ID: 1180675069

View in Genome Browser
Species Human (GRCh38)
Location 22:17581214-17581236
Sequence CCTGGAGACTGGAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1010
Summary {0: 1, 1: 0, 2: 12, 3: 107, 4: 890}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180675069_1180675084 4 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675084 22:17581241-17581263 GCGCGTGAGCCTGGGGGCTGGGG 0: 1
1: 1
2: 3
3: 34
4: 500
1180675069_1180675087 19 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675087 22:17581256-17581278 GGCTGGGGATCTGATCAGCTGGG 0: 1
1: 0
2: 2
3: 16
4: 204
1180675069_1180675081 -2 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675081 22:17581235-17581257 GGCAGCGCGCGTGAGCCTGGGGG 0: 1
1: 0
2: 2
3: 16
4: 167
1180675069_1180675083 3 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675083 22:17581240-17581262 CGCGCGTGAGCCTGGGGGCTGGG 0: 1
1: 0
2: 4
3: 12
4: 143
1180675069_1180675079 -4 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675079 22:17581233-17581255 CAGGCAGCGCGCGTGAGCCTGGG 0: 1
1: 0
2: 2
3: 39
4: 766
1180675069_1180675080 -3 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675080 22:17581234-17581256 AGGCAGCGCGCGTGAGCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 127
1180675069_1180675086 18 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675086 22:17581255-17581277 GGGCTGGGGATCTGATCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 218
1180675069_1180675082 2 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675069_1180675078 -5 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675078 22:17581232-17581254 CCAGGCAGCGCGCGTGAGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180675069 Original CRISPR CCTGGAGACTGGAGGGAAGG GGG (reversed) Intronic
900150844 1:1178840-1178862 CCTGAAGAATGGAGGGTGGGAGG - Intronic
900284627 1:1893248-1893270 CCTGGACACTGGGGAGAGGGCGG - Intergenic
900511224 1:3062083-3062105 CCTGGGGACTGGGGTGAAGAGGG - Intergenic
900608164 1:3533032-3533054 AGTGGAGAGTGGAGAGAAGGTGG - Intronic
901210022 1:7519417-7519439 CCTGGAGCCTGGTGTGGAGGGGG + Intronic
901219607 1:7575906-7575928 CCTGGAGACGTCAGGGAGGGAGG + Intronic
901401302 1:9016817-9016839 CGTGGAGGGTGGAGGGAAAGAGG - Intronic
901804955 1:11732749-11732771 GCTGGAGACAGGAGGTCAGGAGG - Intergenic
902221892 1:14971634-14971656 CCTGGTGCCTCCAGGGAAGGGGG - Intronic
902283026 1:15388291-15388313 CCTGGGGAGGGAAGGGAAGGAGG - Intronic
902283041 1:15388324-15388346 CCTGGGGAGGGGAGGGAGGGAGG - Intronic
902416457 1:16242639-16242661 CCAGGTGACTGGATGGATGGTGG + Intergenic
902833097 1:19030165-19030187 TCTGGAGACAGAAGGGAAGGAGG + Intergenic
902837801 1:19058143-19058165 TCTGGAGACCTGAGGGAAGGGGG + Intergenic
903010296 1:20325064-20325086 CCTGGAAAGTGGAGGGAAAATGG - Intronic
903185056 1:21624177-21624199 CCTGTAGGGAGGAGGGAAGGAGG + Intronic
903211075 1:21818929-21818951 GCTGGAGTGTGGAGGGGAGGCGG - Intronic
903284389 1:22267914-22267936 CCTGGGGGCTGCAGGGGAGGGGG + Intergenic
903327424 1:22577447-22577469 CCTGTAGGGTGGAGGGAAGTGGG + Intronic
903670233 1:25031117-25031139 GATGGAGACTGGAGAGATGGAGG + Intergenic
903670245 1:25031163-25031185 GATGGAGACTGGAGGGATGGAGG + Intergenic
903670254 1:25031193-25031215 GATGGAGGCTGGAGGGATGGAGG + Intergenic
903670274 1:25031269-25031291 GATGGAGACTAGAGGGATGGAGG + Intergenic
903670325 1:25031469-25031491 GATGGAGGCTGGAGGGATGGAGG + Intergenic
904450250 1:30606357-30606379 CCTGGAGAAAGGAGGTGAGGAGG - Intergenic
904656734 1:32054362-32054384 CCTTCAGGCAGGAGGGAAGGCGG - Intronic
904773436 1:32893502-32893524 CCTGGGGGCGGGAGGGGAGGCGG - Exonic
905252544 1:36658885-36658907 GCAGGAGATTGGAGGGAGGGAGG + Intergenic
905446188 1:38029842-38029864 CCTGGAGCCTGGAAACAAGGTGG - Intergenic
905866509 1:41379771-41379793 CCAGGAGACTGGTGGGAAGGAGG + Intronic
906429319 1:45742213-45742235 ACTTGAGAGTGGAGGGTAGGAGG + Intronic
906714330 1:47955753-47955775 CCTGAAGCCTGGATGGGAGGGGG - Intronic
907405548 1:54251544-54251566 CATGGAAACAGGAGAGAAGGCGG + Intronic
907523506 1:55040184-55040206 CTTGGGGACTGCAGGCAAGGCGG + Intronic
907547385 1:55274175-55274197 TCTAGAGGCTGGGGGGAAGGTGG + Intergenic
907916262 1:58872718-58872740 CATGGAGAGGGCAGGGAAGGTGG - Intergenic
908128048 1:61050226-61050248 CCTGGAGAGGGGAGGGCAGGGGG - Intronic
908618616 1:65950691-65950713 CCTGGAGAAGGGAGGGAAAGTGG + Intronic
908720388 1:67119269-67119291 ATTGGAAACTGGAGGAAAGGTGG + Intronic
909596093 1:77407777-77407799 ACTAGAGAGGGGAGGGAAGGTGG - Intronic
909800141 1:79796680-79796702 GCTGGAGTATGTAGGGAAGGGGG + Intergenic
909812305 1:79945272-79945294 CATGGACACTGCAGGGAAGATGG + Intergenic
910337809 1:86154841-86154863 CCTGGAGACTCCAGGAGAGGCGG - Intronic
911154948 1:94628130-94628152 CCTGAAGATGGGAGGGAGGGTGG - Intergenic
911172544 1:94784505-94784527 CCTAGAAACTGGAAAGAAGGTGG + Intergenic
911900485 1:103497146-103497168 ACTTGAGAGTGGAGGGTAGGAGG + Intergenic
912432960 1:109639177-109639199 CCTGGAGTCAGGATGGAAGTTGG + Intergenic
912558759 1:110535286-110535308 CCTGCATGCTGGAGAGAAGGGGG - Intergenic
912563346 1:110566065-110566087 CATGGATACTGGAGGCATGGCGG + Intergenic
912727779 1:112074898-112074920 CCTTGAAGTTGGAGGGAAGGGGG - Intergenic
913171885 1:116240566-116240588 ACTTGTGACTGGTGGGAAGGAGG + Intergenic
913250649 1:116909986-116910008 GCTGGAGGAGGGAGGGAAGGAGG + Intergenic
913395792 1:118370404-118370426 CCTAGAGAGAGGAGGGAGGGAGG - Intergenic
914747220 1:150509516-150509538 CGTGAAGCCTGGAGGGAAGAAGG - Exonic
914801973 1:150968616-150968638 CCTGGAGGCTAGAGAAAAGGGGG - Intronic
914914075 1:151807520-151807542 CTTGTAGAGTGGAGGGAAAGCGG + Exonic
915310038 1:155002117-155002139 CCTGGAACCTGGAGAGGAGGGGG - Intergenic
915624980 1:157108976-157108998 CGAGGAGAGTGGAGGGTAGGGGG - Intergenic
916428768 1:164707697-164707719 CCAGGAGACTGGAGGGACAGTGG + Intronic
916446926 1:164881150-164881172 CCGGGAGTCTGGAGAGAAGTGGG + Intronic
916582095 1:166117983-166118005 GGTTCAGACTGGAGGGAAGGAGG + Intronic
917801585 1:178575758-178575780 CCTGAAGACAGGAGGGGATGTGG - Intergenic
918511349 1:185317098-185317120 CGTGGAGACTGAAAGGAAGGGGG + Exonic
918725682 1:187919684-187919706 ACTGGAGGATGGAGGGTAGGAGG - Intergenic
919712053 1:200738805-200738827 GCCGGAGACGGGAGGGAAGCGGG + Intergenic
920269205 1:204750711-204750733 TCTGGAGACCCCAGGGAAGGAGG - Intergenic
920304465 1:205009731-205009753 CCTGGAGACTCACGGGAAAGTGG - Intronic
920324536 1:205152570-205152592 CCTGGAGACAGGAAGGTTGGCGG - Intronic
920355855 1:205371891-205371913 GCTGGAGACTGTGGGGAATGGGG - Intergenic
920380323 1:205531322-205531344 CCTGGAGAATGGAGAAGAGGTGG - Exonic
920537924 1:206752413-206752435 CCTGGAGGGTGGAGGGTGGGAGG - Intergenic
920572041 1:207024709-207024731 CCTTGTCCCTGGAGGGAAGGAGG - Intronic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
921030622 1:211332459-211332481 CCTGGAGGATGGAGGGAGGTGGG + Intronic
921260298 1:213380321-213380343 ACTGGAGAATGGAGGGCGGGAGG + Intergenic
921327834 1:214005090-214005112 GGTGGGGACTGGAGGGAGGGAGG + Intronic
921331558 1:214043664-214043686 CCTGGGGACGGAGGGGAAGGAGG - Intergenic
921349737 1:214223289-214223311 CATGGAGAGTGGAAGGAGGGTGG - Intergenic
921354233 1:214270722-214270744 ACTTGAGAATGGAGGGTAGGAGG - Intergenic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
922327573 1:224543096-224543118 TCTGGAGAGGGGAGGGAAGCTGG + Intronic
922769547 1:228174677-228174699 CCTGGAGCCTGCAGGGAGAGAGG - Exonic
922856663 1:228780882-228780904 CCTGGAAAGAGGAGGGAAGGTGG + Intergenic
922996095 1:229962729-229962751 CCCACAGGCTGGAGGGAAGGCGG + Intergenic
923064145 1:230502815-230502837 ACTAGAGAATGGAGGGAGGGGGG - Intergenic
923241985 1:232095069-232095091 CCAGGAGGATGGAGAGAAGGAGG - Intergenic
923319838 1:232820287-232820309 GCAGGAGATTGGAGGGCAGGAGG + Intergenic
923457227 1:234174954-234174976 CCTGGGGACAGGAAGGGAGGTGG + Intronic
923498481 1:234544944-234544966 CCTGGCTGCTGGAGGAAAGGTGG + Intergenic
923560953 1:235041395-235041417 GCAGGAGACTGGAGGAAGGGAGG - Intergenic
924089208 1:240485560-240485582 GCTGGAGCATGGGGGGAAGGAGG - Intergenic
924463204 1:244277689-244277711 CCTTGAGAGTGGAGGGTGGGAGG - Intergenic
924839876 1:247697652-247697674 CTTGGGGACTGGGTGGAAGGGGG - Intergenic
1063625392 10:7684937-7684959 ACTAGAGGCAGGAGGGAAGGAGG + Intergenic
1063800663 10:9573554-9573576 TGTGAAAACTGGAGGGAAGGAGG + Intergenic
1063811616 10:9715720-9715742 ACTGGAGAGTGGAGGGTGGGAGG + Intergenic
1063883152 10:10551493-10551515 AGTGGAGACTGGGGGGGAGGGGG - Intergenic
1063954594 10:11254825-11254847 CTCGGAGACGAGAGGGAAGGAGG + Intronic
1064304309 10:14151727-14151749 CCTGGGGAAGGGAGGGAGGGAGG - Intronic
1064304566 10:14153677-14153699 GCTGGAGACGGGAGGGGAGCAGG - Intronic
1064326170 10:14353573-14353595 CCTGGAGATGGGATGGCAGGGGG + Intronic
1064728829 10:18308456-18308478 CCTGGAGAGCGGAGGGCGGGAGG - Intronic
1064872008 10:19947856-19947878 CCTAGACCCTGGAGGGAAGGAGG - Intronic
1064888038 10:20134733-20134755 CCTGGAGCCTGGAGCCATGGGGG + Intronic
1064909354 10:20383572-20383594 ATTGGAAACTGGAGGAAAGGCGG + Intergenic
1065115238 10:22477532-22477554 CCTGCAGACTGGAGAGACGTGGG - Intergenic
1065210331 10:23396413-23396435 CCTGCAGGCTGGAGGGCTGGGGG + Intergenic
1065753766 10:28912254-28912276 CCTGGAGCCTGGTGGAGAGGAGG + Intergenic
1065772021 10:29086433-29086455 CCTGAAGTCTGCAGTGAAGGAGG - Intergenic
1065862683 10:29885101-29885123 ACTGGAGGGTGGAGGGCAGGAGG - Intergenic
1067058026 10:43063675-43063697 GCTGCTGACTGGTGGGAAGGTGG - Intergenic
1067097964 10:43314826-43314848 CCTGGCAACTGGTGGGGAGGAGG + Intergenic
1067558750 10:47289805-47289827 TCTAGAGACTGGTGGGAAGGAGG - Intergenic
1067806312 10:49395639-49395661 GCGGGGGACAGGAGGGAAGGCGG + Intronic
1067844768 10:49710868-49710890 CCTGGGGAATGGGGAGAAGGAGG - Intergenic
1068362555 10:55997112-55997134 CCTGGAGGGTGGAGCGAATGTGG - Intergenic
1068740621 10:60465214-60465236 GCTGGAGACTGGAGTGCAGTGGG - Intronic
1069964379 10:72101981-72102003 CCTTGAGGGTGGAGGGAGGGAGG + Intronic
1070197994 10:74176685-74176707 CGTGCTGATTGGAGGGAAGGCGG - Intronic
1070282425 10:75059391-75059413 AAAGGAGACTGGAGAGAAGGAGG + Intergenic
1070640147 10:78162584-78162606 CCTGGAGATTAGAGAGGAGGGGG + Intergenic
1070666694 10:78350147-78350169 TCTGGAGACTGTAGGTGAGGAGG + Intergenic
1070760507 10:79021437-79021459 ACTGGAGGCTGCAGGGAAGGTGG + Intergenic
1070834857 10:79441868-79441890 CCTGGAGGCTGGAGGGTACAGGG + Intronic
1071405652 10:85328702-85328724 CCTGGAAACTGGAGGGGATTTGG - Intergenic
1071500630 10:86201531-86201553 GGTGGAGAGTGGAGGGTAGGAGG + Intronic
1072690211 10:97567830-97567852 CCTGGGGAGGGGAGGGGAGGGGG + Intronic
1072737511 10:97889113-97889135 AGTGGAGGCGGGAGGGAAGGGGG + Intronic
1073146674 10:101285913-101285935 CCTGGGGCCTGGGGGGAGGGAGG - Intergenic
1073432121 10:103493757-103493779 CCTGGAGACTGCCGGGGCGGGGG + Intergenic
1073481632 10:103789584-103789606 ACTGGAGAATGAAGGGAAGGGGG - Intronic
1073538835 10:104301551-104301573 CCTGGAGAAAAGAGGGAAGGAGG + Intronic
1073568400 10:104555333-104555355 ACTGGAAGCTGGAGGGCAGGAGG - Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074182383 10:111076540-111076562 CCTGGAGGCTGGGGAGAAAGGGG - Intergenic
1076379730 10:130016678-130016700 ACTGGAGTCTGGAGGCAACGTGG + Intergenic
1076463946 10:130665712-130665734 CCTGAAGGCTGGTGGGGAGGAGG + Intergenic
1076740028 10:132478420-132478442 CCAGGAGACTGGACAGCAGGAGG - Intergenic
1077199723 11:1299906-1299928 CATGGAGACTCGGGGGACGGAGG + Intronic
1077246586 11:1542249-1542271 CCTGGCCTCTGGAGGGGAGGCGG - Intergenic
1077442457 11:2575001-2575023 CCGGGAGGCTGGTGGCAAGGTGG + Intronic
1078354439 11:10623585-10623607 CCTGGGGGCTGGTTGGAAGGAGG + Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078581735 11:12544195-12544217 GCAGGAGACTGGAGGGCGGGAGG - Intergenic
1078636977 11:13060738-13060760 CATGGAGAAGGGCGGGAAGGAGG + Intergenic
1078759667 11:14242173-14242195 CATGGAAACTGAAAGGAAGGAGG - Intronic
1079176740 11:18148972-18148994 GCAGGAGACTGGAGGGCAGGAGG - Intronic
1081354926 11:42101046-42101068 TTTGGAGAGTGGAGGGTAGGAGG - Intergenic
1081989768 11:47331670-47331692 CCAGGAGCCTGGAGGGAAGTTGG - Exonic
1082205362 11:49427165-49427187 GATGGAGACGTGAGGGAAGGAGG - Intergenic
1082661670 11:55919985-55920007 CCTGAAGACTGGGGGCCAGGTGG + Intergenic
1082702718 11:56453089-56453111 CCTTGAGAATGGAGGGTGGGAGG + Intergenic
1082957935 11:58891595-58891617 CCTAGAGGGTGGAGGGAAAGGGG - Intronic
1083335600 11:61920006-61920028 CCTGGGGCATGGAGGGGAGGGGG - Intronic
1083340713 11:61956822-61956844 CCTGCAGAGTGGAGTGAAGAAGG - Exonic
1083442899 11:62688506-62688528 CATGGAGACTGGAAGGGAAGGGG + Exonic
1083476015 11:62916166-62916188 CCTGGGGTCTGGAGGGGAAGCGG - Intronic
1083759089 11:64806108-64806130 CCTAGGGACTGGATGGAAAGGGG + Intronic
1083899852 11:65638309-65638331 GCTGGAGCCCGGAGGGAAGTTGG - Intronic
1084036099 11:66511258-66511280 CCAGGAGAGTTGAGGGTAGGGGG + Intronic
1084510969 11:69603494-69603516 TCTGAAGACAGGAGGGCAGGGGG + Intergenic
1084582278 11:70031606-70031628 CCAAGAGACTGGTGGGAGGGAGG + Intergenic
1084609289 11:70191907-70191929 CATGGAGACAGGAGGGCAGAGGG - Intergenic
1084650444 11:70486495-70486517 CCTGGTGACCGTAGGGAAGCCGG + Intronic
1085315021 11:75539592-75539614 CTGGGAGATTGGAGGGCAGGGGG + Intergenic
1085341140 11:75732355-75732377 ACTAGAAGCTGGAGGGAAGGAGG + Intronic
1085342935 11:75745193-75745215 CCTGGGGCCTGCAGGGGAGGTGG - Intergenic
1085516703 11:77115966-77115988 GCTGCAGACTGGGGGGAAGGGGG - Intronic
1086154416 11:83649746-83649768 ACAGGAGATTGGAGGGTAGGAGG + Intronic
1086319216 11:85627871-85627893 CATGGAGACTGGAGGGTCGGGGG + Intronic
1086875367 11:92089325-92089347 CCTGGAGACAGGAGGGAGCATGG + Intergenic
1087121729 11:94582042-94582064 CCTGGGGACTGGAGGGTCTGAGG + Intronic
1087417770 11:97879877-97879899 CCTGGAGGTTGGAGGGCAGGAGG - Intergenic
1087974213 11:104524498-104524520 CCTGGTGACTGGACAGAAGCTGG - Intergenic
1088828932 11:113518809-113518831 CTTGGAGAATGGAGGGCAGCTGG - Intergenic
1089402660 11:118173278-118173300 CATGGAGAAGGGAAGGAAGGTGG - Intronic
1089529232 11:119115954-119115976 GATGGAGAATGGAGGGAAAGAGG - Intronic
1089558481 11:119330006-119330028 CCAGGAGTCTGGGGGGAAGGAGG + Intergenic
1089630246 11:119779847-119779869 CCTGGAGTCTGGAGGGGACTTGG - Intergenic
1089654034 11:119934204-119934226 GCTGGAGAATGGATGGAGGGAGG - Intergenic
1089681151 11:120119712-120119734 CATGGAGACTGGAGGGTCAGGGG - Intronic
1090172776 11:124619274-124619296 CCTGGGCAGTGGAAGGAAGGAGG - Exonic
1090268838 11:125371537-125371559 GAAGGAGACTGGAGGGGAGGAGG - Intronic
1090315031 11:125778693-125778715 CCTGGAGACAGAGGGGAAGCTGG - Intronic
1090729105 11:129554421-129554443 ATTGGAAACTGGAGGGAAGATGG + Intergenic
1090826605 11:130391584-130391606 CTTGGGGACTGGAGAGAAAGCGG + Intergenic
1090878489 11:130812796-130812818 GCAGGAGACTGGAGGGCAGGAGG - Intergenic
1091317057 11:134621870-134621892 CCAGGAGCATGGAGGGATGGAGG + Intergenic
1091821733 12:3480570-3480592 ACTGGAGACCTCAGGGAAGGTGG - Intronic
1092083419 12:5736540-5736562 CTTGGGCACTGGAGGGAGGGAGG - Intronic
1092104148 12:5909030-5909052 CCTGGAGACTGGTGGGAGCTAGG + Intronic
1092507441 12:9118315-9118337 TCTGGTGACTGGAGGGCAAGTGG + Intergenic
1094257110 12:28444674-28444696 ACTTGAGAGTGGAGGGTAGGAGG + Intronic
1096154875 12:49336307-49336329 CTTGGCGCCTGGCGGGAAGGGGG + Exonic
1096501947 12:52069660-52069682 CATAGAGACTGGAGGGAAGGAGG - Intronic
1096547255 12:52348565-52348587 CCTGAAGATAGGAGGGAAGCAGG - Intergenic
1096595604 12:52693092-52693114 CCCAGAGACTGGTGGGAATGCGG - Intronic
1096803278 12:54125913-54125935 CCTGGGTACCGGAGGGAGGGAGG - Intergenic
1097053894 12:56238926-56238948 GGTGGAGAAGGGAGGGAAGGCGG + Exonic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097242127 12:57582714-57582736 CCTGGAGCCTTTGGGGAAGGGGG + Intronic
1097365776 12:58710376-58710398 CATTGAGACTGGTCGGAAGGTGG - Intronic
1097872117 12:64610451-64610473 CCTGGAGCCTGGCGGGGAGGCGG + Intergenic
1097998481 12:65915943-65915965 CCAGGGTACTGGAGGGAAAGGGG + Intronic
1099313294 12:81054404-81054426 TTTGGAGAGTGGAGGGTAGGAGG + Intronic
1099653182 12:85456124-85456146 CCTGGATACTTGAGGTAAGAGGG - Intergenic
1099908360 12:88799166-88799188 CATGAAGAAGGGAGGGAAGGAGG + Intergenic
1100544999 12:95593251-95593273 CCTGCAGATTGGAGGAAAGATGG - Intergenic
1100914550 12:99404168-99404190 ATTGGAGAGTGGAGGGTAGGAGG + Intronic
1100983819 12:100186342-100186364 CTTGTAGTCTGGAGGGAGGGAGG - Intergenic
1101242008 12:102848308-102848330 CCAGGAGACTGGAGAGGTGGAGG + Intronic
1101242035 12:102848448-102848470 CCAGGAGACTGGAGAGGTGGAGG + Intronic
1101242049 12:102848518-102848540 CCAGGAGACTGGAGAGGTGGAGG + Intronic
1101242112 12:102848867-102848889 CCAGGAGACTGGAGAGGTGGAGG + Intronic
1101345335 12:103880941-103880963 GCAGGGGAGTGGAGGGAAGGGGG - Intergenic
1101495706 12:105252152-105252174 GCTGGAGGGAGGAGGGAAGGGGG + Intronic
1101638277 12:106565786-106565808 CCTGGGCAATGGAGGGAGGGAGG + Intronic
1101682488 12:106983314-106983336 ACTGGTGTCTGGAGGGAAGAGGG - Intronic
1102145996 12:110655543-110655565 CCAGGAGGGTGGCGGGAAGGAGG - Intronic
1102422501 12:112815093-112815115 GCAGGAGACTGGAGGGAGGGAGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102735257 12:115153499-115153521 ACTGGAGAGTGGAGAGAGGGAGG + Intergenic
1102884521 12:116511483-116511505 TCTGAAGCCTGGAGGCAAGGAGG - Intergenic
1103057887 12:117835938-117835960 TCTGGAGGCTGTAGGGTAGGCGG - Intronic
1103436257 12:120929271-120929293 TCTGGAGATTGGAGAGAAGGGGG - Intergenic
1103911882 12:124356492-124356514 CCTGGTCAGTGGAGGGAAAGGGG - Intronic
1104029453 12:125053859-125053881 CCTGGGGGCTGGAGAGGAGGTGG + Intergenic
1104122014 12:125808715-125808737 CCTGGTGTCTGGAGGCAAGACGG + Intergenic
1104136045 12:125939925-125939947 TCTGGAGACTGGGGGAAGGGAGG - Intergenic
1104268946 12:127264736-127264758 ACTTGTGACTGGTGGGAAGGAGG - Intergenic
1104310322 12:127648997-127649019 CCTGGTGCCTGGAGGGGAGAGGG - Intergenic
1104323581 12:127774625-127774647 CCTGGCGTGTGGAGGGAAGACGG - Intergenic
1104554544 12:129787853-129787875 GCTGGATCCTGCAGGGAAGGAGG + Intronic
1104737722 12:131148356-131148378 ACTTGAGAGTGGAGGGAGGGAGG - Intergenic
1104756991 12:131275634-131275656 CCTGGAGGCTGGAGGCTGGGTGG - Intergenic
1104790791 12:131480783-131480805 CCCAGAGACTCGTGGGAAGGGGG + Intergenic
1105805860 13:23951274-23951296 CCACGAGAATGCAGGGAAGGAGG - Intergenic
1105821740 13:24086558-24086580 CTTGGGGACTGGCGAGAAGGTGG + Intronic
1106396229 13:29383632-29383654 CCTGCAAAAGGGAGGGAAGGTGG - Intronic
1107024483 13:35785536-35785558 GCTGGAGAATGGAGAGAAAGGGG + Intronic
1107359394 13:39602901-39602923 CCGGGACGCGGGAGGGAAGGTGG - Exonic
1107429888 13:40330913-40330935 CCTGGACAAGGGAGGGAAAGGGG + Intergenic
1107433647 13:40362584-40362606 GTTGGAGGCAGGAGGGAAGGTGG - Intergenic
1107461610 13:40608904-40608926 CCTAGAGATAGGTGGGAAGGGGG + Intronic
1107541566 13:41393926-41393948 CCTGGACAAGGGAGGGAAAGGGG - Intergenic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1107997572 13:45875968-45875990 CCTGGACAAGGGAGGGAAAGGGG + Intergenic
1108321055 13:49290997-49291019 TCTGGGGACTGGAAGGAAGACGG - Intronic
1108555310 13:51585121-51585143 CCTGAGGACAGGAGGGAAAGAGG + Intronic
1110050887 13:70897712-70897734 ACTTGAGAATGGAGGGTAGGAGG - Intergenic
1110811273 13:79813010-79813032 TCTGGAGATAGGAGGGATGGGGG - Intergenic
1111193538 13:84841134-84841156 CCTGGCAACTGGAAGCAAGGTGG - Intergenic
1112589547 13:100750727-100750749 GCAGGAGACTGGAGGTAAGTGGG - Intergenic
1113377860 13:109782002-109782024 CTTGGCGTCTGGCGGGAAGGAGG - Intronic
1113524660 13:110965688-110965710 CCTGGACAAAGGAGGGAAAGGGG - Intergenic
1113680985 13:112244965-112244987 CCTGAAGCATGGAGGGAAAGAGG - Intergenic
1114402269 14:22420844-22420866 TCAGGAGACTGGAGGGAAGGAGG - Intergenic
1114674420 14:24430947-24430969 CTTGGTGCCTGGAGGGATGGGGG - Intronic
1114731755 14:25000495-25000517 CCAGAAGACAGGAGGGCAGGAGG - Intronic
1115044225 14:28970925-28970947 TTTGGAGATTGGAGGGTAGGAGG - Intergenic
1115521253 14:34235034-34235056 GCCGGAGACTGGAGGAAGGGAGG - Intronic
1116395370 14:44442316-44442338 ACTGGAAGCGGGAGGGAAGGAGG + Intergenic
1116931665 14:50696889-50696911 CCTTGAGAGTGGAGGGTGGGAGG - Intergenic
1117092351 14:52263926-52263948 TCTGTAGAAAGGAGGGAAGGAGG - Intergenic
1118312383 14:64703684-64703706 CCTGGAAACTGGGGGGCAAGGGG - Intergenic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1118724726 14:68621002-68621024 AATGGAGACTGGAGGGGACGGGG + Intronic
1118812297 14:69284253-69284275 TCTGGAGTCTGGAGGGTAGCAGG - Intronic
1118935028 14:70279861-70279883 CCTTGAGAGTGGGGGGAGGGAGG + Intergenic
1119735032 14:76976312-76976334 GCTGGAGACTGGAGATCAGGTGG - Intergenic
1119749622 14:77068155-77068177 TCTGGAGAAGGGTGGGAAGGAGG - Intergenic
1120395726 14:83964737-83964759 CCTGGACAAGGGAGGGAAAGGGG - Intergenic
1121414462 14:93769622-93769644 CCTGTCGCCTGCAGGGAAGGCGG + Intronic
1122114919 14:99522828-99522850 CCTGCACACAGGAGGGAGGGAGG + Intronic
1122233932 14:100321638-100321660 CATAGAGTCTGGAAGGAAGGAGG - Intergenic
1122271229 14:100569146-100569168 CCTGAAAGCTGGGGGGAAGGGGG + Intronic
1122299201 14:100722526-100722548 CATGGAGCCTGGAGGAAAGTGGG - Intergenic
1122382179 14:101316152-101316174 CCTGGATAAGGGAGGGAAAGGGG - Intergenic
1122693033 14:103540246-103540268 CCTGGAGGCTTGGGGAAAGGGGG - Intergenic
1122891218 14:104733146-104733168 CCTGGTGGCAGGAGGGAGGGTGG - Intronic
1122970501 14:105150291-105150313 CCTCGGGACTGGAGGGCAGGGGG - Intronic
1122977813 14:105178184-105178206 GGTGGAGACGGGAGGGCAGGAGG + Intronic
1124411511 15:29441300-29441322 CCTGGGGAGAGGAGGGAATGTGG + Intronic
1124786342 15:32684401-32684423 ACTGGATCCTAGAGGGAAGGTGG + Intronic
1125828415 15:42694357-42694379 CCTGGAGTCGGGAGGGGAAGGGG + Intronic
1126087432 15:45023182-45023204 CCAGGGCACTGGATGGAAGGTGG - Exonic
1126299157 15:47175694-47175716 ACTGGAGGGTGGTGGGAAGGAGG - Intergenic
1126426461 15:48531788-48531810 CCTGGAGACTGGTGTGAACAGGG - Intronic
1127022856 15:54769422-54769444 ACTTGAGGGTGGAGGGAAGGAGG + Intergenic
1127361802 15:58251016-58251038 CCTGGAAACTTGGAGGAAGGTGG + Intronic
1127474864 15:59323749-59323771 CCAGCACACTGGAGGGGAGGAGG + Intronic
1127668352 15:61171083-61171105 CCTGGAGCCTGGAAAGAGGGCGG - Intronic
1127889646 15:63238303-63238325 ACTGGAGACTAGAAAGAAGGAGG - Intronic
1128082035 15:64862434-64862456 CCTGGAGACTGGGAGCATGGAGG + Intronic
1128084363 15:64875627-64875649 GGTGGAGACTGGAGGCAGGGAGG + Intronic
1128119437 15:65134704-65134726 CATGGAGGCTGGGGCGAAGGCGG - Intergenic
1128161389 15:65424925-65424947 TCTTGAGGCTGGAGGGGAGGAGG - Intergenic
1128507815 15:68289216-68289238 CCTGGAGGCTACTGGGAAGGAGG + Intronic
1128738048 15:70064700-70064722 CCTGGGGACTAGAGGGGTGGGGG - Intronic
1128772314 15:70291614-70291636 CCTGGAGCCTGGATTTAAGGTGG + Intergenic
1129069602 15:72939699-72939721 CCTGCACACTGGAGGGTAAGTGG + Intergenic
1129186363 15:73909530-73909552 CCTGGGAAGTGGAGGGAAGGTGG + Intergenic
1129257651 15:74343174-74343196 CCTGCAGGCGGGTGGGAAGGAGG + Intronic
1129700175 15:77763303-77763325 CCTGGGGCCTGGAGAGGAGGAGG + Intronic
1129732685 15:77941004-77941026 CCTGTAGCATGGAGGGCAGGAGG - Intergenic
1130017219 15:80196825-80196847 ACAGGAGATTGGAGGGCAGGAGG + Intergenic
1130044040 15:80430330-80430352 TCTGGAGTCTGGAGGAAAAGTGG - Intronic
1130993634 15:88891868-88891890 CCTGGAACCAGGAGGGAAGTGGG + Intronic
1131015023 15:89050820-89050842 CCAGGAGACTGAGGGAAAGGAGG + Intergenic
1131150060 15:90042224-90042246 CAAGGAGGCTGGAGAGAAGGGGG - Intronic
1131531281 15:93194816-93194838 CCTGGAGGGTGGAGGGTGGGAGG - Intergenic
1132736453 16:1388391-1388413 CCTGCAGACAGGCGGGAAGGAGG - Intronic
1132769497 16:1553395-1553417 CCTGGGGAATGCAGGGGAGGCGG + Intronic
1132871527 16:2117672-2117694 GCTGGAGACCGGTGGGAACGAGG + Exonic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133110208 16:3543501-3543523 CCTGGAGACTGGGGCGGAGAGGG + Exonic
1133280861 16:4664559-4664581 CCTCGAGATGGCAGGGAAGGCGG - Intronic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133545803 16:6805384-6805406 CCTGGAGGATAGAGGGTAGGAGG + Intronic
1133765011 16:8831919-8831941 CCTGGAGAAGGGAGGGAAGGGGG - Intronic
1134521002 16:14919223-14919245 GCTGGAGACCGGTGGGAACGAGG - Intronic
1134550570 16:15136750-15136772 GCTGGAGACCGGTGGGAATGAGG + Intronic
1134597969 16:15511029-15511051 GCTTGAGAAAGGAGGGAAGGAGG - Intronic
1134708678 16:16317874-16317896 GCTGGAGACCGGTGGGAACGAGG - Intergenic
1134715891 16:16357907-16357929 GCTGGAGACCGGTGGGAACGAGG - Intergenic
1134958865 16:18394252-18394274 GCTGGAGACCGGTGGGAACGAGG + Intergenic
1135471351 16:22734308-22734330 GATGGAGACAGGAGGTAAGGGGG + Intergenic
1135740320 16:24969713-24969735 CTTCCAGGCTGGAGGGAAGGAGG + Intronic
1135861368 16:26058947-26058969 CCTGGGGGCTGGGAGGAAGGTGG + Intronic
1135883608 16:26283294-26283316 GCTGGAGAGTGGAGGAAATGGGG - Intergenic
1135889585 16:26345176-26345198 CCTGGAGACTGGAGGGAACATGG + Intergenic
1136140070 16:28282670-28282692 CCTGGAGCTTGGAGGGAAAGGGG + Intergenic
1136477791 16:30524342-30524364 CCTGGAGACTTGTGGGAAGTGGG - Exonic
1136503723 16:30688986-30689008 CCAGGAGACTGCAGGGGAAGGGG - Intergenic
1136593020 16:31229074-31229096 CATGGTGTCTGGAGGGATGGTGG + Intergenic
1137523891 16:49216814-49216836 CCAGGAGCCTGAAGAGAAGGAGG + Intergenic
1137852606 16:51761774-51761796 TCTGGCTACTGGGGGGAAGGGGG - Intergenic
1137858123 16:51817345-51817367 ACTTGAGGATGGAGGGAAGGAGG - Intergenic
1137904211 16:52302763-52302785 CCTGGAGGGTGGAGGGTAGGAGG - Intergenic
1138085608 16:54131279-54131301 GAAGGAGGCTGGAGGGAAGGAGG + Intergenic
1138444475 16:57054887-57054909 CCTGGAGTCTGGTGGGTATGAGG + Intronic
1138695551 16:58809607-58809629 CCTGGAGAACAGATGGAAGGAGG - Intergenic
1139613463 16:68075130-68075152 CGTGGACACTGGAGGGAGGCTGG - Intronic
1139956256 16:70694428-70694450 CCTGGAGACAGAAGAGCAGGGGG - Intronic
1139967165 16:70752169-70752191 GCTGGACACTGAAGGAAAGGTGG - Intronic
1140113279 16:72021360-72021382 CCTGGAGAATGAAGGGGAGCAGG - Intronic
1140985657 16:80156007-80156029 CCTGGAGAGGGGAGGGGAAGGGG + Intergenic
1141152207 16:81572096-81572118 CCGGGAGACAGGAGGGAAATGGG - Intronic
1141213452 16:82002143-82002165 TGTGGAGACAGGAGGGAAGCGGG + Intronic
1141443696 16:84045067-84045089 ACTGGACACAGCAGGGAAGGAGG + Intergenic
1141614792 16:85204131-85204153 GCTGGAGACTGAGGGGAACGGGG - Intergenic
1141762698 16:86039062-86039084 GCAGGAGCCTGGAGGGAAGGGGG + Intergenic
1141815669 16:86407976-86407998 CAGGGAAACTGCAGGGAAGGTGG + Intergenic
1141881715 16:86864579-86864601 CCTGGAGGGTGGAGGGAGGGAGG - Intergenic
1141904705 16:87016705-87016727 GCTGGCGATAGGAGGGAAGGTGG + Intergenic
1141916619 16:87101866-87101888 TCTGGAGGATGGAGTGAAGGTGG - Intronic
1142176501 16:88647810-88647832 CCTGGTGAGTGGTGGGCAGGGGG - Intronic
1142247555 16:88976879-88976901 CCTGCAGCCTTGAGGGAAAGAGG + Exonic
1142742512 17:1939533-1939555 CCTGGAGGCTGGAGTGAGGTGGG - Intronic
1143095230 17:4475330-4475352 GCTGGTGTCTGGAGGGATGGTGG + Intronic
1143199595 17:5103082-5103104 GCTGGAGTCTAGAGGGAGGGTGG + Intergenic
1143405248 17:6673113-6673135 CCTGGGGACTGGAGTGGGGGAGG + Intergenic
1143538868 17:7558012-7558034 CCTGGGGGCTGGAGGCATGGAGG - Intronic
1143628686 17:8125008-8125030 CCTGGTGACTGTAGGGTAGCAGG + Intergenic
1143916185 17:10295083-10295105 CCTGGAGACAGAAGGGTTGGGGG + Intergenic
1144040268 17:11404349-11404371 ACTGAAGACTGGAGTGAGGGGGG + Intronic
1144070723 17:11669140-11669162 TCTGGAGTCTGGAGTGAAGGGGG + Exonic
1144378360 17:14668007-14668029 GCTGAAGACTGGAGTGAAGATGG + Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144775834 17:17784172-17784194 CCTGGGGACTGGGGGGAGGGAGG + Intronic
1144792299 17:17867209-17867231 CCTGGGCCCTGGAGGGAGGGTGG + Intronic
1144810347 17:17994782-17994804 GGTGGAGACTGGTGGGAAAGAGG - Intronic
1146250615 17:31339905-31339927 CCAGGACAATGGAGGGAAGGTGG + Intronic
1146401242 17:32501625-32501647 CATGGAGGCTGACGGGAAGGCGG + Intronic
1146528235 17:33585061-33585083 TCTCTAGGCTGGAGGGAAGGAGG - Intronic
1146532175 17:33617494-33617516 ACTGGAGGGTGGAGGGAGGGAGG + Intronic
1146570736 17:33950511-33950533 TCTGAATACTGAAGGGAAGGTGG + Intronic
1146809776 17:35893968-35893990 ACTCGTGACTGGTGGGAAGGAGG - Intergenic
1147412683 17:40264933-40264955 CCAGGAGGCTGGCGGTAAGGCGG - Exonic
1147484724 17:40801630-40801652 GCAGGAGACAGGAGGGAAGTGGG + Intergenic
1147996123 17:44361351-44361373 CCAGGAGACAGGTGGGAAGTGGG + Intronic
1148060088 17:44830189-44830211 GCTGGAGACTGAGGCGAAGGCGG - Intronic
1148157569 17:45432504-45432526 TCTGGGGGCTGGAGGGAAGCAGG - Intronic
1148461401 17:47841000-47841022 CCTGGAGCCTGGGGAGAGGGTGG - Intronic
1148554611 17:48570748-48570770 CCTGGACTCTGTAGGGGAGGTGG + Intronic
1148695727 17:49556884-49556906 CCTGCAGTCTGGGTGGAAGGTGG - Intergenic
1148797536 17:50204206-50204228 GCTGCAGACTGGGGGGATGGGGG + Intergenic
1148860955 17:50604133-50604155 CCTGGGGAGGGGAGGGAGGGAGG - Exonic
1148876300 17:50689462-50689484 CCTAGAAACTAGAGGGGAGGAGG + Intronic
1150212834 17:63450808-63450830 TCTGGAGTGTGGGGGGAAGGAGG + Intergenic
1150631268 17:66882034-66882056 GCTGGGGAATGGAGGGAGGGAGG + Intronic
1151124464 17:71829992-71830014 CCTGGATACTGGGGGAAAGATGG - Intergenic
1151705095 17:75763267-75763289 CCTGGAGACCTCAGGGAAGGAGG + Intronic
1152362751 17:79839979-79840001 CCCGGAGCCTGGAGGCGAGGCGG - Intergenic
1152419175 17:80182888-80182910 ACTGCAGCCTGGAGGGAAGGGGG - Intronic
1152421082 17:80193570-80193592 CCGGGAGCCGGGAGGGAGGGAGG + Intronic
1152425580 17:80216901-80216923 CCTGGAGGTGGGAGGGAAAGTGG + Intronic
1152562802 17:81086935-81086957 GCTGGCCACTCGAGGGAAGGTGG + Intronic
1152626627 17:81390645-81390667 CCTGGTGCCTGGAGGGAACAGGG - Intergenic
1152636556 17:81432757-81432779 CCTGGGGATGGGAGGGAGGGTGG - Intronic
1152739897 17:82014294-82014316 CCTGGTGGGTGGAAGGAAGGGGG - Intronic
1152844034 17:82588390-82588412 GCTGGCGATTGGAGGGCAGGCGG + Intronic
1153450230 18:5219051-5219073 ACTGGAGAGTGGAGGGTGGGAGG - Intergenic
1153680232 18:7493549-7493571 GCTAAATACTGGAGGGAAGGGGG + Intergenic
1153835687 18:8962201-8962223 CCTGAAGTCAGGAGGAAAGGAGG + Intergenic
1155160231 18:23189617-23189639 CCCGGGGACTGCAGGGCAGGCGG + Intronic
1155479820 18:26273190-26273212 CCTGGAGACTTGAGGGAGGGAGG + Intronic
1156455214 18:37289413-37289435 CCTGGAGACTTGTGGGTGGGAGG - Intronic
1156512790 18:37655294-37655316 CCTGGAGGCTGGAAGGATAGGGG - Intergenic
1157014379 18:43693071-43693093 CATAGAGACTGGAAGTAAGGGGG + Intergenic
1157052529 18:44183985-44184007 ACTGGAGGTTGGAGGGAGGGAGG + Intergenic
1157099431 18:44716012-44716034 CCAGGAGAAGGGAGGGAAGGTGG - Intronic
1157193999 18:45605604-45605626 CCTTGAAACTGGAGAGAAGTGGG + Intronic
1157492881 18:48136509-48136531 CTTGGGGACGGGAGGGAGGGGGG - Intronic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1158012684 18:52747517-52747539 CCTGGAAAATGCATGGAAGGAGG - Intronic
1158095868 18:53770080-53770102 ACTGGAGGCTGGAGGGTGGGAGG + Intergenic
1158197652 18:54906529-54906551 CTTGGACCCTGGAGGGAATGGGG - Intronic
1158532653 18:58277370-58277392 CCTGGGGGCAGGAGGGAGGGTGG + Intronic
1158750809 18:60257967-60257989 ACTAGACAGTGGAGGGAAGGAGG + Intergenic
1158903378 18:61987112-61987134 CCTGAAGACTGGAGGAAGTGAGG + Intergenic
1159143274 18:64422708-64422730 ACTGGAGAGTGGAGGGTGGGAGG - Intergenic
1159174456 18:64815051-64815073 CCTGCAGACTGGAGGGCAAATGG + Intergenic
1159440402 18:68471564-68471586 GCTGGAGACTGGAGTGGAGTAGG - Intergenic
1160088960 18:75808114-75808136 CTGGGAGACTGGTGGCAAGGTGG - Intergenic
1160328016 18:77968321-77968343 CCTGGACAGTGGAGGAAATGAGG + Intergenic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1160607978 18:80066495-80066517 CCTGGAGACGGGAGTGAATGGGG + Intronic
1161329080 19:3677925-3677947 GATGGAGAATGGAGGGATGGAGG + Intronic
1161329333 19:3678795-3678817 GATGGAGAATGGAGGGATGGAGG + Intronic
1161329380 19:3678941-3678963 GATGGAGAATGGAGGGATGGAGG + Intronic
1161388693 19:4010195-4010217 CCTTGACACTGGAGGGAGTGCGG - Intronic
1161544381 19:4871111-4871133 GCTTGAGACTGGAGGGGTGGAGG + Intergenic
1161838610 19:6665003-6665025 CCTGGAGGCTGGGGAGAAGGTGG - Exonic
1161945585 19:7434434-7434456 CCTGGAGGATGGATGGAAAGAGG - Intronic
1161950287 19:7463968-7463990 CCTGGAGGCAGGAGGGGAGACGG - Intronic
1161995220 19:7707586-7707608 CCTGGGGCCTTGAGGGGAGGGGG - Intergenic
1162082194 19:8224879-8224901 CCTGAAGACTGGGTGGAGGGTGG + Intronic
1162267507 19:9587904-9587926 CCTGGACAAGGGAGGGAAAGGGG + Intergenic
1162337866 19:10072832-10072854 CCTGGGGGCTGAAGGGAGGGAGG + Intergenic
1162372509 19:10287857-10287879 CCTGGGGACTAGGAGGAAGGGGG + Intronic
1162589835 19:11584221-11584243 CTTGGGGGCTGCAGGGAAGGGGG + Intronic
1162761516 19:12891408-12891430 TCGGGAGTGTGGAGGGAAGGAGG + Intronic
1162820023 19:13217278-13217300 GCTGGAGACTGGGAGAAAGGGGG - Intronic
1162821955 19:13228470-13228492 GCTGAAGGCTGAAGGGAAGGAGG + Intronic
1162836725 19:13324220-13324242 CCTGGAGGCTGCAGGGGAGGAGG + Intronic
1163102751 19:15107815-15107837 CCTGGAGGGTGGAGGGGAGGAGG + Intronic
1163113926 19:15178129-15178151 GGTGGGGAGTGGAGGGAAGGAGG + Intronic
1163214523 19:15866023-15866045 ATTGGAGGCTGGAGGGTAGGAGG + Intergenic
1163759856 19:19130307-19130329 GCTGGAGGCTGGAGCTAAGGAGG + Exonic
1163826706 19:19528211-19528233 CCTGGGGACTGGGGGAAAGAAGG + Intronic
1163927521 19:20360268-20360290 CCTGGACAAGGGAGGGAAAGGGG - Intergenic
1164232580 19:23303164-23303186 CATGGAGAATGGAGGAAAGCAGG - Intergenic
1164711403 19:30359571-30359593 CGGGGAGACAGGAAGGAAGGTGG - Intronic
1165162235 19:33823582-33823604 TCAGGAGACTGGAGGGCAGAAGG + Intergenic
1165461575 19:35946935-35946957 GCAGGAGAGTGGAGGGAAGCTGG + Intergenic
1165827479 19:38713587-38713609 CCTGGAGACAGGCGGGGAGGCGG - Intronic
1166252411 19:41580444-41580466 ACTTGTGACTGGTGGGAAGGTGG - Intronic
1166330945 19:42077697-42077719 CCTGGAGACAGGAGCTAGGGTGG + Intronic
1166532872 19:43553003-43553025 CCTGGAGACTGGAGAGGCTGAGG + Exonic
1166557397 19:43710008-43710030 TGTGGAGAGTGGAGAGAAGGTGG + Intergenic
1166677216 19:44747599-44747621 GCTGGAGATGGGAGGGAGGGAGG - Intergenic
1166772723 19:45294122-45294144 CCTGGAGACCGGAGAAGAGGGGG - Intronic
1166835322 19:45664183-45664205 CCTGGAGTGGAGAGGGAAGGGGG - Intergenic
1166855288 19:45780210-45780232 CCTGGAGTCAGGGTGGAAGGTGG - Exonic
1166985707 19:46659227-46659249 CCTAGAGACTGGGGGGTGGGGGG + Intronic
1167016174 19:46842516-46842538 CCTGGATCCTGGAGGCATGGAGG + Intronic
1167166522 19:47803131-47803153 CCTGGAGAATGGAGGGAAGAGGG + Intronic
1167175320 19:47860633-47860655 CCTGGAGAAGGGAGGGAAGAGGG - Intergenic
1167221830 19:48204299-48204321 CCTGGGAACTGGAGGGATGGAGG + Intronic
1167509154 19:49887289-49887311 TCTGGAGAGTGGGAGGAAGGAGG + Intronic
1167704033 19:51067835-51067857 GCTGGAGCCTGGAGTGAGGGTGG + Intergenic
1168295749 19:55376758-55376780 CCTGGGGCCTGGCGGGCAGGCGG + Intergenic
1168303362 19:55419629-55419651 CCCTGAGACTGAAGGGATGGGGG - Intergenic
1168641784 19:58035480-58035502 CCTGGAGACTCTAGGGAGGGGGG - Intronic
926203191 2:10815977-10815999 GCTGGGGACAGCAGGGAAGGGGG - Intronic
926218480 2:10919970-10919992 CAGGGAGACTGAAGCGAAGGAGG - Intergenic
926545016 2:14229032-14229054 ACTGGAGGGTGGAGGGTAGGAGG - Intergenic
927496819 2:23556688-23556710 CCAGGAGACGGGAGGGGAGGAGG - Intronic
928089475 2:28365253-28365275 CCAGGAGCCTGGAGAGAGGGAGG + Intergenic
928322835 2:30296703-30296725 CCTGTAGCCTGGAGGCAGGGTGG + Intronic
928983238 2:37156997-37157019 CCGGGCGGCTGCAGGGAAGGCGG - Exonic
929487534 2:42368257-42368279 GCTGGGGACAGGAAGGAAGGTGG - Intronic
929572288 2:43030194-43030216 TATGGAAACTGGAGGTAAGGTGG - Intergenic
929589767 2:43137371-43137393 CAGGGAGACTGGTGGGAGGGTGG - Intergenic
930365617 2:50435798-50435820 TCTTGAGGGTGGAGGGAAGGAGG + Intronic
930475896 2:51881720-51881742 ACTGGAGAGTGGAGGGTGGGAGG - Intergenic
930753924 2:54957453-54957475 GCTGGGGACTTGATGGAAGGGGG + Intronic
930926537 2:56824661-56824683 GCTGGAGGCTGGAGGGTAGGAGG + Intergenic
931983019 2:67714396-67714418 ACTTGAGAGTGGAGGGTAGGAGG - Intergenic
932574096 2:72953371-72953393 ATTTGAGACTGGAGGGAAGGAGG + Intronic
932731067 2:74222295-74222317 CCTGGGGAAAGGAGGGAATGAGG + Intronic
932731741 2:74226690-74226712 CCTGGAGCCAGGAGGTAGGGTGG + Intronic
932739389 2:74280230-74280252 CCAGGAGAGGGTAGGGAAGGGGG - Intronic
933310680 2:80658047-80658069 CATGGAGAATAGAGGGTAGGAGG + Intergenic
933807855 2:86013034-86013056 CCTTCTGACTGGAGGCAAGGGGG - Intergenic
933810999 2:86032584-86032606 GATGAAGACTGAAGGGAAGGAGG - Intronic
934704893 2:96470615-96470637 CCTGCAGGCTGGAGGGGAAGGGG + Intergenic
934991832 2:98927081-98927103 CCAGGAGACAGCAGGGAGGGAGG + Intronic
935213281 2:100956359-100956381 GCTGGAGGCTGGAGGGAGGAAGG - Intronic
935673382 2:105574125-105574147 CCTGCAGAGCAGAGGGAAGGTGG - Intergenic
936073797 2:109388849-109388871 TATAGAGACGGGAGGGAAGGAGG + Intronic
936376839 2:111948187-111948209 CCTGGAGAAAGGAAGGAGGGAGG - Intronic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937204420 2:120226321-120226343 GCTGGAGAGTGGAGGGAACAGGG - Intergenic
937289024 2:120770835-120770857 CCAGCAGCCTGGAGGGTAGGTGG - Intronic
937513940 2:122631051-122631073 CCTGGAGTTTGGAGGAAAGATGG + Intergenic
937671520 2:124542510-124542532 CCTGGAGGCTGGAAGGCAGCTGG - Intronic
937805473 2:126138270-126138292 TGTGGAGGCTGGAGGAAAGGGGG + Intergenic
937866754 2:126757803-126757825 CCTGGGAGCAGGAGGGAAGGTGG + Intergenic
938195575 2:129324541-129324563 ACGGGAGACTGGTGGGCAGGAGG + Intergenic
938413166 2:131082227-131082249 CCTGTAGAGTGGAGGTAAAGAGG + Intronic
939002591 2:136753611-136753633 CCAGATGACTGGAGTGAAGGGGG - Intergenic
939162653 2:138608069-138608091 GCAGGAGATTGGAGGGGAGGAGG - Intergenic
939422615 2:141993267-141993289 CCAGGAGTCTTGAGGCAAGGGGG - Intronic
939512421 2:143123493-143123515 ACGGGAGCCTGGAGGGAAGGAGG - Intronic
939820061 2:146946639-146946661 GCTGGAGGGTGGAGAGAAGGAGG + Intergenic
940236421 2:151515603-151515625 TCTGGAGACTGGAGAGGAGATGG - Intronic
941650227 2:168084525-168084547 CCTGGAAGCTAGAGGAAAGGAGG + Intronic
941831385 2:169964495-169964517 TGAGGAAACTGGAGGGAAGGAGG + Intronic
942131078 2:172880085-172880107 CCTGCAGACTGAAGGGGTGGGGG + Intronic
942198077 2:173542675-173542697 ACTGGAGAGTGGAGGGTGGGAGG + Intergenic
943666498 2:190614899-190614921 CCTGGCATCTGGAGGGAATGGGG + Intergenic
943771246 2:191720253-191720275 CCTAGTGTCTTGAGGGAAGGTGG - Intergenic
943894056 2:193330563-193330585 ACTGGAGACTGGAGGGTGGGAGG + Intergenic
944021302 2:195107704-195107726 ACTTGAGAGTGGAGGGTAGGAGG + Intergenic
944212208 2:197218325-197218347 CCTGGAGAATGGAGGGGTGTAGG - Intronic
944888557 2:204091539-204091561 GCTGGAGAGTGGAGGAAATGGGG - Intergenic
945041840 2:205749101-205749123 ACTGGGGCCTGGAGGGGAGGTGG - Intronic
945160923 2:206889685-206889707 TCTTGAGAGTGGAGGGAAGGAGG - Intergenic
945273470 2:207964485-207964507 CCATGAGAGTGGAGGGAGGGAGG + Intronic
945289519 2:208113254-208113276 CCTGGAGCCTGGGTGGAAGCAGG + Intergenic
945636024 2:212352162-212352184 CCTTGAAAATGGAGGGTAGGAGG + Intronic
946165056 2:217858709-217858731 GCAGGAGAGTGGAGGGAGGGAGG - Intronic
946373460 2:219294594-219294616 CCTGGAGACAGCGGGGCAGGAGG + Intronic
947140806 2:227017942-227017964 ACTTGAGGCTGGAGGGGAGGAGG + Intronic
947748149 2:232520024-232520046 CCTGGAGGGAGGAGGGCAGGGGG - Intergenic
947751670 2:232535785-232535807 TCTGGGGTCTGGAGGGAGGGAGG - Exonic
947792848 2:232877642-232877664 CCTGGACACTGGAGCCCAGGTGG + Intronic
947853868 2:233310077-233310099 CCTGGAGAGTGGTGGAAAGGGGG - Intronic
948134108 2:235622943-235622965 CCTGCACACTGGAGGGAAGCAGG + Intronic
948485741 2:238279709-238279731 CGTGGGTACTGGTGGGAAGGAGG - Intronic
948515026 2:238498328-238498350 CATGGGGACTGGGGGAAAGGTGG + Intergenic
948667511 2:239545779-239545801 CCAGGTGACAGGAGGGAAGGCGG - Intergenic
948760333 2:240186252-240186274 GCTGCAGACTGGAAGGAAGTGGG + Intergenic
948947576 2:241228891-241228913 AGTGGAGCCTGGAGGCAAGGTGG - Exonic
949002992 2:241628099-241628121 CCAGGATAGTGGAGAGAAGGGGG - Intronic
1168752354 20:291774-291796 CCATGAGACTGGAAGGGAGGGGG - Intergenic
1168823334 20:792153-792175 CCTGGACAAGGGAGGGAAAGGGG - Intergenic
1169472252 20:5896700-5896722 CCTGAAGGAGGGAGGGAAGGAGG + Intergenic
1169983827 20:11419632-11419654 CCTGGAATCTGGAGAGAAAGGGG - Intergenic
1170024117 20:11870163-11870185 ACTTGAGACTGGGGGGAAAGAGG + Intergenic
1170871443 20:20210209-20210231 CCAGGAAAGTGGAAGGAAGGGGG - Intronic
1170932729 20:20783378-20783400 CATGGAGACTGAAGGGTATGGGG - Intergenic
1171793486 20:29548675-29548697 CCTGGGTACCGGAGGGAGGGAGG + Intergenic
1171854976 20:30335709-30335731 CCTGGGTACCGGAGGGAGGGAGG - Intergenic
1172321246 20:33996782-33996804 GCTGGAGGGAGGAGGGAAGGGGG - Intronic
1172611270 20:36254434-36254456 CCTGGTGGGAGGAGGGAAGGGGG + Intronic
1172611288 20:36254508-36254530 CCTGGAGGGAAGAGGGAAGGGGG + Intronic
1172781302 20:37438420-37438442 GCAGGAGAGTGGAGGGAAGAGGG - Intergenic
1172795494 20:37534396-37534418 CCTGGGGACTGGAGGCACTGTGG + Intergenic
1173201053 20:40955387-40955409 GCCGGAGACTGGAGGGTGGGAGG - Intergenic
1173431594 20:42992383-42992405 CCTGGAAAATGGAGAAAAGGAGG + Intronic
1173643936 20:44622085-44622107 CTTGGCGACAGGACGGAAGGAGG + Intronic
1173765036 20:45599562-45599584 CCTGAAGAGGGGAGAGAAGGTGG - Intergenic
1173926436 20:46784672-46784694 CCTGGTGACCTGAGGGAGGGAGG + Intergenic
1174008329 20:47428270-47428292 CCTGCAGAGGGAAGGGAAGGTGG - Intergenic
1174263906 20:49318088-49318110 CCTGGAACCTGGAGGCAATGAGG + Intergenic
1174307775 20:49626653-49626675 ACTTGTGACTGGTGGGAAGGAGG - Intergenic
1174334495 20:49849305-49849327 ACGGGAGAGTGGAGGGAAAGGGG + Intronic
1174662521 20:52226588-52226610 CCTGGAAACTGGAGGTTAGCTGG - Intergenic
1175133330 20:56805881-56805903 CTTGGAGATTGGAGGGATGTGGG - Intergenic
1175191650 20:57215765-57215787 CCTGGAGGCTGGAGGAAATGCGG - Intronic
1175260117 20:57668916-57668938 CCTGGAGGCTGGAGGGCAGAGGG - Intronic
1175381575 20:58567697-58567719 CCTGGAGGCTGAGAGGAAGGAGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175507500 20:59496161-59496183 CCTGGAGACTGGAGTGAGGACGG - Intergenic
1175883606 20:62274822-62274844 AGTGCAGACGGGAGGGAAGGCGG + Intronic
1175935001 20:62510284-62510306 GATGGAGACTGGAGGGGTGGAGG - Intergenic
1178109756 21:29358085-29358107 CCTGGACACAGGGGAGAAGGAGG + Intronic
1178184862 21:30207878-30207900 CATAGAGACTGGTGGGGAGGAGG + Intergenic
1178482405 21:32990895-32990917 CTTGGAGCCTGCAGGGAAAGAGG + Intergenic
1178944363 21:36933929-36933951 CCTGGAGACAAGGGGGAAGATGG + Intronic
1179169361 21:38961154-38961176 CATGGAGAATGGTGGGCAGGTGG - Intergenic
1179346692 21:40564932-40564954 CCTGGAGATTGGAAGGGAAGAGG + Intronic
1179427293 21:41291763-41291785 CCTAGAGACTGGAGTGCAGCAGG - Intergenic
1179449569 21:41459349-41459371 CCTAGAGACTGGAGGGAAATGGG + Intergenic
1179481006 21:41678702-41678724 CCTGGAAAACGGAGGGAAGCAGG - Intergenic
1179494378 21:41762439-41762461 CCTGGAGAGGGGCTGGAAGGCGG - Intronic
1179893400 21:44349171-44349193 CCTGCAAAGTGGTGGGAAGGCGG - Intergenic
1179950053 21:44704247-44704269 CCTGGAGAGTGGTGGGGGGGTGG - Intronic
1180133389 21:45843134-45843156 CCTGAAAGCTGGAGGGAAGAAGG - Intronic
1180581940 22:16846089-16846111 CCTGGTGTGTGGAGGGCAGGGGG - Intergenic
1180675069 22:17581214-17581236 CCTGGAGACTGGAGGGAAGGGGG - Intronic
1180866592 22:19123021-19123043 CCTGGAGACTGCAGCGAAGCCGG + Intergenic
1181110641 22:20600809-20600831 CCTGGACACTGGAGAGAAAAGGG - Intergenic
1181930084 22:26394023-26394045 GCTGGAGGCTGGAGAGAGGGGGG + Intergenic
1182861989 22:33568262-33568284 CCGGGAGACTGGTGGGCAGGAGG - Intronic
1182904399 22:33922392-33922414 TCACGAGGCTGGAGGGAAGGGGG - Intronic
1183025206 22:35060035-35060057 GCTTGAGAGTGGAGGGTAGGAGG + Intergenic
1183381455 22:37492431-37492453 CCAGGAGTCTGTTGGGAAGGTGG - Exonic
1183925868 22:41205473-41205495 CCTGGAGGGTGGAGGGTGGGAGG + Intronic
1184098534 22:42329582-42329604 CAAGGAGACGGGAGGGGAGGTGG + Intronic
1184109919 22:42388638-42388660 GCGGGAGGCGGGAGGGAAGGAGG + Intronic
1184335420 22:43849969-43849991 CCTGGAGGGTGGAACGAAGGAGG + Intronic
1184644067 22:45886575-45886597 CCGGGAGAGGGGCGGGAAGGAGG - Intergenic
1184649046 22:45911280-45911302 CCTGGAGCCAGGAGGGAGCGTGG + Intergenic
1184740329 22:46424604-46424626 GCTGGGGACAGGAGGGAAGTGGG - Intronic
1185002627 22:48255463-48255485 GATGGAGACTGAAGGGAAAGAGG + Intergenic
1185131002 22:49038757-49038779 CCTGGACACTGGCTGGAAGGCGG + Intergenic
1185237651 22:49724290-49724312 CCCGGAAACCGCAGGGAAGGCGG + Intergenic
1185317202 22:50184342-50184364 CCTGGAGCCTGGAAGGAAGCAGG + Intergenic
1185368525 22:50447837-50447859 CCTGGAGTCTGGAGGGTGTGAGG - Intronic
1185401910 22:50623308-50623330 CCCTAAGACTGGGGGGAAGGGGG + Intronic
949849265 3:8406004-8406026 ATTGGAAACTGGAGGTAAGGTGG + Intergenic
949886868 3:8702290-8702312 CTTGGAGACTTAAGGGAAGGGGG + Intronic
950060329 3:10065886-10065908 CCTGGAGCCTGGAGAGAAGTTGG + Exonic
950181362 3:10915678-10915700 TCTGAGGACTGGAGGGGAGGAGG + Intronic
950301740 3:11885435-11885457 CCTGGAGCCTGGAGAGAGGTTGG + Intergenic
950472043 3:13192529-13192551 GGTGGAGACAGGAGGGAAGCAGG + Intergenic
950609127 3:14113677-14113699 CCTGGGGACTGGTGAAAAGGAGG + Intronic
950642641 3:14358497-14358519 CCTGGAGCCAGGAGGCAGGGAGG - Intergenic
950798492 3:15530657-15530679 CCTGGAGGCTGGGGAGAAGGAGG - Intergenic
950845877 3:16015617-16015639 CCTGGACAAGGGAGGGAAAGGGG + Intergenic
951140160 3:19148612-19148634 CCTGATGACGGCAGGGAAGGGGG - Exonic
951160450 3:19413373-19413395 ACTAGAGAAGGGAGGGAAGGAGG + Intronic
952134894 3:30407284-30407306 CCTGGGGACTGGAGGTCTGGTGG + Intergenic
952859517 3:37801297-37801319 GGTGGGGACTGGAAGGAAGGGGG + Intronic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953198213 3:40753892-40753914 CCTAGAGGCTGGAGAGGAGGTGG - Intergenic
953842753 3:46402886-46402908 ACTTGAGACTGGAGGGCGGGAGG - Intergenic
953932072 3:47010403-47010425 CCTGGAGACAGGTGGGAGGCGGG + Intergenic
954053183 3:47999691-47999713 CCTGGAGGGTGGAGGGTGGGAGG + Intronic
954111410 3:48435421-48435443 CCTGGAGGATGTAGGGAAGTGGG - Intronic
954581776 3:51706965-51706987 CCTGGCGTCTGGAGGAACGGAGG + Intergenic
954708361 3:52493149-52493171 CCTGGAGACAGGAGGGTGAGGGG + Intergenic
956248930 3:67215264-67215286 CCTCTGGACTGTAGGGAAGGCGG - Intergenic
956611701 3:71130347-71130369 GATGGAGAGAGGAGGGAAGGGGG + Intronic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
956903054 3:73736657-73736679 CCTGGGAAAGGGAGGGAAGGAGG + Intergenic
958864690 3:99486563-99486585 CCTAGAGTCTGGAGCTAAGGGGG - Intergenic
960055619 3:113274509-113274531 CCTGGACACTGCGGGGAAGCAGG - Exonic
960602096 3:119468870-119468892 GCTGGGGACTGGAGGAAGGGTGG + Intergenic
960677371 3:120209142-120209164 ACTGAATCCTGGAGGGAAGGGGG + Intronic
961343597 3:126246641-126246663 GCTGGAGATGGGAGGGGAGGGGG + Intergenic
961358308 3:126352448-126352470 CATGGAGCCTGGAGTCAAGGAGG - Exonic
961556044 3:127697214-127697236 CCAGGAGCCCTGAGGGAAGGAGG + Intronic
961658539 3:128456428-128456450 CCAGGAGACAGCAGAGAAGGAGG - Intergenic
962185062 3:133249455-133249477 ACTGGAAGGTGGAGGGAAGGAGG - Intronic
962396177 3:135016973-135016995 CCTGAAGCTTGAAGGGAAGGAGG + Intronic
962448433 3:135490737-135490759 CCTGGAGACTGGAGGCTGGCTGG + Intergenic
962475507 3:135751801-135751823 CCTGCAGTCTGGAGAAAAGGAGG - Intergenic
962936052 3:140081789-140081811 TCTGGAGACTGGAGAGAGGTTGG + Intronic
963388170 3:144623155-144623177 GCTAGAGATTGGAGGGCAGGCGG - Intergenic
963503962 3:146161470-146161492 CCGGGAGTCTGGCGGGAGGGCGG + Intronic
964040291 3:152253248-152253270 CCTGGATAATGGGGGTAAGGTGG - Intronic
964093793 3:152907822-152907844 CCTAGACAGGGGAGGGAAGGAGG + Intergenic
964132530 3:153305957-153305979 CCTGGAGGAGGGAGAGAAGGGGG + Intergenic
964710424 3:159665944-159665966 CATGGAGACTGGAAGGCAGGAGG - Intronic
965763663 3:172107849-172107871 CCCTGAGACTGGAGGGAGTGTGG + Intronic
965868629 3:173238254-173238276 ATTAGAGAGTGGAGGGAAGGAGG - Intergenic
966039900 3:175470235-175470257 CCTGGGGTATGGAGGGAACGGGG + Intronic
966674615 3:182572008-182572030 CCTGGAGTCAGGAGGGAGGTAGG + Intergenic
966769718 3:183492886-183492908 CGTGGAGCCTGGAGGGAGGGTGG - Intronic
966908367 3:184543956-184543978 CCTGGAGAGGGGTGAGAAGGTGG - Intronic
966919039 3:184600626-184600648 TCTAGAGACAGGAGGGAAAGGGG - Intronic
967314092 3:188134463-188134485 ACTGGAGAGTGGAGGGTGGGAGG + Intergenic
967318675 3:188174524-188174546 CCTGGAGCCTGGAGAGATGGGGG + Intronic
967980646 3:195063135-195063157 GCTGGAGACAGGAGGGCAGCCGG + Intergenic
968260002 3:197313640-197313662 ACTGGAGAGTGGAGGGTGGGAGG - Intergenic
968516508 4:1017818-1017840 CCTGGCCACAGGAGGGAAGCCGG + Intronic
968516596 4:1018148-1018170 GCTGCAGTCTGGAGGGACGGAGG - Intronic
968520732 4:1033673-1033695 CCTGGGGTCAGGAGGGAATGGGG - Intergenic
968951964 4:3700004-3700026 CCTTGTCACTGGAGGGAAAGCGG - Intergenic
969106216 4:4808868-4808890 CCTGGAGGAGGGAGAGAAGGGGG + Intergenic
969286726 4:6207141-6207163 CATGGAGGCTGATGGGAAGGTGG + Intergenic
969350109 4:6593480-6593502 CCAGGGGTCTGCAGGGAAGGAGG - Intronic
969398348 4:6937824-6937846 CCTGAAGCCTGGAGGGTAGTGGG + Intronic
969434953 4:7183694-7183716 CCAAGAGACTGGAGGGAGGCAGG - Intergenic
969515899 4:7648144-7648166 CCTGGTGGATGGTGGGAAGGAGG + Intronic
969594816 4:8142989-8143011 CCTGCAGAGGGGAGGGAAGCTGG - Intronic
969632811 4:8348203-8348225 TCTGGAGGCTGGAGGGCTGGTGG + Intergenic
970330833 4:14982251-14982273 ACTGGAGAGTGGAGGGTGGGAGG + Intergenic
970946480 4:21698903-21698925 CCCTGAGACTGGTGGGAATGGGG - Intronic
971263832 4:25080999-25081021 TCTGGTGACTGCAGGGCAGGTGG - Intergenic
971607530 4:28676993-28677015 GCCAGAGACAGGAGGGAAGGAGG + Intergenic
971624432 4:28899790-28899812 ACTGGAGGCTTGAGGGTAGGAGG + Intergenic
971689336 4:29812475-29812497 GCTGGAGGCTGTAGGGGAGGGGG + Intergenic
972338494 4:38129573-38129595 CCAGCAGATTGGAGGGCAGGGGG + Intronic
972506262 4:39723124-39723146 CCTGGAGTCTGGAAGGCAGGGGG - Intronic
972577378 4:40364346-40364368 GGAGGAGACTGGAGGGAAGGAGG - Intergenic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
972967483 4:44529363-44529385 CCAGGAGCTTAGAGGGAAGGAGG - Intergenic
973007326 4:45029300-45029322 ACTGGAGAGTGGAGAGACGGTGG + Intergenic
973163710 4:47051135-47051157 CCCTGAGACTGGCAGGAAGGAGG + Intronic
973642525 4:52917628-52917650 CCTGGAGAGTGGGGGCAATGGGG - Intronic
974543791 4:63274825-63274847 CATTGAGAATGGAGGGAGGGAGG + Intergenic
974981495 4:68963269-68963291 TCTTGAGACTGGAGAGAAAGAGG - Intergenic
975296139 4:72736580-72736602 CCTGATGGGTGGAGGGAAGGCGG + Intergenic
975577358 4:75876364-75876386 CCTGGTGACCGGAGAGAAAGAGG - Exonic
975719442 4:77235739-77235761 TCTGGGGACTCAAGGGAAGGGGG - Intronic
975766806 4:77677093-77677115 CCAGAAGACTGGAGGACAGGAGG + Intergenic
977709986 4:100113901-100113923 GCAGGAGACAGGAGGGCAGGAGG - Intergenic
978320635 4:107490804-107490826 ACTTGAGGCTGGAGGGTAGGAGG + Intergenic
978495981 4:109359478-109359500 CCTGGAGACTTAGAGGAAGGAGG - Intergenic
978924082 4:114221307-114221329 ACTGGAGAATGGAGGGTGGGAGG + Intergenic
978949484 4:114540446-114540468 CCTTGAGGGTGGAGGGTAGGAGG - Intergenic
979041296 4:115800257-115800279 CAGGGAGACAGGAGAGAAGGGGG - Intergenic
979402045 4:120260754-120260776 CCTTGAATCTGGAGGCAAGGGGG + Intergenic
979413989 4:120413648-120413670 ACGGGGGACTGGAGAGAAGGTGG + Intergenic
980016682 4:127657972-127657994 TCTGGAGACTGGTGGGACAGAGG + Intronic
980323301 4:131307360-131307382 ATTGGAGAGTGGAAGGAAGGTGG + Intergenic
981682316 4:147413780-147413802 CTTGGAGGGTGGAGGGTAGGAGG - Intergenic
982720130 4:158850626-158850648 AGTGGGGGCTGGAGGGAAGGAGG + Intronic
982787997 4:159558655-159558677 CCAGGAGACTGGGGGGAAATTGG - Intergenic
983102238 4:163639017-163639039 CCCAGAGACTGGAGGGCAGTGGG + Intronic
983155641 4:164344219-164344241 ACTTGAGGGTGGAGGGAAGGAGG + Intronic
983249490 4:165327912-165327934 GAAGGAGACTGGAGTGAAGGTGG + Intronic
983735392 4:171052591-171052613 ACTTGAGACTGGAGGGTGGGAGG + Intergenic
983996425 4:174188223-174188245 CTTGGAGAGTGGAGGGTGGGAGG + Intergenic
984009631 4:174355434-174355456 CCTGATGACTGGAGAGACGGGGG - Intergenic
984056319 4:174933623-174933645 CCTTGAGGATGGAGGAAAGGAGG - Intronic
984547718 4:181127309-181127331 TGTGGAGAATGGATGGAAGGGGG + Intergenic
984764017 4:183385733-183385755 CCTGGAGTGTGGAGGGTGGGAGG + Intergenic
985121699 4:186649629-186649651 CCTGGAGACTGGGAGGAGCGAGG + Intronic
985140428 4:186833771-186833793 GCAGGTGACTGGAGGGAAAGTGG + Intergenic
985197327 4:187445568-187445590 GCTGAAGACTGTAGGGAAGAAGG + Intergenic
985213488 4:187621755-187621777 CATGGAGAGTGGGAGGAAGGAGG - Intergenic
985538889 5:478739-478761 CCTGGAGCCTGGCTGGAGGGTGG - Intronic
985669692 5:1201039-1201061 CGTGGGGACTGGTGGGAAGCCGG + Intergenic
985716597 5:1466626-1466648 CCTGGTGAATGGAGGCATGGCGG + Intronic
986033301 5:3913465-3913487 CCTGGAGACTGCAGAAAATGAGG - Intergenic
986491458 5:8295651-8295673 CCTGGAGCTTGGAGAGAAAGAGG - Intergenic
986499922 5:8387976-8387998 ACTTGAGACTGGAGGGTGGGAGG - Intergenic
986779767 5:11054564-11054586 CGTGGGGACTGGCGGGAAGGCGG - Intronic
987325705 5:16810320-16810342 CATGGGGACTGTAGGGAGGGAGG - Intronic
988781017 5:34521906-34521928 TCAGGAGAATGGAGGGCAGGAGG - Intergenic
988824077 5:34916855-34916877 CCTGCAGATTGGGGGGCAGGGGG + Intronic
989084713 5:37663744-37663766 CTTGGCGACTGCAGGGAAGGAGG - Intronic
989182807 5:38595450-38595472 CCCAGGGACTGGAGGGAAAGAGG + Intronic
989352161 5:40498881-40498903 TCTGGAGAGTGGAGGGAAAAGGG + Intergenic
990232436 5:53727930-53727952 GCTTGTGACTGGTGGGAAGGAGG + Intergenic
990334213 5:54756341-54756363 CCTGGGGACTGGTTGGATGGGGG + Intergenic
990731080 5:58810148-58810170 GCAGGAGACTGGACTGAAGGAGG - Intronic
990865602 5:60376461-60376483 CCTGGAGACTAGGGAGTAGGAGG - Intronic
991100593 5:62788194-62788216 GCTGGAGATTGGAGGGCAAGAGG + Intergenic
992058840 5:73021321-73021343 GATGGCGACAGGAGGGAAGGAGG + Intronic
992579053 5:78151987-78152009 GCAGGAGAAGGGAGGGAAGGGGG - Intronic
992836715 5:80648710-80648732 CCTGGTGACTGGAGAGTGGGAGG - Intronic
993109057 5:83632973-83632995 ACAGGAGACAGGAGGGCAGGAGG - Intergenic
995321370 5:110837901-110837923 CCTGAAAACTGGAGGGAAGGGGG - Intergenic
995493983 5:112722557-112722579 ACTTGGGACTGGGGGGAAGGAGG - Intronic
995526209 5:113052613-113052635 TCTGGAGAGTGGAGGGGAGCTGG - Intronic
995527233 5:113059793-113059815 CCTGTAGCCTGGTGGGAATGCGG + Intronic
995621649 5:114032205-114032227 ACTGGAGACTGGAGGAAGAGAGG + Intergenic
995996444 5:118306337-118306359 TCTGGAGATTGGAGGGAACAAGG - Intergenic
996081883 5:119266480-119266502 CCTGGAGATTGAGGGGATGGAGG - Intergenic
996605585 5:125317655-125317677 CTTGGAGAGTGGAGGGAGGGAGG - Intergenic
996681576 5:126233164-126233186 ACTGGAGAGGGGAGGGTAGGAGG + Intergenic
997264272 5:132486028-132486050 GCTGGTGAGAGGAGGGAAGGGGG - Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997812775 5:136988413-136988435 CCAGAAGCCTGGAGGTAAGGTGG - Exonic
999348375 5:150844339-150844361 TATGGAATCTGGAGGGAAGGAGG - Intergenic
1000414869 5:160973806-160973828 TCTTGAGACTGGAGGGTGGGAGG + Intergenic
1001464938 5:171955520-171955542 TTTGGAGACTGGAGGTAAAGGGG + Intronic
1001547868 5:172581635-172581657 GCTGGAGGCTGGAGGGAAGGAGG - Intergenic
1001866632 5:175111754-175111776 CCCTGTGACTGGAGGGAATGTGG + Intergenic
1002101538 5:176860410-176860432 TCTGGAGAATGAATGGAAGGAGG - Intronic
1002105880 5:176879288-176879310 CCTGGAGGTGGGAGGGAAAGAGG - Exonic
1002340734 5:178515267-178515289 CATGGAGGCTGCAGGGAGGGAGG - Intronic
1002370060 5:178744820-178744842 ACTGGAGGATGGAGGGAGGGCGG + Intergenic
1002423286 5:179161522-179161544 CCTGGAGAGTGGGGGGCAGCGGG + Intronic
1002452178 5:179325401-179325423 CCTGGAGACAGAAGGCAATGGGG + Intronic
1002473351 5:179450655-179450677 CCTGGAGTCTGGGAGGGAGGAGG - Intergenic
1002480785 5:179499377-179499399 CCTGGAGTCTGGGAGGGAGGAGG + Intergenic
1002711995 5:181200898-181200920 CCTGGAAGCTGAAGGAAAGGTGG - Intronic
1002861538 6:1084071-1084093 CCTGCACACAGGAGGCAAGGTGG - Intergenic
1003244010 6:4369196-4369218 GCAGGAGATTGGAGTGAAGGGGG - Intergenic
1003535713 6:6973713-6973735 CCTGGAGGCTGGAAGGTAGCTGG - Intergenic
1004108373 6:12688300-12688322 ACTTGAGGCTGGAGGGTAGGAGG + Intergenic
1004784404 6:18950493-18950515 ACTTGAGAGTGGAGGGTAGGAGG + Intergenic
1005479791 6:26244756-26244778 GCAGGAGACTGGAGGAAAGGAGG + Intergenic
1005826254 6:29633082-29633104 CGGGGAGCCGGGAGGGAAGGAGG + Exonic
1006028576 6:31162795-31162817 CCTGGGGAGGGAAGGGAAGGGGG - Exonic
1006155600 6:32011371-32011393 CCTGGGGACTAGAGGAAAAGGGG - Intergenic
1006161931 6:32044225-32044247 CCTGGGGACTAGAGGAAAAGGGG - Intronic
1006175882 6:32121233-32121255 CCTGGAGGAAGGAAGGAAGGTGG + Intronic
1006264062 6:32901894-32901916 AGTGGAAACTGGAGGGAAGAGGG + Intergenic
1006297203 6:33174987-33175009 CCTGGAGCCTCTGGGGAAGGGGG - Intronic
1006907588 6:37543473-37543495 GCAGAAGGCTGGAGGGAAGGGGG - Intergenic
1007106358 6:39285752-39285774 CGTGGAGAATGGATGGGAGGGGG + Intergenic
1007172867 6:39876868-39876890 CCTGGGGACAGGAAGGAAAGAGG + Intronic
1007360238 6:41350398-41350420 CCTGGAGACTTGAAGGAAACAGG + Intronic
1007423978 6:41735247-41735269 CCCGGAGACAGGTGGGAGGGTGG - Intronic
1007937778 6:45748710-45748732 CCTGGAGAATGGATAAAAGGTGG + Intergenic
1008081520 6:47199611-47199633 CCTGAAGACTGGGGGCAAGAAGG + Intergenic
1008456795 6:51720429-51720451 CCTGGGCACTGGAGGAAAGCAGG - Intronic
1008536228 6:52508311-52508333 CCTGGAAGCTGGAGACAAGGGGG + Exonic
1009323566 6:62321421-62321443 CCTGGGGATTGGGAGGAAGGCGG + Intergenic
1011011905 6:82712387-82712409 CCTGGAGAAAAGAAGGAAGGTGG + Intergenic
1011247008 6:85329973-85329995 TATGGAGACAGGAGAGAAGGAGG - Intergenic
1011553194 6:88548524-88548546 CCTAGAGTCTGGAGGGAGTGTGG - Intergenic
1011788522 6:90872551-90872573 ACTGGAAATTGGAGGGAAGAAGG - Intergenic
1012399321 6:98831691-98831713 CCTGGCGCCTGGAGGGGAGGCGG + Intergenic
1012585918 6:100922410-100922432 ACTTGAGAGTGGAGGGTAGGAGG + Intergenic
1012847232 6:104405895-104405917 GCTGGAGATTGGGGGTAAGGGGG + Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1014767366 6:125422131-125422153 CCTGGATACTGAAGGGGAGGAGG + Intergenic
1015022733 6:128495890-128495912 CATGGAGACTGGAGAGAATGCGG - Intronic
1015141777 6:129942194-129942216 CCTGGGGATTGGAGAGATGGGGG + Intergenic
1015467990 6:133568987-133569009 CCTGAATAATGAAGGGAAGGAGG - Intergenic
1015774076 6:136795909-136795931 ACTGCGGACGGGAGGGAAGGAGG - Intergenic
1016423214 6:143906926-143906948 GCTGGAGAATGGGGGGAAGGAGG - Intronic
1017035661 6:150264789-150264811 CATGGAGACAGAAGGAAAGGAGG - Intergenic
1017781128 6:157716193-157716215 CCTGGACACAGGTAGGAAGGAGG + Intronic
1017791607 6:157804833-157804855 GCTGGAGCGTGGAGGGAGGGAGG + Intronic
1017820500 6:158045659-158045681 CTTAGAAACAGGAGGGAAGGTGG - Intronic
1018910133 6:168096969-168096991 CCTGGAGAGTGGGGGGTGGGGGG + Intergenic
1019267355 7:125297-125319 CCAGGAGCCTGGAGGGGAGCAGG - Intergenic
1019478495 7:1255398-1255420 CATGGGGACAGGAGGGGAGGGGG + Intergenic
1019890636 7:3943309-3943331 CCTTGAGCCTGGTGGGAAGGCGG - Intronic
1020055890 7:5117393-5117415 CCTGGCCCCTGGAGGGCAGGAGG - Intergenic
1020265739 7:6558947-6558969 CCTGGAAAGTGGAGAGAAGAGGG - Intergenic
1021451590 7:20787167-20787189 TGCGGAGACTGGAGGGAGGGGGG + Intergenic
1022190855 7:28015890-28015912 CCTGGAGCCTGGGGAGCAGGGGG - Intronic
1022753036 7:33252249-33252271 GGTGGAGCCTGGAGGGAGGGAGG - Intronic
1022764421 7:33394396-33394418 ACTGGAGGGTGGAGGGTAGGAGG + Intronic
1023295199 7:38707768-38707790 ACTGGAGAGAGGAGGGAATGGGG + Intergenic
1023330061 7:39105843-39105865 CCTGGGTACTGGAGGGCTGGAGG - Intronic
1023457144 7:40352457-40352479 ACTTGAGAGTAGAGGGAAGGAGG - Intronic
1024064335 7:45720055-45720077 CCTGGTAACTGGAGGGGAGCTGG - Exonic
1024079217 7:45842248-45842270 CCTGTAAAGGGGAGGGAAGGAGG + Intergenic
1024229738 7:47354943-47354965 CCCAGTGTCTGGAGGGAAGGAGG - Intronic
1024242228 7:47444559-47444581 CCTGACGGCAGGAGGGAAGGAGG + Intronic
1024573648 7:50746789-50746811 CCTGGGGACTGGAGGCCCGGGGG - Intronic
1025709412 7:63893070-63893092 CCTGGAGGCTGGAGGGGGGTTGG + Intergenic
1026023771 7:66729674-66729696 CCTGGAGACTGGATGGGTGATGG - Intronic
1026312227 7:69196436-69196458 AGTGGAGGCTGGAGGGAGGGGGG - Intergenic
1026451957 7:70537179-70537201 GCTGGGTACTGGTGGGAAGGAGG - Intronic
1026591582 7:71700615-71700637 CCTGGAGACCAGAGGAAATGTGG - Intronic
1027623770 7:80523992-80524014 TCTTGAGACTGGGGGAAAGGAGG - Intronic
1027991522 7:85369064-85369086 CATTGAGAGTGGATGGAAGGAGG - Intergenic
1029303349 7:99601262-99601284 CCTGGAGAGTGGATGGGAGATGG + Intronic
1029375496 7:100174702-100174724 CCTGGAGACTGGAAGAAATGTGG - Exonic
1029448648 7:100628306-100628328 CCTGGGGACAGAGGGGAAGGAGG + Exonic
1030749697 7:113216299-113216321 CCAAAAGACTGGAGGTAAGGAGG - Intergenic
1032223142 7:130009228-130009250 CATGGAGACTGGTAGGAATGTGG + Intergenic
1032274064 7:130439526-130439548 CCTGGAGGGTGGGGGGAAGGAGG - Intronic
1032400297 7:131619896-131619918 ACAGGAGACTGGAGGTGAGGTGG + Intergenic
1033024692 7:137760849-137760871 CCTCTGGACTGGAAGGAAGGAGG - Intronic
1033125896 7:138706777-138706799 GCTGGAAGGTGGAGGGAAGGAGG + Intronic
1033281929 7:140012209-140012231 CCTGAAGTCTGGAAGGTAGGAGG + Intronic
1033535072 7:142304523-142304545 CCTGGAGATGGGAAAGAAGGTGG + Intergenic
1033539010 7:142338838-142338860 CCTGGAGAGGGGTGGGAAGGTGG + Intergenic
1033760293 7:144430060-144430082 CCTGGTCACTAGAGGGTAGGGGG + Intergenic
1033970990 7:147039360-147039382 CCTGGAGAGTGGAGGGTGGAAGG - Intronic
1034063051 7:148110527-148110549 CGTGGAGAATGAAGAGAAGGAGG - Intronic
1034424946 7:151009419-151009441 CCTGGACACCGGAGGCCAGGAGG + Exonic
1034453193 7:151148942-151148964 CCTGGGGACTGGAGCTGAGGAGG - Exonic
1034999719 7:155603185-155603207 TCTGGAGAGTGGAGGGCAGGAGG - Intergenic
1035171042 7:157017730-157017752 CCCGGAGACTGCGGGGAGGGTGG - Intergenic
1035212175 7:157336824-157336846 CCAGGAGACTGGGGGCGAGGGGG - Intronic
1035245790 7:157561302-157561324 CCTGGAGTCTGCAGGGAAGTGGG - Intronic
1035541842 8:446033-446055 CCTGGTGTCTGGTGGGATGGAGG + Intronic
1035689886 8:1553189-1553211 CCTGAGGACAGGAGGGAAGGAGG - Intronic
1035823118 8:2616245-2616267 ACTGGAGATTGGAGGGTGGGAGG + Intergenic
1036197522 8:6733347-6733369 CCTGGTGAGGGGAGGGCAGGAGG - Intronic
1036612564 8:10362849-10362871 GCTGGGGCCAGGAGGGAAGGAGG - Intronic
1037743489 8:21625635-21625657 CCAGGAGACTGGTGTGAAGAGGG + Intergenic
1037818442 8:22124159-22124181 CCTAGGGCTTGGAGGGAAGGAGG - Intronic
1037904897 8:22710526-22710548 CCTGGAAACCACAGGGAAGGAGG - Intergenic
1038094249 8:24290029-24290051 GCTGGAGAAGGGAGGGAAGAGGG - Intergenic
1038682696 8:29683968-29683990 CCTAGAGATTGGAGGGAGAGAGG + Intergenic
1039296585 8:36162696-36162718 CCAGGAAACTGGAGGGAAGGAGG + Intergenic
1039680561 8:39730657-39730679 CCTGGAGAGGTGGGGGAAGGAGG + Intergenic
1039904066 8:41773395-41773417 CCTGGAGGAGGGAGGGAAGGGGG + Intronic
1040665055 8:49621716-49621738 CCTGGAGAAGGGAGGGAAAGGGG - Intergenic
1040811208 8:51455703-51455725 CCTAGAGGCAGAAGGGAAGGAGG + Intronic
1040846088 8:51842155-51842177 ACTGGAGATGGGAGGGAAGGGGG - Intronic
1041107827 8:54459036-54459058 CCTGCACAGTGGAAGGAAGGGGG - Exonic
1041679032 8:60568066-60568088 AATGGAGACTTGAGGGAAGGTGG - Intronic
1041919668 8:63168214-63168236 CCTGGAGGCTGACGGGACGGAGG - Intergenic
1042194747 8:66222508-66222530 CTGGGAGACTGGAGACAAGGAGG - Intergenic
1043355003 8:79401737-79401759 CAGGGAGACTGCAGGGAAAGAGG - Intergenic
1043520971 8:81044907-81044929 CGGGGAGACTGGTGGGGAGGGGG - Intronic
1043945306 8:86244470-86244492 TCTGGAGACTTGAGGGAAGGAGG + Intronic
1045023476 8:98064376-98064398 CCAGGAGACAGGAGGGGAGACGG - Exonic
1045048057 8:98297678-98297700 ACTAGAGAGGGGAGGGAAGGAGG - Intergenic
1045051756 8:98333862-98333884 CCTGAAAGCTGGAGGGCAGGTGG - Intergenic
1045240949 8:100400983-100401005 CCTGGAGGGTGGAGAGAAGATGG - Intronic
1045467865 8:102486262-102486284 CCTGGAGGCAGCATGGAAGGTGG - Intergenic
1047011026 8:120672908-120672930 GAAGGAGACTGGAGGGCAGGAGG + Intronic
1047437910 8:124850295-124850317 GCCAGAGACTGGAGGGAGGGGGG - Intergenic
1047555341 8:125923315-125923337 GATGGAGACTGGGGGGAAGAAGG + Intergenic
1048468528 8:134687043-134687065 CCTGCAGGGTGGAGGGGAGGTGG - Intronic
1048873141 8:138815299-138815321 CCTGGAGCCTGGAAGGAAGATGG - Intronic
1048963998 8:139602004-139602026 CCTGAAGAGAGGAGGTAAGGTGG - Intronic
1049034182 8:140061722-140061744 CCAGAAGCCTGGACGGAAGGGGG + Intronic
1049276268 8:141721599-141721621 CCTGGAGACCGAAAGGAGGGTGG - Intergenic
1049344629 8:142131892-142131914 GCTGGGCACAGGAGGGAAGGTGG - Intergenic
1049526985 8:143131910-143131932 TCTGCAGACTGGAGCTAAGGTGG - Intergenic
1049570942 8:143370020-143370042 CCTGGGCACTGGAGGGAAAGAGG + Intronic
1050620805 9:7450070-7450092 CCCAGTGACTGGCGGGAAGGGGG + Intergenic
1053006753 9:34609939-34609961 CAAGGAAGCTGGAGGGAAGGAGG + Intergenic
1053526668 9:38837169-38837191 TTTGGAGGCTGGAGGGAGGGCGG + Intergenic
1053532819 9:38898830-38898852 CCTGGATACTAGAGGGAAGTTGG - Intergenic
1053650565 9:40164591-40164613 ACTGGAGAGTGGAGAGATGGTGG - Intergenic
1053755173 9:41299333-41299355 ACTGGAGAGTGGAGAGATGGTGG + Intergenic
1053792802 9:41698993-41699015 CCTGGGTACCGGAGGGAGGGAGG - Intergenic
1054152373 9:61615832-61615854 CCTGGGTACCGGAGGGAGGGAGG + Intergenic
1054181215 9:61911014-61911036 CCTGGGTACCGGAGGGAGGGAGG - Intergenic
1054198896 9:62061604-62061626 CTTGGAGGCTGGAGGGAGGGCGG + Intergenic
1054205045 9:62123259-62123281 CCTGGATACTAGAGGGAAGTTGG - Intergenic
1054331075 9:63756362-63756384 ACTGGAGAGTGGAGAGATGGTGG - Intergenic
1054472146 9:65546975-65546997 CCTGGGTACCGGAGGGAGGGAGG + Intergenic
1054534018 9:66211611-66211633 ACTGGAGAGTGGAGAGATGGTGG + Intergenic
1054633314 9:67465111-67465133 CCTGGATACTAGAGGGAAGTTGG + Intergenic
1054639458 9:67526763-67526785 CTTGGAGGCTGGAGGGAGGGCGG - Intergenic
1054656377 9:67670128-67670150 CCTGGGTACCGGAGGGAGGGAGG + Intergenic
1055305768 9:74927680-74927702 ACTTGTAACTGGAGGGAAGGAGG - Intergenic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1056271896 9:84955000-84955022 TCTGTACACTGGAGGGAAGGGGG + Intronic
1056526201 9:87445328-87445350 CTTGAAGACTGGAGGTGAGGAGG + Intergenic
1056578360 9:87872569-87872591 ACTGGAGCCTGGGAGGAAGGAGG - Intergenic
1056723843 9:89094717-89094739 CCTGCATACTGGAAGGAAGATGG + Intronic
1056769407 9:89465989-89466011 CTTGGAGGCAGGGGGGAAGGTGG + Intronic
1056929478 9:90862156-90862178 CCTGGAGACTGGCGGGCCTGGGG + Intronic
1057151397 9:92799070-92799092 CCTGGATACTAGAGGGAAGTTGG + Intergenic
1057230471 9:93318657-93318679 CATGGAGAAGGGAGGGAAGTGGG - Intronic
1057674407 9:97127339-97127361 CCTGGGGGCAGGAGGGAAGTGGG + Intergenic
1057905011 9:98976523-98976545 CGTGGAGATGGGAGGGAACGTGG + Intronic
1058618474 9:106860703-106860725 CCGGGACAGTGGAGGGACGGCGG + Intergenic
1059024762 9:110614632-110614654 CCTGGACAAGGGAGGGAAAGGGG + Intergenic
1059142907 9:111870874-111870896 ACTTGGGACTGGTGGGAAGGAGG + Intergenic
1059405099 9:114094448-114094470 ACAGGAGACTGTAGGGAAAGAGG + Exonic
1059678192 9:116560549-116560571 ACTTGAGGCTGGAGGGAAGCTGG - Intronic
1060329970 9:122659123-122659145 CCTAGTGGCTGGAGGGAAGGAGG + Intergenic
1060484936 9:124040960-124040982 CCTGGGGACTGGGGAGAGGGGGG + Intergenic
1060491494 9:124088469-124088491 CCCCGAGAATGGAGGGAGGGTGG - Intergenic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060840810 9:126791929-126791951 AGGGGAGACTGGAGGGAAGGAGG - Intergenic
1061209707 9:129183718-129183740 GGTGGAGACTGGGGGGATGGGGG + Intergenic
1061333399 9:129912081-129912103 ACTTGCGACTGGTGGGAAGGAGG + Intronic
1061416545 9:130450372-130450394 CATGCAGGATGGAGGGAAGGAGG - Intronic
1061675388 9:132212702-132212724 CTTGGGCACTAGAGGGAAGGAGG - Intronic
1061761935 9:132857425-132857447 CCTGGAGACCTGAGGGAAACGGG - Intronic
1061869925 9:133515163-133515185 CCTGGAGGAGGGAGGGAGGGAGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062000658 9:134214173-134214195 CCAGGGCCCTGGAGGGAAGGAGG + Intergenic
1062109194 9:134772852-134772874 CCTGGATGCTGAAGGGTAGGAGG - Intronic
1062118319 9:134820979-134821001 CCTGGAGGCTGGGAGTAAGGTGG + Intronic
1062139107 9:134945666-134945688 CCTGGAGAGCGGAGGGCAGAGGG + Intergenic
1062151670 9:135022496-135022518 CCTGGAGACTGGTTGGCAGTGGG + Intergenic
1062184912 9:135213042-135213064 GCTGGAGACTGGAGGGAGGGAGG + Intergenic
1062376485 9:136264084-136264106 CCTGGAGCCTGCAGAGAGGGAGG - Intergenic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062480201 9:136747590-136747612 GCTGGAGGCTGGAGGGCTGGCGG - Intronic
1062480235 9:136747705-136747727 GCTGGAGGCTGGAGGGTTGGAGG - Intronic
1062480287 9:136747886-136747908 GCTGGAGGCTGGAGGGTTGGAGG - Intronic
1062480322 9:136748029-136748051 ACTGGAGGCTGGAGGGCTGGAGG - Intronic
1062480343 9:136748112-136748134 ACTGGAGGCTGGAGGGCTGGAGG - Intronic
1062502348 9:136856959-136856981 CCTGGGGCCTGGAGAGCAGGTGG - Exonic
1062653743 9:137591207-137591229 CCTGCAGCCTGGAGCGAACGGGG + Intergenic
1062667263 9:137681657-137681679 ACTGGAGACAGGAGAGAAAGTGG - Intronic
1202798449 9_KI270719v1_random:149282-149304 ACTGGAGAGTGGAGAGATGGTGG - Intergenic
1185592516 X:1286935-1286957 CGGGGAGAGGGGAGGGAAGGAGG + Intronic
1185998788 X:4985438-4985460 CCTGAAGTCTGGAGGCAAAGAGG + Intergenic
1186218038 X:7321268-7321290 ACTTGAGAGTGGAGGGAAAGAGG + Intronic
1186587221 X:10888252-10888274 ACTGGAGACTGCAGGGCTGGTGG - Intergenic
1187399181 X:18944467-18944489 TCTGGAGGAGGGAGGGAAGGAGG + Intronic
1187755868 X:22525542-22525564 ACTTGAGAGTGGAGGGAGGGAGG + Intergenic
1188205005 X:27344934-27344956 CATGGAGACTGGAGAAAATGTGG + Intergenic
1188724074 X:33559863-33559885 GCTAGAGAGAGGAGGGAAGGAGG - Intergenic
1189033723 X:37475089-37475111 ACTGGGGTCTGGAGGGGAGGTGG + Intronic
1189701603 X:43719308-43719330 GGTGGAGACAGGATGGAAGGTGG + Intronic
1189809521 X:44768344-44768366 CCTAGAGGATGGAGGGAAGTGGG + Intergenic
1189921030 X:45903516-45903538 GCTGGAGACAGGAGGGTGGGAGG + Intergenic
1190167930 X:48088558-48088580 ACTTGAGAGTGGAGGGAGGGAGG + Intergenic
1190385380 X:49879041-49879063 CATTGAGGCTGGCGGGAAGGGGG - Intergenic
1192166866 X:68831981-68832003 CCCTGAGCCTGGATGGAAGGAGG - Intronic
1192175314 X:68881306-68881328 CCCTGAGGCTGGAGGGGAGGGGG + Intergenic
1192184431 X:68937149-68937171 CCTGGAGAGTGCAGGGAAATGGG - Intergenic
1192221616 X:69201072-69201094 CCTGGAGAGTGGATTGAAGGAGG - Intergenic
1192522528 X:71814922-71814944 ACTGGACACTGGTGGGAAGCTGG - Intergenic
1192538086 X:71945694-71945716 CCTGAAGACAGGAGGGAAGCAGG + Intergenic
1192573057 X:72222032-72222054 GCTGGAGGCTTGAGGGCAGGAGG - Intronic
1192687009 X:73317888-73317910 ACTGGAGAGTGGAGGGTTGGAGG - Intergenic
1192985728 X:76396575-76396597 CCTGGAGTGTGGAGCCAAGGTGG - Intergenic
1193512773 X:82426168-82426190 ACTTGAGAGTGGAGGGAGGGAGG - Intergenic
1193581332 X:83266741-83266763 TCTTGAGAGTGGAGGGTAGGTGG + Intergenic
1194058330 X:89164555-89164577 CCTGGACAAGGGAGGGAAAGGGG + Intergenic
1195288318 X:103406976-103406998 CCTGGAGACAGGGCGGTAGGAGG - Intergenic
1195308450 X:103608146-103608168 CCGGGAGACTGGTGAGGAGGGGG + Intronic
1195431560 X:104795152-104795174 CCTGGAGAATGGTGGGTAGAGGG + Intronic
1195883022 X:109612374-109612396 CTAGGAGAGTGGAGGCAAGGTGG - Intergenic
1196976571 X:121164182-121164204 ACTGGAGAGTGGAGGGAGGAGGG - Intergenic
1197213885 X:123850259-123850281 CCTGGACAAGGGAGGGAAAGGGG - Intergenic
1197753206 X:129979770-129979792 CCTGGAGACGAGAGGCAAGGCGG + Intergenic
1197769701 X:130082275-130082297 CCTGGAGACTGGGGGACAGGTGG + Intronic
1198451310 X:136768887-136768909 CAGGGAGACAGGAGGGAATGAGG + Intronic
1198494500 X:137177819-137177841 CCTGGTGACCGAAGGGATGGTGG + Intergenic
1198531339 X:137551498-137551520 CCTGCAGTCTGGTGAGAAGGTGG + Intergenic
1199626571 X:149746079-149746101 GCTGGAAACTGGGTGGAAGGAGG + Intergenic
1199791378 X:151158443-151158465 ACTGGAGGGTGGAGGGAGGGAGG - Intergenic
1199846047 X:151693983-151694005 CCTGGGGGTTGGAGGGGAGGCGG + Intergenic
1200076894 X:153555601-153555623 CCAGGAGACTGGCCGGGAGGTGG - Intronic
1201194333 Y:11476793-11476815 CATGGAAACTGGAGTGATGGAGG + Intergenic
1201384305 Y:13421759-13421781 ACTTGAGAGTGGAGGGTAGGAGG + Intronic
1202349518 Y:23972731-23972753 CCTGGGGGGTAGAGGGAAGGTGG - Intergenic
1202521257 Y:25697373-25697395 CCTGGGGGGTAGAGGGAAGGTGG + Intergenic