ID: 1180669275

View in Genome Browser
Species Human (GRCh38)
Location 22:17540698-17540720
Sequence CACACAGCCCCCGCGGGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 219}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180669264_1180669275 23 Left 1180669264 22:17540652-17540674 CCACACGCCGAGCGCCCTCTTCT 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 219
1180669263_1180669275 24 Left 1180669263 22:17540651-17540673 CCCACACGCCGAGCGCCCTCTTC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 219
1180669268_1180669275 16 Left 1180669268 22:17540659-17540681 CCGAGCGCCCTCTTCTGGGGACG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 219
1180669262_1180669275 25 Left 1180669262 22:17540650-17540672 CCCCACACGCCGAGCGCCCTCTT 0: 1
1: 0
2: 1
3: 3
4: 44
Right 1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 219
1180669270_1180669275 8 Left 1180669270 22:17540667-17540689 CCTCTTCTGGGGACGATCAGAGC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 219
1180669269_1180669275 9 Left 1180669269 22:17540666-17540688 CCCTCTTCTGGGGACGATCAGAG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 219
1180669261_1180669275 26 Left 1180669261 22:17540649-17540671 CCCCCACACGCCGAGCGCCCTCT 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 219
1180669260_1180669275 27 Left 1180669260 22:17540648-17540670 CCCCCCACACGCCGAGCGCCCTC 0: 1
1: 0
2: 1
3: 7
4: 152
Right 1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180669275 Original CRISPR CACACAGCCCCCGCGGGAGG TGG Exonic
900031824 1:378166-378188 GACTCAGCCTCCGCAGGAGGAGG + Intergenic
900052372 1:606357-606379 GACTCAGCCTCCGCAGGAGGAGG + Intergenic
900184920 1:1328497-1328519 CCCACGGCCGCTGCGGGAGGCGG - Exonic
900408288 1:2501963-2501985 CACACACCCCCAGCCTGAGGTGG + Intronic
901551393 1:9997957-9997979 CACCCAGCCCTCGTGGGAGGCGG - Intronic
901857495 1:12053672-12053694 CACACAGGCCCCCCAGGAGGTGG + Intergenic
902768738 1:18633454-18633476 GACACAGTCCCCCCGGGTGGGGG - Intronic
903928656 1:26849643-26849665 CACACTGTCCCCGGGGGTGGAGG - Intronic
904256714 1:29259248-29259270 CAAACAGCACCTGGGGGAGGCGG - Exonic
904302179 1:29561455-29561477 CACACAGCCCACAGGGGTGGAGG - Intergenic
904401241 1:30258035-30258057 CACACAGCCCACAGGGGCGGAGG + Intergenic
904455086 1:30642682-30642704 CACACAGCCCACAGGGGTGGAGG + Intergenic
904455103 1:30642808-30642830 CACACAGCCCGCAGGGGTGGAGG - Intergenic
904550533 1:31313191-31313213 CACTCAGCCCCCGAGGTAGCTGG + Intronic
905692700 1:39955009-39955031 CACAGAGCCGCCGGGCGAGGCGG + Intergenic
905922566 1:41729149-41729171 CCCACAGCCACCTTGGGAGGTGG - Intronic
906740158 1:48174466-48174488 CAGCCACCCCCTGCGGGAGGTGG + Intergenic
909075608 1:71047609-71047631 CAGAGAGCCGCAGCGGGAGGGGG + Exonic
914361225 1:146938259-146938281 CCCCCAGCTCCCGCGAGAGGTGG - Intergenic
914491362 1:148152363-148152385 CCCCCAGCTCCCGCGAGAGGTGG + Intergenic
920800881 1:209186330-209186352 CACTCAGCCCCCTTGGGAGAGGG + Intergenic
921432740 1:215082821-215082843 CACACACCCCCCGCGGGGCACGG + Intronic
922741903 1:228018833-228018855 CACACAGACCCTGCCTGAGGAGG - Intronic
922860082 1:228809100-228809122 AACACAGACCCAGCCGGAGGGGG + Intergenic
1062798731 10:363541-363563 CACACAGCACCCGCGGGCTCTGG + Intronic
1064230974 10:13529037-13529059 CTGACCGCCCCCGCGGGAGGAGG + Intergenic
1069591021 10:69641877-69641899 CACGCAGCTCCTGGGGGAGGAGG - Intergenic
1069981383 10:72255208-72255230 ACCCCAGCCTCCGCGGGAGGAGG - Intergenic
1073207157 10:101775438-101775460 CACCCAGCCGCCGAGGAAGGGGG - Intronic
1074366511 10:112861758-112861780 CACACAGCCCCCACGAATGGGGG - Intergenic
1075418888 10:122286211-122286233 CACACACCCCCTGAGGGAGCTGG + Exonic
1075544327 10:123343053-123343075 CACACAGCACCCCAGGCAGGTGG - Intergenic
1077113577 11:872848-872870 CACAGAGGCCCCCCAGGAGGAGG - Intronic
1077460792 11:2708443-2708465 CCCACAGCCCCCGAGGAGGGTGG + Intronic
1084705979 11:70816203-70816225 CACCCAGCACACTCGGGAGGGGG + Intronic
1084860616 11:72015567-72015589 GACACAGGCCCAGCGGGAGAAGG - Exonic
1084981606 11:72831935-72831957 CACACACACCCTGGGGGAGGGGG - Intronic
1088930779 11:114348807-114348829 CACACTGCCCCTGAGGGAGAAGG - Intergenic
1090347027 11:126079820-126079842 CACCCAGCCCCACCTGGAGGTGG + Intergenic
1095476349 12:42590229-42590251 CACACACCCCCCGAAGGAGAAGG - Intronic
1096730087 12:53602755-53602777 CACACAGCCCCAGGATGAGGGGG + Intronic
1106464509 13:30000657-30000679 CACACAGACACCTCTGGAGGAGG + Intergenic
1106692816 13:32136765-32136787 CACAGGGCCCCCGAGGGAGATGG + Intronic
1113995034 14:16057767-16057789 CACACAGGGCCTGCGGGGGGAGG - Intergenic
1115758005 14:36549113-36549135 CACAGAACCCCTGGGGGAGGTGG - Intergenic
1115828776 14:37310673-37310695 CACTCAGCCTCCATGGGAGGTGG - Intronic
1117805291 14:59484376-59484398 CCCACTGACTCCGCGGGAGGAGG + Exonic
1118036902 14:61877703-61877725 CACACAGCTCCCCAGGGAGAAGG - Intergenic
1118282697 14:64443938-64443960 CACACAGCCCCTTCTGGAGTTGG + Intronic
1121097761 14:91229661-91229683 CACACAGACCCTGCAGGAGATGG + Intergenic
1121311414 14:92937380-92937402 CACACAGCCCTGGAGGAAGGGGG + Exonic
1121527391 14:94628536-94628558 CCCTCAGCCCCCAGGGGAGGCGG - Intergenic
1122455388 14:101846186-101846208 CAGACAGACCCGGAGGGAGGCGG + Intronic
1125476921 15:40054048-40054070 GACCCAGCCCCTGCGGGAAGAGG - Intergenic
1126110023 15:45169513-45169535 CAAACAGCCCCTGTGGGTGGTGG + Intronic
1126700238 15:51360414-51360436 CACACTGCCCCCGAGGGCGAAGG + Intronic
1131179688 15:90231302-90231324 CACAAAGCCCACGTGGGAAGGGG + Intronic
1132170011 15:99641129-99641151 CACAGAGCCCCCCAGGGAAGAGG + Intronic
1132543835 16:524087-524109 CACACAGACCCCTGGGTAGGTGG - Intergenic
1132645627 16:998056-998078 CACACAGCCTGCGCGGGGGCTGG + Intergenic
1133420054 16:5638386-5638408 CACACAGCCCTAGCAGGGGGAGG + Intergenic
1133513502 16:6483655-6483677 CCCACTGACTCCGCGGGAGGGGG + Intronic
1134238885 16:12489482-12489504 CACACAGCCAGTGTGGGAGGGGG - Intronic
1134846964 16:17448555-17448577 CACACAGCTCCAGAGGAAGGAGG + Intronic
1136559894 16:31033139-31033161 CACACGGCCCCCGCGAGGTGGGG - Intronic
1136561731 16:31043014-31043036 CACATGGCCCCCGCTGCAGGTGG - Intergenic
1136913806 16:34163260-34163282 CACACAGGGCCTGCGGGGGGAGG - Intergenic
1138439585 16:57026086-57026108 CGCCCAGCCATCGCGGGAGGGGG + Exonic
1139576817 16:67847147-67847169 CTCACAGGACCGGCGGGAGGCGG - Intronic
1141997436 16:87644444-87644466 CACGAAGCCCCCGCGGGACACGG - Exonic
1142142787 16:88479909-88479931 CTCACACCCCCCGCCGAAGGAGG + Intronic
1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG + Intronic
1142849124 17:2695845-2695867 GACACAGAGCCTGCGGGAGGAGG + Intronic
1144806544 17:17971944-17971966 GGCCCAGCCCCCCCGGGAGGTGG + Intronic
1147134241 17:38425992-38426014 CCCTCAGACCCCGCAGGAGGGGG - Intergenic
1148775000 17:50090273-50090295 GACACAGCCCATGGGGGAGGGGG - Intronic
1151558671 17:74859809-74859831 CAGGCTCCCCCCGCGGGAGGAGG + Exonic
1151571004 17:74925278-74925300 CACACAGCCCCAAAGAGAGGGGG + Intronic
1152072613 17:78141243-78141265 CACACAACCCCAGCGGCAGCAGG + Exonic
1152300685 17:79493856-79493878 CACACACCCGCCGCGGCAGTAGG + Intronic
1152339462 17:79716234-79716256 CACTCAGCCCCCGGGAAAGGTGG - Intergenic
1152600017 17:81257602-81257624 CACACAGCCCCCATGCGTGGAGG - Intronic
1152606885 17:81295775-81295797 CACACAGCTCCAAGGGGAGGCGG + Intergenic
1152718983 17:81913542-81913564 CACACAATCCCCGCGGGGAGAGG - Intronic
1152947833 17:83207548-83207570 GACTCAGCCTCCGCAGGAGGAGG - Intergenic
1153801840 18:8678069-8678091 CACAGAGCCCCCGTGGGATTGGG - Intergenic
1156443017 18:37210594-37210616 CACACAGCCCCAGCAGGATCAGG + Intronic
1157528998 18:48406309-48406331 CACACCGCCCCTGCTGGAGAGGG + Intronic
1159018833 18:63126305-63126327 GAGAAAGCCCCCGCGGAAGGAGG + Exonic
1160138515 18:76296615-76296637 CACACAGCCGCCGCCAGAGAGGG + Intergenic
1160838647 19:1136520-1136542 GCCACAGCCCCCCCGGGAGGAGG - Intronic
1160904326 19:1445406-1445428 CGCGCAGGCCCAGCGGGAGGTGG - Intergenic
1161062541 19:2222375-2222397 CACACAGTCCCCACGGGCGCTGG - Exonic
1161468552 19:4445306-4445328 CCCACAGCCCCCAAGGGATGGGG + Exonic
1161494601 19:4580518-4580540 CAATCAGCGCCCGCGGGAGGGGG + Intergenic
1162721595 19:12666077-12666099 CAGACGGCCACCGTGGGAGGTGG + Intronic
1162954319 19:14090027-14090049 GCCACAGCCGCCGCCGGAGGGGG - Exonic
1165311720 19:35032531-35032553 CACGCAGCCCCCGCAGGCTGAGG - Exonic
1166336833 19:42113352-42113374 CACACAGCCCCCTCGGCAGAAGG + Intronic
1166524942 19:43504838-43504860 CCAACAGCTCCCGAGGGAGGAGG + Exonic
1168071752 19:53957279-53957301 AACACAGCCCCCAAGGGAAGGGG - Intergenic
1168144920 19:54415535-54415557 CCCATGGCCCCCGGGGGAGGGGG - Exonic
928260695 2:29763972-29763994 CTCACAGCCACCTGGGGAGGTGG + Intronic
929430018 2:41878884-41878906 AACACAGTCACCACGGGAGGAGG + Intergenic
931235715 2:60410910-60410932 CAGACAGCCCCTGTGGGTGGGGG + Intergenic
931265052 2:60653128-60653150 GATGCAGCCCCCACGGGAGGTGG - Intergenic
937223860 2:120357067-120357089 CACACAGACCCCACAGGAAGAGG - Intergenic
937299687 2:120831657-120831679 CACACAGCCCCCGGTGGTGCAGG + Intronic
937333167 2:121044643-121044665 CACACAGGCCCCGGTGAAGGAGG + Intergenic
938464029 2:131515336-131515358 CACACAGCCCACCCCGGGGGAGG - Intergenic
941706654 2:168665473-168665495 CACACAGCACCCTCGGATGGTGG + Intronic
943836871 2:192525009-192525031 CACAGAGCACCCGGGGGAAGGGG + Intergenic
946395348 2:219441573-219441595 CAGAGAGGCCCCGCGGGAGGAGG + Intronic
946409691 2:219509849-219509871 CACACAGCACCCCCTTGAGGTGG - Intergenic
946421636 2:219568286-219568308 CACACGGCCCCTGCAGGACGTGG - Exonic
946692690 2:222320565-222320587 GACCCAGCCCCCGGGCGAGGAGG - Intergenic
948040977 2:234901268-234901290 CACCCAGCCCCTGCGGCTGGTGG + Intergenic
948174003 2:235928896-235928918 CTCACAGCAGCCGGGGGAGGTGG - Intronic
948602436 2:239115100-239115122 GGCAGAGCCCCCACGGGAGGTGG - Exonic
948932663 2:241142044-241142066 CACACAGCGCCCTTGGGAGTGGG - Intronic
1169532778 20:6503465-6503487 CACACAGCCCAAGAGGGAGAAGG + Intergenic
1171466076 20:25328903-25328925 CACACAGCCCCAGAGCGGGGTGG + Intronic
1171810257 20:29741338-29741360 CACACAGGACCTGCGGGGGGAGG + Intergenic
1171908717 20:30921833-30921855 CACACAGGGCCTGCGGGGGGAGG - Intergenic
1173804017 20:45912225-45912247 CTCCCAGCCCCCAAGGGAGGAGG - Intergenic
1174412333 20:50344171-50344193 CAGACAGACCCCGAGGGAGATGG - Intergenic
1174422873 20:50411712-50411734 CTCACATCCCCTGCTGGAGGAGG - Intergenic
1175833689 20:61980432-61980454 CCCACAGCCGCCCCGGGCGGCGG + Intronic
1176076113 20:63248954-63248976 CATCCAGCCCCCGGGGGAAGGGG + Intronic
1176220976 20:63969356-63969378 CACAGAGCCCTCGCGGGGAGAGG + Intronic
1176548779 21:8212877-8212899 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1176556674 21:8257086-8257108 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1176567710 21:8395912-8395934 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1176575613 21:8440128-8440150 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1177162270 21:17560457-17560479 CACACAGCCTCAGCTGGAGCAGG - Intronic
1178690355 21:34745086-34745108 CCAACAGCCCCCTGGGGAGGAGG + Intergenic
1179581588 21:42347815-42347837 TCCACAGTCCCCGGGGGAGGCGG - Intronic
1179923084 21:44517713-44517735 CACAGAGCCCCCGCAGGACAAGG - Exonic
1179923431 21:44520005-44520027 CACTCTGCCCCCGTGGCAGGAGG + Intronic
1180312058 22:11249642-11249664 CACACAGGGCCTGCGGGGGGAGG + Intergenic
1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG + Exonic
1180864314 22:19107158-19107180 CAAACAGCCCCCGGGGCAAGTGG + Intronic
1180876087 22:19175825-19175847 CACACGGGCACCCCGGGAGGCGG + Exonic
1181571059 22:23767998-23768020 AACACGCCCCCAGCGGGAGGCGG + Exonic
1183374718 22:37456570-37456592 CTCACAGTCCCCGGGCGAGGAGG - Intergenic
1183380048 22:37486147-37486169 CAGCCAGGCCCCGCGGGAGCCGG + Exonic
1183618456 22:38959186-38959208 CCCACAGCCCCTGCTGGAGATGG - Intronic
1183623652 22:38989084-38989106 CCCACAGCCCCTGCTGGAGATGG - Intronic
1184072818 22:42156512-42156534 CCCACAGCCCCCTAAGGAGGTGG + Intergenic
1184357243 22:43990612-43990634 CACAAAGCACCTGAGGGAGGGGG - Intronic
1203253664 22_KI270733v1_random:129182-129204 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1203261720 22_KI270733v1_random:174261-174283 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
950262944 3:11555212-11555234 CCCAGAGCCACTGCGGGAGGTGG + Exonic
950723821 3:14902873-14902895 CACACAGCCCCACCCAGAGGAGG + Intronic
953535503 3:43774048-43774070 CCCACAGTCCCCTGGGGAGGTGG - Intergenic
960632277 3:119744157-119744179 AAAACAGCGCCTGCGGGAGGAGG + Exonic
960965295 3:123100279-123100301 CACAGAGTCCCTGCGGGACGGGG + Intronic
962653856 3:137522611-137522633 CACACAGCCCCTACGTGAAGAGG + Intergenic
968462519 4:732437-732459 CTCACAGCCCCGCAGGGAGGAGG + Intronic
969492832 4:7509764-7509786 AACACAGCCCCGGTGGGCGGTGG - Intronic
969607979 4:8211789-8211811 TCCACAGCCCCCGTGGCAGGTGG + Intronic
974036360 4:56821663-56821685 AAGACAGCCGGCGCGGGAGGAGG - Exonic
975140624 4:70914851-70914873 CACACAGCCCCAAGGAGAGGAGG - Intronic
977323697 4:95549242-95549264 CACACAGACACCGGGGGTGGGGG + Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
985210435 4:187586757-187586779 CTCACAGACCCCGCGGCGGGAGG - Intergenic
985633893 5:1026761-1026783 CTCCCAGCCCCCGAGGCAGGAGG + Intronic
985965772 5:3338066-3338088 CACAGAGACCCCTCTGGAGGGGG + Intergenic
987962056 5:24823568-24823590 CACACATCCCCAGTGGGAGGGGG - Intergenic
992210658 5:74476607-74476629 CACACAGCCCACAAGGAAGGAGG + Intergenic
994900401 5:105762570-105762592 CTCACAGCTCCCCCAGGAGGTGG + Intergenic
997511792 5:134459377-134459399 GACAGAGCCTCCGCGGGAGAGGG + Intergenic
1002741996 5:181440702-181440724 GACTCAGCCTCCGCAGGAGGAGG - Intergenic
1003112908 6:3264082-3264104 CCCACAGCCCCTGTGGGTGGTGG + Intronic
1003698356 6:8435576-8435598 CACACAGGCCTGTCGGGAGGCGG - Intergenic
1004924133 6:20402648-20402670 TCCCCAGCCCCGGCGGGAGGTGG + Intronic
1006641083 6:35490221-35490243 CACAGTGCTCCCGCGGGGGGCGG - Intronic
1016199877 6:141394535-141394557 CCCACAGAGCCAGCGGGAGGCGG + Intergenic
1019247133 6:170716440-170716462 GACTCAGCCTCCGCAGGAGGAGG - Intergenic
1019400965 7:853600-853622 GGGACAGCCCCCGAGGGAGGTGG + Exonic
1019702354 7:2480130-2480152 TTCTCAGCCCCCGCTGGAGGAGG + Intergenic
1020617983 7:10483847-10483869 CACAAAGCCCCCGAGGAAGTGGG + Intergenic
1022223843 7:28342683-28342705 CACACAGGCCCAGCATGAGGTGG - Intronic
1024059912 7:45690055-45690077 CACACAGCCCAGGAGGCAGGTGG + Intronic
1024619559 7:51145991-51146013 CACACTGCCCAGGCTGGAGGTGG + Intronic
1025638756 7:63348789-63348811 CACACTGGCACCCCGGGAGGCGG + Intergenic
1025643940 7:63399300-63399322 CACACTGGCACCCCGGGAGGCGG - Intergenic
1026878472 7:73893519-73893541 GGGACAGCCCCCGCAGGAGGAGG + Intergenic
1031657723 7:124379399-124379421 CACACAGCCTCTGCTGGGGGTGG - Intergenic
1032510274 7:132466698-132466720 GAGACTGCCCCCGAGGGAGGGGG - Intronic
1033159641 7:138984029-138984051 CACACACCCTCCAGGGGAGGGGG + Intergenic
1035265986 7:157690569-157690591 CCCAGCGCCCGCGCGGGAGGAGG + Intronic
1035353387 7:158261970-158261992 GTCACAGTCACCGCGGGAGGAGG - Intronic
1035501004 8:91494-91516 GACTCAGCCTCCGCAGGAGGAGG + Intergenic
1035781724 8:2233189-2233211 CACACAGCCACCGCAGTGGGTGG + Intergenic
1035810371 8:2486175-2486197 CACACAGCCACCGCAGTGGGTGG - Intergenic
1038779253 8:30556670-30556692 CACAGAGCCCCCATGGCAGGTGG - Intronic
1039058232 8:33553665-33553687 CAAACAGCCCCAGTGGAAGGGGG + Intronic
1040285793 8:46099802-46099824 CAGAGGGCCCCCTCGGGAGGCGG + Intergenic
1045028965 8:98117196-98117218 CCCACAGCTCCCGCTGGGGGCGG + Exonic
1047753430 8:127899765-127899787 CACACAGCACAAGAGGGAGGCGG - Intergenic
1049029350 8:140023006-140023028 CACACAGGGCCCACTGGAGGAGG + Intronic
1049470591 8:142773513-142773535 CACCCAGTTCCCGCTGGAGGAGG - Intronic
1049614400 8:143569798-143569820 CGCACGGCTCCTGCGGGAGGAGG - Exonic
1051603483 9:18897228-18897250 GACAGAGCCCCCGGGGGAAGGGG + Intronic
1054340783 9:63859848-63859870 CCCACAGCTCTAGCGGGAGGCGG - Intergenic
1054784888 9:69201094-69201116 CACACAGCCCAGTGGGGAGGTGG - Intronic
1060229676 9:121817635-121817657 CACCCAGCCTCTGCGGGACGTGG + Intergenic
1060408720 9:123385764-123385786 CACACAGCACCCGCAAGAGGTGG + Intronic
1060793816 9:126501922-126501944 CACATCGCCCCAGCAGGAGGCGG - Intronic
1060992482 9:127856955-127856977 CTCACAGCCACCCCAGGAGGTGG + Intergenic
1061064215 9:128267382-128267404 CACCCAGCCCCCGCTGTGGGAGG + Intronic
1061494297 9:130962925-130962947 CAGACAGCCCCCCGGGGCGGGGG - Intergenic
1061673286 9:132201307-132201329 CACCCAGCCTCTGCGGGCGGCGG + Intronic
1061712748 9:132499040-132499062 CACACAGTCCCTGCCGGCGGCGG - Intronic
1061727452 9:132589543-132589565 CACGCCGAGCCCGCGGGAGGAGG - Exonic
1062502689 9:136858128-136858150 CAGGCAGCCCTCGGGGGAGGGGG - Intronic
1062612949 9:137383143-137383165 CACACAGGCCACCCTGGAGGCGG + Intronic
1062665720 9:137670438-137670460 CACCCAGCACCGGGGGGAGGGGG - Intronic
1062680340 9:137775705-137775727 CACACAGCTCCTGGGAGAGGTGG + Intronic
1203470064 Un_GL000220v1:112330-112352 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1203477885 Un_GL000220v1:156302-156324 CACGCAGGGCCCGCGGGGGGAGG - Intergenic
1203607908 Un_KI270748v1:71918-71940 GACTCAGCCTCCGCAGGAGGAGG - Intergenic
1186207683 X:7217168-7217190 CACACATCCCCTGGGGGTGGTGG + Intergenic
1192208405 X:69111043-69111065 CACACCGCCCCCGCAGGAGGAGG - Intergenic
1192547749 X:72027756-72027778 AACACAGACCCTGTGGGAGGCGG + Intergenic
1197184790 X:123574013-123574035 GACACAGCACCTGCGGGAAGGGG + Intergenic
1197773530 X:130105838-130105860 CACACAGGCCCCTGGGGAGTGGG - Intronic
1200150721 X:153950096-153950118 CACACAGCCCCCCACGGGGGTGG - Intronic
1200155425 X:153972394-153972416 CACCCAGCAGCCGCAGGAGGCGG + Exonic