCAGGCGCCTGTAGG + Intronic
970910500 4:21269542-21269564 GCATGGTGGCATGCACCTGTAGG - Intronic
971776409 4:30971821-30971843 GCATGGTGGCACATGCCTGTGGG + Intronic
972432316 4:38994807-38994829 GCGTGGTGATGTGTGCCTGCAGG + Intronic
972489565 4:39574377-39574399 GCATGGTGGCATGCACCTGTAGG - Intronic
972621705 4:40753410-40753432 GCGTGGTGGCAGGTGCCACTTGG - Intronic
972655049 4:41056053-41056075 GCATGGTGGCAGGTGCCTGTGGG + Intronic
972840931 4:42929284-42929306 GTGTGGGGACATTTGCCTGCTGG - Intronic
973303564 4:48617485-48617507 GTGTGGTGGTATGTGCCTGTAGG - Intronic
974615787 4:64279377-64279399 GCGTGGTGGCACATGCCAGTAGG - Exonic
975422563 4:74185011-74185033 GCGTGGTAGCAGATGCCTGTAGG + Intronic
975653491 4:76618163-76618185 GCGTGGTGGCATGTGCCTATAGG + Intronic
975969854 4:80020245-80020267 GCATGGTGGCATGTGCCTATAGG + Intronic
976799324 4:88971067-88971089 GCGTGGTGGCGGGCGCCTGTAGG + Intronic
977087988 4:92628947-92628969 GTGGGGTGGCAGGTGGCTGCTGG + Intronic
977192701 4:94020837-94020859 GTATGGTGGCATATGCCTCCTGG + Intergenic
977602473 4:98948995-98949017 GCATGGTGGCACATGCCTGTAGG + Intergenic
979321534 4:119330704-119330726 GCATGGTGGCATGTGCTTCTGGG + Intergenic
979535547 4:121816092-121816114 GCGTGGTGGCATGTGCTTGTAGG - Intronic
980107707 4:128603600-128603622 GTGTGGTGGCATGGGCATGGTGG + Intergenic
980331512 4:131416194-131416216 GAGTGATGGCTTCTGCCTGCAGG + Intergenic
981028127 4:140096608-140096630 GCGAGGTGGCAAGAGGCTGCTGG + Intronic
982587994 4:157266919-157266941 GTGTGGTGGTGTGTGCCTGTAGG + Intronic
983497230 4:168457075-168457097 GCATGGTGGCATATGCCTGTGGG + Intronic
983556270 4:169061881-169061903 GCATTGTGGCAAGTGCCTGAGGG + Intergenic
984091594 4:175381533-175381555 GCGTGGTGGCGCATGCCTGTAGG + Intergenic
984187541 4:176564421-176564443 GCATGGTGGCATGCACCTGTAGG - Intergenic
984284717 4:177714573-177714595 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
984340401 4:178449914-178449936 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
984732632 4:183082610-183082632 GTGTGGTGGCACATGCCTGTAGG + Intergenic
985069788 4:186156834-186156856 GCATGGTGGCACATGCCTGTAGG + Intronic
985332725 4:188857936-188857958 GCGTGGTAGCATGTGCCTATAGG - Intergenic
985483580 5:135525-135547 GCATGGTGGCAGGTACCTGTAGG + Intergenic
985663966 5:1172246-1172268 GCGTGGAGGCATGAGCCACCTGG + Intergenic
986584464 5:9300164-9300186 GTGTGGTGGGGTGTGCCTGTAGG - Intronic
986897072 5:12384152-12384174 GCTTGCTTGCATGTGCCAGCAGG + Intergenic
986979594 5:13431863-13431885 GCATGATGGCATGAGCCTGTAGG + Intergenic
987006953 5:13720519-13720541 ACGTGGTGGCCTGTGCCTGTGGG - Intronic
987205117 5:15617575-15617597 GCATAGTGGCAGGTGCCTGTAGG - Intronic
988643979 5:33073465-33073487 GTGTGGTGGCATGTACCTTTAGG - Intergenic
988686443 5:33530056-33530078 GCATGGTGGCACATGCCTGTAGG - Intronic
990253243 5:53938685-53938707 GTGTGGTGCCATGTGCCTCTAGG + Intronic
990372133 5:55130981-55131003 GCATGGTGATATGTGCCTGTGGG + Intronic
990439890 5:55833804-55833826 GCGTGGTGGCAGGTGCCTGTAGG + Intergenic
990580990 5:57167510-57167532 GTGTGGTGGCATGTGCCTGTAGG + Intergenic
991512850 5:67399045-67399067 GTGTGGTGGCGGGTGCCTGTAGG - Intergenic
991919917 5:71646498-71646520 GCATGGTGGCACATGCCTGTAGG - Intronic
991991515 5:72344371-72344393 GCATGGTGGCACTTGCCTGTAGG + Intronic
992115921 5:73538542-73538564 GCATGGTGGCATGTGCCTGTAGG + Intergenic
992295315 5:75321665-75321687 GTGTGGTGGCATGAGCCTGTAGG + Intergenic
992300889 5:75379038-75379060 GCATGGTGGCACATGCCTGTGGG + Intronic
992354431 5:75966650-75966672 GAGTAGTGGCATGTGGCTGTTGG - Intergenic
992446302 5:76837168-76837190 GAGTGTTGGCATGTTCCTGTAGG - Intergenic
992689263 5:79227278-79227300 GCGTGGTGGCACGCACCTACAGG + Intronic
992719424 5:79545567-79545589 GCGTGCTGGCACATGCCTGGTGG + Intergenic
992734123 5:79701986-79702008 GCGTGGTGGCGGGCGCCTGTAGG + Intronic
994089747 5:95799713-95799735 GTGTGGTGGAGTGTGCCTGTAGG + Intronic
994098507 5:95869317-95869339 GCATGGTGGCATGCACCTGTAGG + Intergenic
994402656 5:99300906-99300928 GCATGGTGGTGTGTGCCTGTAGG - Intergenic
995000424 5:107121031-107121053 GCATGGTGGTGTGTGCCTGTAGG + Intergenic
995174410 5:109158242-109158264 GCTTGGTGGCACATGCCTGTAGG + Intronic
995288611 5:110422379-110422401 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
995436109 5:112137231-112137253 GCATGGTGGCAGGAGCCTGTAGG + Intergenic
995560300 5:113374041-113374063 GCGTGGTGGCATGCGCCTGTGGG - Intronic
995655324 5:114419857-114419879 ATGTGGTGGCATGTGCCTTCAGG + Intronic
996943465 5:129038065-129038087 GCATGGTTGCAAGTGCCTGTAGG + Intergenic
997148736 5:131467890-131467912 GCGTGGTGGTGTGTGCCTATAGG + Intronic
997305980 5:132836695-132836717 GCATGGTGGCATGTGCCTGCAGG - Intergenic
997827088 5:137116126-137116148 GTGTGGTGCCATCAGCCTGCAGG - Intronic
997898300 5:137739996-137740018 GCGTGCTGGCATCTGCTTCCGGG - Intergenic
997961934 5:138329041-138329063 GCATGGTGGCACGTGCCTGTAGG - Intronic
998579343 5:143354782-143354804 GCGTGGTGGCACACGCCTGTAGG + Intronic
999420662 5:151439512-151439534 GCGTGGTGGTGTGTGCCTGTAGG + Intronic
999456292 5:151719158-151719180 GCGTGGTGACATGTGCCTGTAGG - Intergenic
999473295 5:151875309-151875331 GCATGGTGGCATGCACCTGTAGG - Intronic
999946482 5:156601820-156601842 GCGTGGTGGCAGGCGCCTGTAGG - Intronic
999974518 5:156897630-156897652 GTGTAGTGGCATATGCCTGTGGG - Intergenic
1000092086 5:157938535-157938557 GCATTGTGGCGTGTGCCTGTGGG + Intergenic
1000686985 5:164262427-164262449 GCATGGTGGCATCTGCTTGTGGG - Intergenic
1001073549 5:168607057-168607079 GCGTGCTAGCATGGGCCTCCTGG - Intergenic
1001142841 5:169159635-169159657 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1001264608 5:170264535-170264557 GTGTGGTGGCTCATGCCTGCTGG + Intronic
1001779252 5:174353761-174353783 GCGTGGTGGTGGGTGCCTGTAGG - Intergenic
1002095883 5:176830582-176830604 GCGTGCTGGTGTGTGCATGCTGG + Intronic
1002117482 5:176974671-176974693 GTGTAGTGGCATGTGCCTGTAGG + Intronic
1002286379 5:178165263-178165285 GCGTGGTGGTGGGCGCCTGCGGG + Intergenic
1002717525 5:181237233-181237255 GCGTTGTGGCACATGCCTACTGG - Intronic
1002718301 5:181242703-181242725 ACGTGCTGGCAGGTGCCAGCTGG - Intronic
1003345749 6:5264930-5264952 GCATGGTGGCATGAGCCTATAGG - Intronic
1003643313 6:7893779-7893801 GCCTTGTGACTTGTGCCTGCTGG - Intronic
1004111560 6:12723626-12723648 GCATGGTGGCATGTGCCTACAGG - Intronic
1004221837 6:13753949-13753971 GCGTGGTGGCGCATGCCTGTAGG - Intergenic
1004345229 6:14843213-14843235 GCATGGTGGCATGTACCTTGTGG + Intergenic
1004410980 6:15381218-15381240 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
1004624000 6:17357751-17357773 GCGTGGTAGCAGGTGCCTGTAGG - Intergenic
1004726820 6:18318989-18319011 GCATGGTGGCATGCGCCTATAGG - Intergenic
1005557762 6:27005839-27005861 GCATGGTGGCATGTTCCTAAAGG - Intergenic
1005878817 6:30038156-30038178 GTGTGGTGGCGTGTGCCTGTAGG + Intergenic
1006013599 6:31062922-31062944 GTGTGGTGGCACATGCCTGTAGG + Intergenic
1006094607 6:31648152-31648174 GTGTGGTGGCACGCGCCTGTAGG - Intronic
1006346798 6:33488844-33488866 GCGTGGTGGCACGCACCTGTAGG + Intergenic
1006607661 6:35270273-35270295 GCATGGTGGCACGTGCCTGTAGG - Intronic
1006827857 6:36949258-36949280 GTGTGGTGGTGTGTGCCTGTAGG - Intronic
1007417021 6:41697267-41697289 GTGTGGTGGCACATGCCTGTAGG + Intronic
1007568359 6:42870782-42870804 GCATGGTGGCATATGCCTGTAGG + Intergenic
1007647957 6:43397294-43397316 GCATGGTGGCAGGTGCCTGTAGG + Intergenic
1008018848 6:46552907-46552929 GCATGGTGGTGTGCGCCTGCAGG + Intronic
1008213497 6:48755672-48755694 GCATGTTGGCATGCACCTGCAGG - Intergenic
1008948893 6:57132579-57132601 GCATGGTGGCATGTGCCTATAGG + Intronic
1009736476 6:67682723-67682745 GTATGGTGGCATGAACCTGCAGG + Intergenic
1010107499 6:72186990-72187012 GTGTGGTGGCATGCGCCTGTAGG + Intronic
1010225541 6:73485575-73485597 GCATGGTGGCAAGCGCCTGTAGG - Intronic
1010543067 6:77116399-77116421 CCATGGTGGCGTGTGCCTGTAGG + Intergenic
1010779522 6:79929377-79929399 GTGTGTTGGCGTGTGCCTGTAGG - Intronic
1011035486 6:82969467-82969489 GCATGGTGGCACATGCCTGTGGG + Intronic
1011178817 6:84595714-84595736 GCGTGATGGCGGGTGCCTGTAGG + Intergenic
1012321873 6:97859081-97859103 GCATGGTGGTGTGTGCCTGTAGG + Intergenic
1012586131 6:100924710-100924732 GCGTGGTGGCATGCGCACGTAGG + Intergenic
1013237933 6:108215209-108215231 GCGTGGTGGCGGGCGCCTGTAGG + Intronic
1013296254 6:108760764-108760786 GAGTGGTGGCAAGTGGCTGGGGG - Intergenic
1013327196 6:109058221-109058243 GTGTGGTGGTGTGTGCCTGTAGG - Intronic
1013402680 6:109814275-109814297 GTGTGGTGGCATGTGCTTGTGGG - Intronic
1014272066 6:119347558-119347580 GCGTGGTGACAGGTGACTGGGGG + Intronic
1014447141 6:121541647-121541669 GCATGGTGACATGTGCTTGTAGG + Intergenic
1014741978 6:125156325-125156347 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1015764829 6:136705439-136705461 TTGTGGTGGCATGTACCTGTAGG - Intronic
1016313249 6:142757518-142757540 GTGTGGTGGCACGTGCCTATAGG + Intronic
1017404176 6:154099144-154099166 GCGCGGTGGCATGCACCTGTAGG + Intronic
1017673767 6:156793472-156793494 GCATGGTGGCATGTGCCTGTAGG - Intronic
1018205549 6:161434383-161434405 GGAGGGTGGCATCTGCCTGCCGG + Intronic
1018281663 6:162192589-162192611 GCGTGGTAGCATGTGCCTGTAGG - Intronic
1018962044 6:168456077-168456099 GCGTGGGGGCACGGGCCTGCTGG + Intronic
1019339392 7:501551-501573 GCATGGTGGCCTGTGCTTACAGG - Intronic
1019363765 7:619987-620009 GTATGATGGCATGTGCCTGTAGG - Intronic
1019473135 7:1231721-1231743 GGGTGGTCGCATTTGGCTGCGGG - Intergenic
1019623598 7:2004149-2004171 GCCTGGTGGCCTGTGGGTGCTGG - Intronic
1019832794 7:3349736-3349758 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1019987776 7:4670336-4670358 GTGTGGTGGTGTGTGCCTGTGGG - Intergenic
1020036966 7:4969770-4969792 GAGTGGTGGCATGTGCCTGTAGG + Intergenic
1020163318 7:5788909-5788931 GAGTGGTGGCATGTGCCTGTAGG - Intergenic
1020171629 7:5849559-5849581 GCGTGGTGGCACGTGCCTGTAGG + Intergenic
1020204143 7:6102615-6102637 GTGTGGTGGGCTGTGCCTGTGGG + Intergenic
1020305494 7:6830880-6830902 GCATGGTGGCCCGTGCCTGTAGG - Intergenic
1021454057 7:20810471-20810493 GCATGGTGGAATGTGCCTGTAGG - Intergenic
1021715693 7:23460092-23460114 ACGAGGAGGCATGTGCCTGTAGG + Intronic
1021797337 7:24269632-24269654 GTGTGGTGGCACGAGCCTGTAGG - Intergenic
1022007000 7:26275173-26275195 GTGTGGTGGCATGTGACTGTAGG - Intergenic
1022234365 7:28446651-28446673 GCGTGGTGGTGGGTGCCTGTAGG + Intronic
1022858098 7:34336827-34336849 GCATGGTGGCACATGCCTGTGGG - Intergenic
1023048388 7:36230667-36230689 ACATGGCGCCATGTGCCTGCTGG - Intronic
1023290237 7:38660507-38660529 TCATGGTGGCATGTGCCTGTGGG - Intergenic
1023384153 7:39638580-39638602 GCCTGGTGGCATGTGCCTTCTGG - Intronic
1023438040 7:40158609-40158631 GCGTGGTGGCATGTGCCTGTAGG + Intronic
1023767377 7:43523825-43523847 GCAAGGATGCATGTGCCTGCAGG + Intronic
1024262150 7:47581273-47581295 GCTGTGTGGCATGTGCCTCCTGG - Intronic
1024265529 7:47603432-47603454 GCGTGGTGGTGTGCACCTGCGGG + Intergenic
1025116924 7:56266239-56266261 GCTTGGTGGCTTGTGCCTATAGG - Intergenic
1025901073 7:65745263-65745285 GCATGGTGGCGTGTGCCTGGAGG + Intergenic
1026167632 7:67924312-67924334 GCATGGTGGCGGGTGCCTGTAGG + Intergenic
1026321900 7:69275517-69275539 GCGCGGTGGCTCGTGCCTGTGGG - Intergenic
1026788266 7:73315496-73315518 GTGTGGTGTTATGTGCCTGTGGG - Intronic
1026890343 7:73978159-73978181 GTGTGCAGGCATGTGCGTGCAGG + Intergenic
1027353537 7:77335260-77335282 GCATGGTGGTGTGTGCCTGTAGG + Intronic
1027571364 7:79871417-79871439 GTGTGGTGGCACGCGCCTGTAGG - Intergenic
1027666214 7:81045082-81045104 GCGTGGTGGCAGGCGCCTGTAGG + Intergenic
1027995220 7:85417376-85417398 GTGTTGTGGTATGTGCCTGTAGG - Intergenic
1028805020 7:95015912-95015934 GCATGGTGGTGTGTGCCTGTAGG + Intronic
1029019790 7:97352443-97352465 GCGCGGTGGCAGCTGCCTGTAGG + Intergenic
1029306219 7:99622061-99622083 GCATGGTGGCACATGCCTGTAGG - Intronic
1029478583 7:100799795-100799817 GCATGGTGGCGTGCGCCTGGAGG + Intergenic
1029564533 7:101327135-101327157 GCATGGTGGCATGTACCTGTGGG - Intergenic
1030415859 7:109241533-109241555 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
1031158605 7:118139644-118139666 GCGTGGTGGCGGGCGCCTGTAGG + Intergenic
1031344937 7:120653170-120653192 GCATGGTGGTGTGTGCCTGTGGG - Intronic
1032829162 7:135605161-135605183 GCGTGGTGGCATGCACCTGTAGG - Intronic
1033288922 7:140064870-140064892 GCATGGTGGCACGTGCCTCTAGG - Intergenic
1034484311 7:151348712-151348734 GCATGGTGGCGTGTGCCTGTAGG - Intronic
1035226652 7:157437612-157437634 GGGTGGTGGCTTCTGCCTGAGGG + Intergenic
1035234715 7:157488819-157488841 GTGTGGTGGCTCGTGCCTGAGGG + Intergenic
1036158860 8:6367887-6367909 GCATGGTGGCGGGTGCCTGTAGG + Intergenic
1036458348 8:8929525-8929547 GCATGGTGGTGTGTGCCTGTAGG - Intergenic
1036534627 8:9635029-9635051 GCGCGGTGGCAGGCGCCTGTAGG + Intronic
1036981978 8:13479925-13479947 GTGTGGTGGCGTGTGTCTGTAGG + Intronic
1037093077 8:14946812-14946834 GCGTGGTGGTGGGTGCCTGTAGG - Intronic
1037132605 8:15424739-15424761 GCGTGGTGGCACATGCCTGTGGG + Intronic
1037194400 8:16170207-16170229 GCGTGGTGGCGGGCGCCTGCAGG + Intronic
1037506322 8:19533253-19533275 GTGTGGTGGTATGTACCTGTAGG - Intronic
1037624817 8:20597517-20597539 GCCTGGTGGCACATGCCTGTAGG - Intergenic
1037732300 8:21537236-21537258 GCATGGTGGTATATGCCTACAGG - Intergenic
1038455277 8:27668725-27668747 GCATGGTGGCATGCGCCTGTTGG + Intronic
1038675915 8:29622913-29622935 GTGTGGTGGCAGGCGCCTGTAGG - Intergenic
1038767085 8:30438910-30438932 GTGTGGTGGCATGCGCCTGTAGG - Intronic
1038807288 8:30806184-30806206 GCGTGGTGGCAGGCGCCTGTAGG - Intronic
1039041757 8:33415121-33415143 CTGTGGTGGCATGTGCCTGTAGG + Intronic
1039135924 8:34322771-34322793 GCGTGGTGGCGGGTGCCTGTAGG - Intergenic
1039547599 8:38421121-38421143 GGGTGGTGGCTGGTGACTGCGGG - Intronic
1039564879 8:38544214-38544236 GTGTGGTGGCACATGCCTGTAGG + Intergenic
1039571366 8:38589143-38589165 GTGTGGTGGCCTGTGCCTATAGG - Intergenic
1039619791 8:38986033-38986055 GTGTGGTGGCAGGTGCCTGTAGG + Intronic
1039851874 8:41375092-41375114 GCATGGTGGCAGGTGCCACCTGG + Intergenic
1040426680 8:47294767-47294789 ACGTGGTGGCACATGCCTGTAGG - Intronic
1040543822 8:48381605-48381627 GCTTGGTGGCATGTGCCTGTAGG - Intergenic
1041052724 8:53953380-53953402 GCGTGGTGGCACGTGCCTGCAGG + Intronic
1041249689 8:55922224-55922246 GCGTGGTGGCACATGCCTGTAGG - Intronic
1042126099 8:65538433-65538455 GCATGGTGGCATGAGCCTGTAGG + Intergenic
1042268419 8:66931956-66931978 GTGTGGTGGTACGTGCCTGGTGG + Intergenic
1042277822 8:67024451-67024473 GCATGGTGGCATGAGCCTGTAGG - Intronic
1042603758 8:70525782-70525804 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1042711110 8:71718634-71718656 CTGTGGTGGCATGTGCCTGTAGG + Intergenic
1042848114 8:73188333-73188355 GCATGGTGGCATGTGCCTATAGG + Intergenic
1043575668 8:81653190-81653212 GCATGGTGGCACCTGCCTGTAGG + Intergenic
1043840136 8:85093211-85093233 GCATGGTGGCATGCACCTGTAGG + Intergenic
1044264708 8:90167646-90167668 GCGTGGTGGCACATGCCTGTAGG + Intergenic
1044761411 8:95521326-95521348 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1044832682 8:96265632-96265654 GCGTGGTGGCATGCACCTGGAGG + Intronic
1044871284 8:96622329-96622351 CCGTGGTGGCATGCGCCTGTAGG - Intergenic
1044887814 8:96798266-96798288 GTGTGGTGGCATGCACCTGTGGG - Intronic
1045211450 8:100104177-100104199 GCGTGCTGGCACGTGCCTATAGG + Intronic
1045367160 8:101486889-101486911 GCGTGGTGGCAGGCACCTGGTGG + Intergenic
1045486182 8:102633478-102633500 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
1045747132 8:105436378-105436400 GTGTGGTGGTATGTGCCTGTGGG + Intronic
1045872878 8:106946239-106946261 GCGTCGTGGCATGCGTCTGTAGG - Intergenic
1045960565 8:107963383-107963405 GCATGGTGGTATGTGCCTGTTGG + Intronic
1046012329 8:108564571-108564593 GTGTGATGGTGTGTGCCTGCAGG - Intergenic
1046147321 8:110177936-110177958 GCTTGGAGGCATGTGCCTGTTGG - Intergenic
1046213003 8:111103419-111103441 GAATGGTGGCGTGTGCCTGTAGG + Intergenic
1046625807 8:116575855-116575877 GCATGGTGTCATGTGCCTGTAGG - Intergenic
1046648179 8:116808342-116808364 GCATGGTGGCACCTGCCTGGAGG + Intronic
1046775707 8:118161439-118161461 GTGTGGTGGCAAATGCCTGAGGG + Intergenic
1047051155 8:121115014-121115036 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1047539890 8:125754512-125754534 CCATGGTGGCATGTGCCTGTGGG + Intergenic
1048042427 8:130744245-130744267 ACGTGGTGGCATGTGCCTATAGG + Intergenic
1049035492 8:140072391-140072413 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1049089634 8:140504829-140504851 GCCTGGTGGCATGTGACTACAGG - Intergenic
1049545291 8:143228013-143228035 GCATGGTGGCACATGCCTGTGGG - Intergenic
1049563313 8:143324321-143324343 GCTTTGGGGCTTGTGCCTGCTGG + Intronic
1049599636 8:143501340-143501362 GTGTGATGGCTTGTGCCTGTGGG - Intronic
1049816166 8:144603111-144603133 GCGTGGAGGCGTGTGTGTGCTGG + Intronic
1049891694 9:75603-75625 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1049911284 9:270960-270982 ACCTGCTGGCATGTGACTGCTGG - Intronic
1050207302 9:3210613-3210635 GTGTGGTGGCATACGCCTGTTGG - Intergenic
1050231250 9:3527273-3527295 GCCTGGGGGCATGTGCCTGCTGG - Intergenic
1050450684 9:5778828-5778850 GCATGGTGGTGTGTGCCTGTGGG - Intronic
1052146180 9:25052136-25052158 GCGTGGTGGTGGGTGCCTGTAGG - Intergenic
1052494116 9:29205177-29205199 GTGTGGTGGTGTGTGCCTGTAGG - Intergenic
1052957141 9:34262078-34262100 GTGTGGTGGCTCGTGCCTGTGGG - Intronic
1053251453 9:36577539-36577561 GAGTGGTGGCATGTGACTCCTGG + Intronic
1053516552 9:38735282-38735304 GCGTGGTGGTGGGTGCCTGTAGG - Intergenic
1053733121 9:41076694-41076716 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG + Intronic
1055967881 9:81883123-81883145 GCGTGGTGGCGGGCGCCTGTAGG - Intergenic
1055985612 9:82055082-82055104 GCGTGGTGGCAGGCACCTGTAGG + Intergenic
1056098410 9:83277501-83277523 GGGTAATGGCATGTGCCTGTAGG - Intronic
1056308979 9:85320898-85320920 GCATGGTGGCCTGTCCCTGGTGG - Intergenic
1056329545 9:85510390-85510412 GAGTGGTGGCTTGTGGCTGGAGG - Intergenic
1056421260 9:86428792-86428814 GCATGGTGGCACATGCCTGTAGG - Intergenic
1056754963 9:89375970-89375992 GCTTGGTGGCACGTGCCTTGAGG - Intronic
1057163625 9:92908971-92908993 GCGTGGTGGCACGTGCCTAGTGG - Intergenic
1057253289 9:93521441-93521463 ACATGGTGGCATGTGCCTGTGGG + Intronic
1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG + Intergenic
1057881118 9:98793671-98793693 GCGTGGTGGCACGGGCATGGTGG - Intronic
1058446004 9:105055574-105055596 TTGTCGTGGCATGTGCCTGTAGG + Intergenic
1059095003 9:111403219-111403241 GCATGGTGGCTTGTGCCTGTAGG + Intronic
1059116372 9:111603477-111603499 GCGTGGTGGTGTGTGCCTGTAGG - Intergenic
1059122314 9:111652377-111652399 GCGTGGTGGCATGCTCCTGTAGG + Intronic
1059151428 9:111953011-111953033 GCGTGGTGGCAGGCGCCTATAGG + Intergenic
1059192412 9:112339150-112339172 GCGTGGTGGCTCATGCCTGTAGG + Intergenic
1059228742 9:112697443-112697465 GCTTGGTGGCATGTGCCTGTAGG + Intronic
1060604785 9:124903908-124903930 GCGTGGTGGAGCGTGCCTGTAGG + Intronic
1060648250 9:125301205-125301227 ATGTGGTGGCGTGTGCCTGTAGG - Intronic
1060697618 9:125722747-125722769 GCGTGGTGGTGGGTGCCTGTAGG - Intergenic
1060905080 9:127297275-127297297 ACGTGGTGGCCTGCGCCTGTAGG - Intronic
1060922035 9:127427678-127427700 CCGTGGTGGCGCATGCCTGCAGG - Intronic
1061021978 9:128021854-128021876 GCATGGTGGTGTGTGCCTGTAGG - Intergenic
1061165569 9:128920206-128920228 GCGTGGTGGCAGGCGCCTGTAGG + Intergenic
1061344107 9:130008208-130008230 GTGTGGTGTCATGCGCCTGTGGG + Intronic
1061378313 9:130239210-130239232 GCGTGGTGGCAGGTGCCTGTGGG + Intergenic
1061486903 9:130924651-130924673 CAGGGGTGGCAGGTGCCTGCTGG - Intronic
1061725666 9:132580728-132580750 GGGTGGTGGCAGGGGCGTGCAGG + Intergenic
1062048636 9:134435976-134435998 GCGTGGTGGTGCATGCCTGCAGG - Intronic
1062424190 9:136498446-136498468 GCGTGGCGGCAGCTCCCTGCGGG - Intronic
1203426697 Un_GL000195v1:47156-47178 GCATGGTTGCCTGTGCCTGTAGG - Intergenic
1203582007 Un_KI270746v1:16439-16461 GCGTGATGGCGGGTGCCTGTAGG + Intergenic
1185474008 X:402677-402699 GCATGGTGGCACCTGCCTGTAGG + Intergenic
1185669007 X:1791014-1791036 GTGTGGTGGCAGGTGCCACCTGG + Intergenic
1185728449 X:2441933-2441955 GTGTGGTGGCGTGCGCCTGTAGG + Intronic
1186910599 X:14160551-14160573 GCATGGTGGTGTGTGCCTGTAGG + Intergenic
1187913660 X:24133316-24133338 CCCTGGTGGCCAGTGCCTGCTGG + Intergenic
1188210872 X:27421685-27421707 GCTTGGTGGCTTGTGCCTGTAGG + Intergenic
1188298243 X:28476610-28476632 GCATGGTGGCATGCACCTGTAGG - Intergenic
1188355442 X:29184637-29184659 GTGTGGTGGCATGAGCCTGTAGG - Intronic
1188379967 X:29479273-29479295 GTGTGGTGGCACGTGCCTTGTGG + Intronic
1189128264 X:38471322-38471344 GCATGGTGGCGTGCGCCTGTAGG + Intronic
1189233348 X:39469357-39469379 GCCTGGTGGCTGGGGCCTGCTGG - Intergenic
1189684160 X:43546380-43546402 GCGTGGTGGCATGTGTCTGTAGG - Intergenic
1190226302 X:48548252-48548274 GCATGGGGGCATGTGCCTATAGG - Intronic
1190332070 X:49242254-49242276 GGGTGGCGGTATGTGCCTTCAGG + Intronic
1190778159 X:53571460-53571482 GCGTGGTAGCATGTGCCTATAGG + Intronic
1192445270 X:71206447-71206469 GCGTGGTGGCGTGGGCCTGTAGG + Intergenic
1193970327 X:88042939-88042961 GCATGGTGGCGGGTGCCTACAGG + Intergenic
1195062209 X:101207159-101207181 GCGTGTTGGTATGCGCCTGTAGG - Intergenic
1195444515 X:104936742-104936764 CCGTGGTGGCGGGTGCCTGTAGG - Intronic
1197229153 X:123984774-123984796 GTGTGGTGGCGTGTGCCTGTGGG - Intronic
1197482558 X:127005030-127005052 GGGTGTTGACATGTGCCTGAGGG - Intergenic
1197940720 X:131786009-131786031 GCGTGGTGGCATGCACCTGTGGG + Intergenic
1198023587 X:132682973-132682995 GCATGGTGGCACTTGCCTGTAGG + Intronic
1198052076 X:132959542-132959564 GGGTGGGGGCATGTCCCTCCTGG + Intronic
1198074730 X:133183495-133183517 GTGTGGTGGTATGTACCTGTAGG + Intergenic
1198187522 X:134268003-134268025 GCATGGTGGCGTGTGCCTGTGGG - Intergenic
1198262412 X:134976757-134976779 GCATGGTGGCAGGCGCCTGTAGG - Intergenic
1198446711 X:136724627-136724649 GCATGGTGGCATGTGCTTGCAGG - Intronic
1199301382 X:146218223-146218245 GCGTGATGGCATGCACCTGTAGG - Intergenic
1199835023 X:151581449-151581471 GCATGGTGGCATGCACCTGTAGG + Intronic
1200205159 X:154310317-154310339 GCATGGTGGCGTGGGCCTGTAGG + Intronic
1200750473 Y:6940121-6940143 GCGTGGTGACCCGTGCCTGTAGG + Intronic
1201742329 Y:17337261-17337283 TTGTGGTGGCAGGTGCCTGTAGG - Intergenic
1201903686 Y:19068247-19068269 GTGTGGTGGCACCTGCCTGTAGG + Intergenic
1202245088 Y:22811808-22811830 GCCTGGTGGCTGGTGCCTGTAGG - Intergenic
1202270222 Y:23065064-23065086 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202398078 Y:24445554-24445576 GCCTGGTGGCTGGTGCCTGTAGG - Intergenic
1202423216 Y:24698809-24698831 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202472703 Y:25224532-25224554 GCCTGGTGGCTGGTGCCTGTAGG + Intergenic