ID: 1180669392

View in Genome Browser
Species Human (GRCh38)
Location 22:17541674-17541696
Sequence CACACGTGCTCACCCGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180669392_1180669393 5 Left 1180669392 22:17541674-17541696 CCTGATGCGGGTGAGCACGTGTG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1180669393 22:17541702-17541724 AGTCTCCCTGTCTCCAGCCGAGG 0: 1
1: 0
2: 12
3: 130
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180669392 Original CRISPR CACACGTGCTCACCCGCATC AGG (reversed) Intronic
900471493 1:2857153-2857175 CACAGGTGCTCAGCCACACCCGG - Intergenic
900996119 1:6124541-6124563 AGCACGTGCTGACCCGCATCGGG - Exonic
901676938 1:10890844-10890866 CACTCCTGCTCACCCACACCAGG + Intergenic
903864942 1:26391096-26391118 CACACGTGCACACACACAGCCGG - Intergenic
904495124 1:30882248-30882270 CACAAGTGCACACACACATCGGG + Intronic
904747016 1:32717554-32717576 CACAAGTGCCCACCTGCAGCAGG - Intergenic
906940165 1:50248914-50248936 CACATGTCCTCACCAGGATCTGG + Intergenic
908743598 1:67354245-67354267 CACACCTGCTCTCCCTCACCTGG - Intronic
908760835 1:67510553-67510575 CAGACGTGCACAACCACATCTGG + Intergenic
916889508 1:169102817-169102839 CACACGTGCTCACTCACAGTGGG - Intergenic
918055881 1:181022119-181022141 CAAACGTGCTCAGACGCCTCTGG + Intronic
920449750 1:206051039-206051061 CACAGGTGTTCACCGGCCTCAGG - Intronic
921922725 1:220686937-220686959 CACAGGTACACACCCACATCAGG + Intergenic
922153045 1:223021368-223021390 CACACGCCCCCACCCACATCAGG + Intergenic
922616186 1:226962507-226962529 CACAGGTGCACACGCGCAACAGG - Intronic
1081739402 11:45427592-45427614 CACACTTGCTCTCGCACATCAGG + Intergenic
1089633075 11:119795543-119795565 CACACGTGCACACCAGCCTGCGG - Intergenic
1091587698 12:1825588-1825610 CACACATGCACACACGCACCTGG - Intronic
1095423733 12:42052486-42052508 CACAAGAGCTCACTCACATCAGG - Intergenic
1096347985 12:50867095-50867117 CACACTAGCTCACCAGCATTGGG + Intronic
1101943812 12:109120751-109120773 CACACGTGCACACCTGGAGCTGG + Intronic
1104652448 12:130545796-130545818 CACACGTTCTCACGTGCTTCTGG - Intronic
1105271122 13:18875792-18875814 CACACCTCCTCACCCGCCACTGG + Intergenic
1105478129 13:20747105-20747127 CACAGGTTATCACCCTCATCAGG + Intronic
1106161502 13:27204951-27204973 CCCCCGTGCCCACCCCCATCTGG - Intergenic
1107098522 13:36562294-36562316 CACACGTGCCCGGCCTCATCTGG + Intergenic
1114647683 14:24264576-24264598 CACATGTGCTCACACACGTCCGG - Intergenic
1114826911 14:26092016-26092038 CACATGTTCTCACCCACATGTGG + Intergenic
1118764044 14:68898426-68898448 CACACGTGCACACACACATTAGG + Intronic
1124202297 15:27688896-27688918 CACTAATGCTCACCAGCATCAGG + Intergenic
1132859078 16:2061218-2061240 CACACGGGCTCATCAGCATAGGG + Intronic
1132865799 16:2092134-2092156 CACACGTGCTCGGCCGCAGGAGG - Exonic
1136640160 16:31557367-31557389 CACTCCTGCTCACCTGGATCGGG + Intergenic
1139372726 16:66478909-66478931 CACGCGTGCTCGCCTGCCTCTGG - Intronic
1142241038 16:88945668-88945690 CTCACATCCTCACCGGCATCTGG - Intronic
1143409345 17:6699203-6699225 CACAGATGCTCACCTGCAGCAGG + Intronic
1143766383 17:9140507-9140529 CACACCTGCACACACACATCTGG - Intronic
1148441613 17:47714477-47714499 CTCACGTGCTCACCGGGCTCCGG - Intergenic
1152562271 17:81084484-81084506 CACGCGTCCTCATACGCATCCGG - Intronic
1158238188 18:55343861-55343883 CACGCGTGCACACACACATCCGG + Intronic
1159943657 18:74427545-74427567 CACACGTGCACACACACACCAGG - Intergenic
1161484222 19:4525994-4526016 CACATCTGCTCACCCACCTCTGG + Intronic
1161967755 19:7557876-7557898 CACACGTCCACACACACATCAGG + Intronic
1162561355 19:11419561-11419583 CACAGGAGCTCCCCCACATCTGG - Intergenic
1163714359 19:18865441-18865463 CACAGATGCTCACCTGCAGCAGG - Exonic
1165457963 19:35925866-35925888 CGCACCTGCTCACCTGCACCAGG - Intergenic
1166069703 19:40379845-40379867 AGCACATGCTCACCCTCATCAGG - Intronic
924995259 2:354955-354977 CACATGTTCTCACTCGCATGTGG - Intergenic
925738793 2:6987035-6987057 CACGCGTTCTGACCCCCATCCGG - Intronic
936267785 2:111023545-111023567 CACACGTCCCCACACCCATCCGG - Intronic
939491237 2:142879522-142879544 CACACGTACACACACACATCAGG + Intronic
939704189 2:145431621-145431643 CACACGTGCACACCGGCATATGG + Intergenic
946069985 2:217026042-217026064 CACACGTGCACACACACACCAGG + Intergenic
1169356686 20:4912809-4912831 CACAAGTGCTGCCCCGGATCTGG - Intronic
1170112668 20:12822500-12822522 CACACGTTCTCACCCGTAAGTGG - Intergenic
1170557117 20:17523757-17523779 CATACGTGCTCACGCGCAGAGGG + Intronic
1173150072 20:40559694-40559716 TCCACATGCTCACCAGCATCTGG + Intergenic
1174077187 20:47946039-47946061 GACACGTGCTCCCCAGCACCTGG - Intergenic
1175198148 20:57260333-57260355 CACACATGTCCACCTGCATCTGG + Intronic
1179805979 21:43837353-43837375 CCCACGTCCTCACCAGCATTTGG - Intergenic
1180669392 22:17541674-17541696 CACACGTGCTCACCCGCATCAGG - Intronic
1184646882 22:45900693-45900715 CCCACATGCTCACCAGCATCTGG - Intergenic
954106373 3:48411844-48411866 CACACTTGCACACCCTCACCAGG + Exonic
967854119 3:194103757-194103779 GGCACGTGCTCACCCGCTTCTGG - Intergenic
971959760 4:33470977-33470999 CACACTTGCTCACTCACACCTGG - Intergenic
980972087 4:139576371-139576393 AACACTTGCTCACCAGCAGCTGG - Intronic
983532838 4:168829603-168829625 CACACGTCCTAACTCTCATCTGG + Intronic
985127387 4:186708338-186708360 TACCCGTTCTCACCCTCATCAGG + Exonic
985552206 5:539483-539505 CACACGTGGACGGCCGCATCTGG + Intergenic
985654278 5:1121875-1121897 CACACTTGCACAACCCCATCAGG - Intergenic
997373785 5:133382655-133382677 CACCCATGCTCCCCAGCATCAGG - Intronic
998666957 5:144308436-144308458 AACACCTGCCCACCCGCCTCAGG - Intronic
1007829478 6:44627447-44627469 CACACGTGCACACATGCATATGG - Intergenic
1009765600 6:68070593-68070615 TCCACATGCTCACCAGCATCTGG - Intergenic
1016045096 6:139472949-139472971 CACACGTACACACCAGCATCTGG + Intergenic
1019310461 7:357929-357951 CACGCCTGCTTACCCGCTTCTGG + Intergenic
1019492207 7:1320887-1320909 CACACGTGCTTGCCTGCATGTGG + Intergenic
1021895510 7:25231415-25231437 CAATGGTGCTCACCCCCATCAGG - Intergenic
1023427692 7:40056449-40056471 AACATTTGCTCACCCGCCTCAGG + Intronic
1029557618 7:101281278-101281300 GACACGTGCTTACCCTCATGGGG + Intergenic
1030768404 7:113441350-113441372 CACACTTGCTCACCTGGATTAGG - Intergenic
1032277469 7:130472002-130472024 CACACGTTCTCACTCGTATGTGG + Intergenic
1035060051 7:156062452-156062474 CACACGTGGCCAGCCCCATCTGG - Intergenic
1040487163 8:47884327-47884349 CACACGTGCTGAGCCCCAGCAGG - Intronic
1043019283 8:74981314-74981336 CACAGATGCTGACCTGCATCCGG - Intergenic
1043546479 8:81321283-81321305 CACAAGTGCTCACCTGTATTTGG + Intergenic
1044287253 8:90423333-90423355 CACACGTTCTCACCCAAATAGGG - Intergenic
1049818581 8:144620589-144620611 CACACGTACTCACACGCACGTGG - Intergenic
1051248103 9:15132221-15132243 CAAAATTGCTCAACCGCATCTGG + Intergenic
1052305219 9:27001031-27001053 CACACATTCTCACCGGCATGTGG - Intronic
1188111671 X:26201157-26201179 CACACGTTCTCACTCACATGTGG - Intergenic
1189486573 X:41437600-41437622 CACAAATGCTCACCCTGATCAGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1197771966 X:130094918-130094940 CACAAGTGCTCACCCTGAGCTGG - Intronic