ID: 1180675082

View in Genome Browser
Species Human (GRCh38)
Location 22:17581239-17581261
Sequence GCGCGCGTGAGCCTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 271}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180675075_1180675082 -6 Left 1180675075 22:17581222-17581244 CCTCCAGTCTCCAGGCAGCGCGC 0: 1
1: 0
2: 1
3: 10
4: 172
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675072_1180675082 0 Left 1180675072 22:17581216-17581238 CCCTTCCCTCCAGTCTCCAGGCA 0: 1
1: 0
2: 2
3: 60
4: 518
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675076_1180675082 -9 Left 1180675076 22:17581225-17581247 CCAGTCTCCAGGCAGCGCGCGTG 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675074_1180675082 -5 Left 1180675074 22:17581221-17581243 CCCTCCAGTCTCCAGGCAGCGCG 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675073_1180675082 -1 Left 1180675073 22:17581217-17581239 CCTTCCCTCCAGTCTCCAGGCAG 0: 1
1: 0
2: 4
3: 80
4: 569
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675067_1180675082 20 Left 1180675067 22:17581196-17581218 CCCGGGGGAGGGATGGGGCCCCC 0: 1
1: 1
2: 4
3: 46
4: 511
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675071_1180675082 1 Left 1180675071 22:17581215-17581237 CCCCTTCCCTCCAGTCTCCAGGC 0: 1
1: 1
2: 8
3: 86
4: 837
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675068_1180675082 19 Left 1180675068 22:17581197-17581219 CCGGGGGAGGGATGGGGCCCCCT 0: 1
1: 0
2: 4
3: 47
4: 381
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675069_1180675082 2 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180675082 Original CRISPR GCGCGCGTGAGCCTGGGGGC TGG Intronic
900101312 1:963248-963270 GGGCGGGTAAGCCTGGAGGCTGG + Exonic
900109635 1:1000081-1000103 GCGCGCGCGGGCCTGGAGCCGGG - Exonic
900633907 1:3652538-3652560 GGGCGCGCGAGCCTCCGGGCGGG - Exonic
901500785 1:9651716-9651738 GCGCGAGTGAGCCTCGAGGGAGG - Intronic
901635437 1:10668144-10668166 GCGCGTGTGAGGCTGGGCGGCGG + Intronic
901636549 1:10673078-10673100 GGGGGCGGGAGCCTGGGGACCGG + Intronic
902499137 1:16896680-16896702 GCGCGAGGGCACCTGGGGGCCGG - Intronic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
903070533 1:20724912-20724934 GGGCTGGTAAGCCTGGGGGCAGG - Intronic
903750369 1:25617351-25617373 GCGGGCGGGAGCCTAGGGGGCGG + Intergenic
903907737 1:26697570-26697592 GCGAGCGTGGTCCTGGGGGTGGG + Intronic
904052958 1:27651312-27651334 GCGAGAGTCTGCCTGGGGGCCGG + Intergenic
905308427 1:37034211-37034233 GCGCTCGGGAGCCGGGCGGCTGG - Intergenic
905347272 1:37319542-37319564 GCGCGTGTGTGCCTGGGTGAGGG + Intergenic
905864439 1:41369041-41369063 GAGCAGGAGAGCCTGGGGGCAGG - Intronic
906144208 1:43550360-43550382 GGGCGAGTGCGCCTGGGGGCGGG - Intronic
906436815 1:45803576-45803598 GCGCGCGTGAGGGGCGGGGCCGG + Intronic
906521048 1:46467041-46467063 GCGCGCGTGCGCCCGTGGGCTGG - Intergenic
907479174 1:54732543-54732565 GATCACCTGAGCCTGGGGGCTGG - Intronic
907747463 1:57227641-57227663 GCTCGCTTGAGCCTGGGAGGTGG - Intronic
908131971 1:61082970-61082992 GCGCGCGTGTGCCCGCGGGTGGG + Intronic
908377524 1:63559546-63559568 GATCGCTTGAGCCTGGAGGCAGG - Intronic
908857765 1:68448887-68448909 GAGCACGTGAGGCTGGGGGTGGG + Intronic
909170033 1:72283002-72283024 ACGCGCGCGAGCCCGGGAGCCGG - Intergenic
910251217 1:85200966-85200988 GCGCGCCCGAGTCAGGGGGCAGG + Exonic
910694345 1:89995517-89995539 GAGCGCGAGAGCCTCCGGGCTGG + Intronic
911393147 1:97271195-97271217 GCACAGCTGAGCCTGGGGGCAGG + Intronic
912717085 1:111990241-111990263 GCGCGCGTGAGCGGGGGGTGGGG + Intergenic
913378729 1:118185335-118185357 GCGCGCGGCAGCTTGGGGGCGGG + Intergenic
915088855 1:153407401-153407423 GCGGCAGTGAGGCTGGGGGCAGG + Intergenic
916717179 1:167455705-167455727 CAGCGCGGGGGCCTGGGGGCGGG - Intronic
918069849 1:181126813-181126835 GAGGGCTTGAACCTGGGGGCGGG + Intergenic
919513312 1:198493406-198493428 GAGCGAGTGAGCATGGGGTCCGG + Intergenic
924706477 1:246506895-246506917 ACGCGCGTGTGCCCGGGGGCGGG - Intronic
924801522 1:247332019-247332041 GCGCGCCTGGGCCTGGCCGCCGG + Intergenic
1062871013 10:904465-904487 GCTCACTTGAGCCTGGGGGGCGG + Intronic
1063458800 10:6202858-6202880 GCGTACGTCAGCCTCGGGGCGGG - Intronic
1065097443 10:22295778-22295800 GCTCACTTGAGCCTAGGGGCTGG - Intergenic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1067028709 10:42866150-42866172 GCGCGGTGGAGCCTCGGGGCGGG - Intergenic
1067450956 10:46381559-46381581 GGGCGAGATAGCCTGGGGGCAGG - Intronic
1067586287 10:47478192-47478214 GGGCGAGATAGCCTGGGGGCAGG + Intronic
1069651685 10:70053659-70053681 GCGGGCGTGCGCCCCGGGGCCGG + Intronic
1070668183 10:78359988-78360010 GCAGGAGGGAGCCTGGGGGCGGG + Intergenic
1073123127 10:101133901-101133923 GCTCGCGGGAGCCCGGGGCCAGG + Intronic
1075483267 10:122800089-122800111 GGGCAGGAGAGCCTGGGGGCAGG + Intergenic
1075483319 10:122800216-122800238 GGGCAGGAGAGCCTGGGGGCAGG + Intergenic
1075483355 10:122800297-122800319 GGGCAGGAGAGCCTGGGGGCAGG + Intergenic
1075483401 10:122800409-122800431 GGGCAGGGGAGCCTGGGGGCAGG + Intergenic
1076540758 10:131213288-131213310 TCACGGGTGAGCCTGGGTGCAGG - Intronic
1076646004 10:131954789-131954811 CCGCGCATGACCATGGGGGCAGG + Intronic
1076769396 10:132654825-132654847 TGGCGCGTGAGCCTGTGGGGGGG + Intronic
1076850454 10:133089934-133089956 GCTGGTGGGAGCCTGGGGGCAGG - Intronic
1077050002 11:562348-562370 GGGCGTGAGAGGCTGGGGGCTGG - Exonic
1077100219 11:819304-819326 GCAGGCCCGAGCCTGGGGGCCGG - Intronic
1077235604 11:1480702-1480724 GTGCGCGGGGGCCTGGGGGCGGG - Intronic
1077922937 11:6655387-6655409 GTGAACGTGAGCGTGGGGGCAGG - Intronic
1079064336 11:17276589-17276611 GCGCCGGGGAGCCTGGAGGCGGG - Intronic
1079237053 11:18698686-18698708 GCGGGCGGGAGCCGGGGGGGCGG - Intronic
1080485853 11:32705510-32705532 GAGCGAGTGAGCGTGGGGTCCGG - Intronic
1083034481 11:59624103-59624125 GCTCTCTTGAGCCTGGGAGCTGG + Intergenic
1083562219 11:63681816-63681838 GCGAGCGGGAGCCTGGGGGCTGG + Intronic
1083670861 11:64299394-64299416 GCGCGCGTGACCCAGCGAGCCGG + Exonic
1083752471 11:64768089-64768111 CCACCGGTGAGCCTGGGGGCTGG - Exonic
1083770335 11:64863640-64863662 GCACGCTTGGGCCTGGGGCCGGG - Intronic
1084385207 11:68839421-68839443 GGACGCGCCAGCCTGGGGGCGGG - Intronic
1089479269 11:118791737-118791759 GCGCGTCTGAGTGTGGGGGCAGG + Intergenic
1089567149 11:119377843-119377865 GCGCTCCTGGCCCTGGGGGCAGG + Intronic
1090473503 11:127000383-127000405 GGGCGCGGGAGGCTGTGGGCAGG - Intronic
1090807543 11:130211860-130211882 GTGTGCGTGAGCCTGGCAGCCGG + Intergenic
1091273149 11:134331985-134332007 GCGCGCGGGAGCCTCGCCGCGGG - Exonic
1091555210 12:1567870-1567892 GCGCGCGTGTGCGTGTGGGTGGG - Intronic
1096573996 12:52541274-52541296 GCAAGAGGGAGCCTGGGGGCGGG - Intergenic
1098029016 12:66235315-66235337 GCGCGGGGCAGCCTGGGCGCGGG + Intronic
1102084391 12:110124277-110124299 GCGCGCACGAGCTGGGGGGCGGG - Intergenic
1105977630 13:25486877-25486899 GATCGCTTGAGCCTGGGGGGTGG + Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113432849 13:110265504-110265526 CAGCGCGTGAGCCTGGGATCAGG + Intronic
1113868507 13:113544216-113544238 GCGGGCACGAGCCTCGGGGCGGG - Intronic
1114626970 14:24136372-24136394 TCGCGTGGGAGCCTGGGGGGCGG - Intronic
1119229753 14:72970721-72970743 GTGGGGGTGAGCCTGGCGGCAGG - Exonic
1121342802 14:93115436-93115458 GCGCTCGCGAGCCGGTGGGCGGG - Intronic
1122131123 14:99604887-99604909 GGGCGGAGGAGCCTGGGGGCAGG - Intergenic
1122393626 14:101407499-101407521 GCTGCCGTGAGCGTGGGGGCAGG - Intergenic
1123105402 14:105839083-105839105 GGGCGTGGGAGCCTGGGGGAGGG + Intergenic
1124336051 15:28857921-28857943 GTGCAGGTGGGCCTGGGGGCTGG + Intergenic
1126603607 15:50453946-50453968 GATCGCTTGAACCTGGGGGCGGG - Intronic
1127225054 15:56919156-56919178 GCGCCCCGGAGCCTGGGCGCCGG - Intronic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1129423903 15:75451377-75451399 CCGGGCGGGAGCCTGGTGGCGGG - Intronic
1129885043 15:79031708-79031730 GAGCGCGTGAGCATGGGGTGCGG + Intronic
1130224401 15:82046251-82046273 GCGCGCGCCAGGCCGGGGGCGGG + Intergenic
1130411759 15:83653941-83653963 GCGCCCGTCAGCCTGCGCGCCGG - Intergenic
1132495624 16:261950-261972 AGGGACGTGAGCCTGGGGGCGGG - Intronic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132934910 16:2475260-2475282 GGGGGCGGGAGCGTGGGGGCCGG + Intronic
1133130877 16:3675555-3675577 GCCCCCGTGAGACTGGGGGGAGG - Intronic
1133197874 16:4183903-4183925 GCTCGGGAGAGCCTCGGGGCCGG - Intergenic
1133211075 16:4263809-4263831 GGGCGTGTGCGCCAGGGGGCGGG + Intronic
1135342928 16:21664240-21664262 GCGCGCGGGGGCCTGGGCGGAGG + Intergenic
1136398593 16:30005904-30005926 GAGCGCGGGGGCCTGGGGCCGGG + Exonic
1136540271 16:30924544-30924566 GAGAGGGTGAGGCTGGGGGCGGG - Intronic
1138105926 16:54287092-54287114 CCGCGCCTCAGCCTGGGGACAGG - Intergenic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138705742 16:58913335-58913357 GATCGCTTGAGCCTGGGGGGTGG - Intergenic
1141340581 16:83200192-83200214 GAGGGTGTGAGCCTGGGCGCTGG + Intronic
1141831096 16:86510357-86510379 GCGGGCGGGAGCGCGGGGGCGGG + Intergenic
1142049867 16:87951350-87951372 GGGCGCGCGGGCCCGGGGGCGGG - Intronic
1142374897 16:89701723-89701745 GCGGCCGTGACGCTGGGGGCGGG + Intergenic
1142395417 16:89828789-89828811 CCGCGGGTGAGGCCGGGGGCGGG + Exonic
1142668200 17:1474532-1474554 GCCTGTGTGAGCCTGGGAGCTGG - Intronic
1142812357 17:2401222-2401244 GCGCGCCGGATCCGGGGGGCGGG - Intergenic
1143109353 17:4544734-4544756 ATCCGGGTGAGCCTGGGGGCGGG - Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143151106 17:4807919-4807941 GCGTTCGGGAGCCAGGGGGCTGG + Intronic
1143633716 17:8152569-8152591 GCGCACGTGGACCTGGGTGCTGG + Intronic
1144328832 17:14206563-14206585 GTGCCAGTGTGCCTGGGGGCAGG - Intronic
1145197641 17:20908662-20908684 GCGCGCCTGCGCGTGGGGGGGGG - Intergenic
1145914356 17:28562796-28562818 GAGCGCTTGAGCCTGGGAGGTGG - Intronic
1145937980 17:28726275-28726297 GGGCGCGGGCGGCTGGGGGCGGG - Intronic
1148000669 17:44385380-44385402 GCGCGCGCGAGCCCGGAGGAGGG + Intronic
1148437526 17:47695091-47695113 GCGTGCGTGAGCGCGTGGGCAGG - Intronic
1148774531 17:50088119-50088141 GGGCTGGGGAGCCTGGGGGCTGG - Intronic
1151318531 17:73338616-73338638 GAGCCCGGGAGCCTGGGGCCAGG + Exonic
1151508559 17:74544505-74544527 GAGGGTGTGAGCCTGGGGGTTGG - Intronic
1151534445 17:74730714-74730736 GCGGGTGTGACCCTGAGGGCAGG - Intronic
1152419349 17:80183775-80183797 GGGCGGGTGAGCATGTGGGCGGG - Intronic
1152638074 17:81438311-81438333 GCGAGTGTGGGCCAGGGGGCTGG + Intronic
1152695773 17:81793830-81793852 GTGGGCCTGAGCCTTGGGGCTGG - Intergenic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1156455937 18:37294119-37294141 GCACGGGTGAGGGTGGGGGCAGG + Intronic
1157222404 18:45837502-45837524 GCGCTGGCGAGCCTGAGGGCGGG - Exonic
1160446994 18:78935645-78935667 CCGGGCGGGAGACTGGGGGCTGG + Intergenic
1160711319 19:552484-552506 GCGGCCAGGAGCCTGGGGGCGGG - Intergenic
1160735538 19:660714-660736 GAGCGCTTGAGCCTGGGAGGTGG - Intronic
1160809612 19:1007768-1007790 GCTCACGTGAGCCCGGGCGCGGG + Exonic
1160904310 19:1445348-1445370 GCGCCCGCGAGCCTGGAGCCGGG + Intergenic
1161002477 19:1917821-1917843 GTGTGAGTGCGCCTGGGGGCAGG + Exonic
1161015001 19:1979101-1979123 GCGCGCGCGCGGCGGGGGGCGGG + Intronic
1161072352 19:2269285-2269307 GCGCGCGTCCTTCTGGGGGCGGG - Intronic
1161257990 19:3320398-3320420 GCGGGCGCGGGCCAGGGGGCTGG - Intergenic
1162129052 19:8514162-8514184 GCTCTCGCGAGACTGGGGGCGGG + Intronic
1162452913 19:10765523-10765545 GCGTGCGTCAGGCTGTGGGCTGG + Intronic
1162805813 19:13137467-13137489 GCCAGCGTGTTCCTGGGGGCAGG - Exonic
1162951313 19:14073451-14073473 GCGCGCGGGAGCGCGGGGCCAGG - Exonic
1163517760 19:17775192-17775214 GCGGGCTGGAGCCTGGGGGCTGG + Intronic
1163676470 19:18657873-18657895 GCTGACGTGAGCGTGGGGGCCGG + Intronic
1163845808 19:19637596-19637618 GAGCCTGGGAGCCTGGGGGCAGG + Intronic
1165333396 19:35153953-35153975 GAGCGCGGGAGCCTGAGGACCGG + Exonic
1166571368 19:43798977-43798999 GCGCGCGATACCCTGGGGGCGGG + Exonic
1167129153 19:47573082-47573104 GCGCGCGAGCCCCCGGGGGCGGG - Intergenic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1167174493 19:47856267-47856289 GATCGCCTGAGCCTGGGAGCTGG + Intergenic
1167293577 19:48637004-48637026 GAACCCGTGAGCCTGGGGGCAGG - Exonic
1168528831 19:57110061-57110083 GCTCACGTGAGCCTGGGAGGTGG - Intergenic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
926131246 2:10304187-10304209 TTGCGCGGGAGCCTGGGGGCTGG - Intronic
927887077 2:26725189-26725211 GAGAGCATGGGCCTGGGGGCAGG - Intronic
928118293 2:28563707-28563729 GCCCTTGAGAGCCTGGGGGCTGG + Intronic
928168845 2:28990495-28990517 GCGCCTGTGAGTCTGGGGTCTGG - Intronic
929778833 2:44944505-44944527 GCGCGGGGGAGCCGGGTGGCGGG + Intronic
929857778 2:45650909-45650931 GGGCGGGTCAGCCGGGGGGCGGG - Intergenic
930411687 2:51032428-51032450 GGGAGCCTGATCCTGGGGGCGGG + Intronic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
932366396 2:71156162-71156184 GAGCAGGTGAGCCTGGGAGCAGG + Intergenic
932405786 2:71511971-71511993 TGGCACTTGAGCCTGGGGGCTGG + Intronic
933728167 2:85437957-85437979 GCAAGCGGGAGGCTGGGGGCGGG + Intergenic
936112462 2:109676238-109676260 GTGTGAGTGAGCCTGGGAGCCGG + Intergenic
939143133 2:138379320-138379342 GCGTGCTTGGGCCTTGGGGCTGG - Intergenic
940129983 2:150370113-150370135 GAGCGAGTGAGCATGGGGTCTGG - Intergenic
947514001 2:230785369-230785391 GGGCGCGTGGGCAGGGGGGCAGG + Intronic
948187876 2:236035535-236035557 GCTCGCTTGAGCCTGGGAGGTGG + Intronic
948671033 2:239569108-239569130 GGGCGCGTGGGGCTGGGGGCTGG - Intergenic
1168812014 20:710393-710415 GCGCGCGCGTGTCTGGGGGCTGG - Intergenic
1169113116 20:3045888-3045910 CCGGGCCAGAGCCTGGGGGCGGG + Intergenic
1169258110 20:4114279-4114301 GCACGTGTGAGCCTGGGGCTTGG + Intergenic
1170433408 20:16297921-16297943 GAGCAGGGGAGCCTGGGGGCAGG - Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1173068400 20:39736976-39736998 GGGAGCCTGACCCTGGGGGCGGG + Intergenic
1175107767 20:56626972-56626994 GCGCGCGCGTGCCTGGGTGCCGG + Intergenic
1175789813 20:61734178-61734200 GCACGCGTGAGACTGGGGGCTGG + Intronic
1175866817 20:62183080-62183102 GGGAGCGTGGGCCTGGGGGGTGG + Intronic
1175983450 20:62752822-62752844 GTGCTGGTGAGACTGGGGGCAGG - Intronic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1176419055 21:6499476-6499498 GCGCGCCGGGGACTGGGGGCTGG + Intergenic
1178519115 21:33272531-33272553 GCTCGCTTGAGCCTGGGAGGTGG - Intronic
1179243858 21:39613135-39613157 GCGCGCGGGGGCGTGGGTGCCGG + Intronic
1179515515 21:41903761-41903783 TGGCAGGTGAGCCTGGGGGCCGG + Intronic
1179623984 21:42637935-42637957 GGGCGGGTGAGCGTGGGGGCAGG - Intergenic
1179694548 21:43107798-43107820 GCGCGCCGGGGACTGGGGGCTGG + Intergenic
1179905086 21:44418564-44418586 GCTCCGGTGGGCCTGGGGGCGGG + Intronic
1180110084 21:45643474-45643496 GCGGGGGTGGGGCTGGGGGCGGG - Intergenic
1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG + Intronic
1182300641 22:29335011-29335033 GGGCGAGGGAACCTGGGGGCAGG - Intronic
1182604000 22:31489577-31489599 GCGTGCGTGAGCGCGGGCGCCGG - Exonic
1183423778 22:37726498-37726520 GCGCAGGTGAGCCCGGGGGTGGG + Exonic
1183744799 22:39686160-39686182 GCGGGCGTGAGGCCGGGGGCTGG - Exonic
1183788392 22:40045156-40045178 GCGCGCGTGGGGCGGGGAGCGGG + Intronic
1185370705 22:50459707-50459729 TGGGGCGTGAGCCTGGAGGCGGG - Intronic
1185375788 22:50482084-50482106 GCGCTCCTGAGCCTGGGGTAGGG - Intronic
950562900 3:13745825-13745847 GCGTGCGTGCGCCTAGGGGGAGG + Intergenic
950911974 3:16604820-16604842 GAGCGCGTGGGAGTGGGGGCGGG + Intronic
954134364 3:48575322-48575344 GAGAGGGTGAGGCTGGGGGCTGG - Exonic
959073400 3:101724959-101724981 GAGCGCGGGAGCCAGGGCGCCGG - Intronic
959539470 3:107523433-107523455 GCGAGCGGGAGGCTGGGGGCCGG + Intronic
960629209 3:119712053-119712075 GAGCAGGTGAGCCTGAGGGCAGG + Intronic
961599809 3:128052085-128052107 GCGCGCGTGGCCCTGCAGGCAGG - Intronic
961661796 3:128472992-128473014 CAGGGCGTGAGCCTGGAGGCTGG + Intergenic
961831781 3:129626844-129626866 GCACGGGAGAGCCTGGGGCCTGG - Intergenic
962809271 3:138947301-138947323 GGGCGCGTGAGCCTGGCTGTCGG - Exonic
962828335 3:139119074-139119096 GAGGGAGTGAGGCTGGGGGCTGG + Intronic
964118748 3:153161799-153161821 GCGGGCGTGGGTCTGGGGGCCGG - Intergenic
968475499 4:804803-804825 GCGGTCGTCAGCCTGGAGGCCGG + Intronic
969053558 4:4388101-4388123 TCGGGGGTGAGCCTAGGGGCGGG + Intronic
969383783 4:6828285-6828307 GATCGCTTGAGCCTGGGGGGTGG + Intronic
969597681 4:8158330-8158352 CCGCGCGGGGGCCTGGGGTCCGG - Intronic
971196247 4:24473191-24473213 GCGCGGGTGAGGCCGCGGGCAGG + Intergenic
972075257 4:35079250-35079272 GAGAGCCTAAGCCTGGGGGCTGG + Intergenic
979833507 4:125330951-125330973 GGGCGCCTGAGGCTGGGGCCTGG - Intronic
981634302 4:146858292-146858314 GAGCACGTGAGCCTTGGAGCTGG - Intronic
985542826 5:494704-494726 GCGCGGGTCAGCCTGCGGGTGGG - Intronic
985595188 5:784771-784793 GGGCGCGGGACGCTGGGGGCGGG - Intergenic
985988392 5:3536102-3536124 GCGCGGGTGAGCGTGCGCGCGGG - Intergenic
987099832 5:14581953-14581975 CCGCAGGTGAGCCTGGGGCCGGG + Exonic
989660469 5:43792057-43792079 GCGGCAGTGAGGCTGGGGGCGGG + Intergenic
990410169 5:55534389-55534411 GCACGCGGGAGCCGGGGTGCAGG + Intronic
991743777 5:69710576-69710598 GCGCGCGGGAGCCTGCGGTTGGG + Intergenic
991753931 5:69844659-69844681 GCGCGCGGGAGCCTGCGGTTGGG - Intergenic
991795349 5:70290308-70290330 GCGCGCGGGAGCCTGCGGTTGGG + Intergenic
991823149 5:70585851-70585873 GCGCGCGGGAGCCTGCGGTTGGG + Intergenic
991833248 5:70719779-70719801 GCGCGCGGGAGCCTGCGGTTGGG - Intergenic
991887716 5:71289827-71289849 GCGCGCGGGAGCCTGCGGTTGGG + Intergenic
993384836 5:87251788-87251810 GCAGGCCTCAGCCTGGGGGCAGG - Intergenic
993471605 5:88313711-88313733 GCGGCAGTGAGCCTGGGGGAGGG - Intergenic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
1002692412 5:181059485-181059507 GCGCGCCTGAGCCCTGCGGCCGG + Exonic
1004194124 6:13488375-13488397 GCGGGCATGGGCCTAGGGGCGGG - Intergenic
1005583102 6:27251587-27251609 GGGGGCGGGGGCCTGGGGGCGGG + Intronic
1006134724 6:31888533-31888555 GAGAGCGTGAGGCTGGGGCCGGG + Intronic
1006136691 6:31900365-31900387 GCGGGGGGCAGCCTGGGGGCGGG - Exonic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006457549 6:34140618-34140640 GCAAGCGTGAGCCTGGTGGCTGG - Intronic
1006512237 6:34527767-34527789 GGGCCAGTGAGCCTGGGGGAAGG - Intronic
1006924497 6:37647139-37647161 GGGAGCGGGGGCCTGGGGGCAGG - Intronic
1013048781 6:106512208-106512230 GTGGGCGTGACCCTTGGGGCGGG - Exonic
1015786255 6:136923191-136923213 GGCCGCCTGAGCCTGGGAGCTGG + Intronic
1019261021 7:82078-82100 GTGCGCGTGTGCCTGTGGGAGGG - Intergenic
1019329498 7:455624-455646 GCACGTGTGAGCGTGGGGGCGGG - Intergenic
1019343653 7:519714-519736 GCCCGCGCGGGCCTGAGGGCGGG + Intronic
1019454024 7:1115345-1115367 GTGAGGGCGAGCCTGGGGGCTGG - Intronic
1020103253 7:5407349-5407371 GGGCAGGAGAGCCTGGGGGCTGG + Intronic
1020461459 7:8433877-8433899 GCCCGCGAGAGCCTGAGAGCCGG + Intergenic
1022815063 7:33905462-33905484 GCGCCCGAGAGCTGGGGGGCGGG - Exonic
1023995573 7:45157440-45157462 GCTGGGGTGAGCGTGGGGGCCGG - Intergenic
1024958081 7:54947087-54947109 GTGTGCCTGAGACTGGGGGCAGG + Intergenic
1025208827 7:57009268-57009290 GCAGGCGTGAGCATGGGGCCAGG + Intergenic
1025663124 7:63567602-63567624 GCAGGCGTGAGCATGGGGCCAGG - Intergenic
1029497654 7:100905500-100905522 GCGCGCTTGAACCTGGGAGGCGG - Intergenic
1031043401 7:116862400-116862422 GTGCGCGGGCGCCTGGTGGCCGG - Intronic
1033229020 7:139582430-139582452 GCTCCTGTGGGCCTGGGGGCAGG - Intronic
1035045343 7:155962028-155962050 GTGTGCGTGGGCGTGGGGGCAGG + Intergenic
1035261028 7:157661733-157661755 CTGCCCCTGAGCCTGGGGGCAGG + Intronic
1036453635 8:8890978-8891000 GCGCGCTTGGGCCTGCAGGCGGG - Exonic
1038613023 8:29071448-29071470 GCAGGGGTGAGGCTGGGGGCAGG - Intronic
1040927989 8:52705747-52705769 GCTTGCTTGAGCCTGGGAGCTGG + Intronic
1041045354 8:53881902-53881924 GAGGGCGGGAGACTGGGGGCGGG + Intronic
1042642983 8:70955776-70955798 GAGCGAGTGAGCATGGGGTCTGG + Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1048484220 8:134832131-134832153 GCGCGCGAGGGGCGGGGGGCAGG + Intergenic
1049218404 8:141418013-141418035 GCGCGGGTGAGCCTGGCAGGTGG + Intronic
1049784008 8:144441975-144441997 GCAGGGGTGAGCCTGGGGGCGGG - Intronic
1051268511 9:15332043-15332065 GCTCGCTTGAGCCTGGGAGGTGG + Intergenic
1051479095 9:17539978-17540000 GCGGCAGTGAGCCTGGGGGAGGG + Intergenic
1052695158 9:31869021-31869043 CCACCCGTGAGCCTGGGGACTGG - Intergenic
1052974259 9:34400187-34400209 GCGTGGGTGAGGGTGGGGGCAGG + Exonic
1055757854 9:79573459-79573481 GGGCGCGGGGGCCTGCGGGCGGG + Intronic
1056643316 9:88388725-88388747 GCGGGCCTGGGCCTCGGGGCGGG + Intronic
1060263253 9:122093534-122093556 GGGCTCGTGAGCCTGGGGACTGG + Exonic
1060283371 9:122228488-122228510 GCGCGCGCGAGCGGGGGGGGGGG - Intronic
1060389972 9:123268880-123268902 GCGAGCGGGGGCCTGGGGCCGGG - Intergenic
1060477950 9:123999687-123999709 GGGCGCGTGCGGCCGGGGGCGGG - Intergenic
1061119628 9:128635038-128635060 GCGCCGGTGAGCCTTGGGGGTGG - Intronic
1061506224 9:131033397-131033419 GAGAGCGTGTGCCTGGGGTCGGG + Intronic
1061780041 9:132989982-132990004 CCCAGCGTGAGGCTGGGGGCGGG + Intronic
1061828460 9:133275610-133275632 GCGCGCGCGAGCCGGAAGGCCGG - Intergenic
1061976105 9:134068543-134068565 GCGCGCGCGGGGCGGGGGGCGGG + Intergenic
1062400721 9:136371516-136371538 GGGTGGGTGGGCCTGGGGGCAGG + Intronic
1062453921 9:136626964-136626986 GTGCCCGTGAGCCAGGGGCCAGG - Intergenic
1062460519 9:136660850-136660872 GCCCAGGTGAGCCTGGAGGCCGG - Intronic
1062474584 9:136720737-136720759 GAGCGCTTGAGCCTGGGCACTGG + Intronic
1203374191 Un_KI270442v1:349414-349436 GCGGCAGTGAGCCTGGGGGAGGG - Intergenic
1185493678 X:538236-538258 GCTCACTTGAGCCTGGGAGCTGG - Intergenic
1185874410 X:3690643-3690665 GATCACTTGAGCCTGGGGGCGGG + Intronic
1192157121 X:68754992-68755014 GGGAGGGTGAGCTTGGGGGCTGG - Intergenic
1192660518 X:73037396-73037418 GCGGCCGTGAGGCTGGGGGAGGG - Intergenic
1198450955 X:136767083-136767105 GCGCGCGAGGGCCCGGGGGTGGG - Intronic
1199736800 X:150693341-150693363 GCGCGCGGGGGTCGGGGGGCGGG - Intronic