ID: 1180675082

View in Genome Browser
Species Human (GRCh38)
Location 22:17581239-17581261
Sequence GCGCGCGTGAGCCTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 271}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180675073_1180675082 -1 Left 1180675073 22:17581217-17581239 CCTTCCCTCCAGTCTCCAGGCAG 0: 1
1: 0
2: 4
3: 80
4: 569
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675069_1180675082 2 Left 1180675069 22:17581214-17581236 CCCCCTTCCCTCCAGTCTCCAGG 0: 1
1: 0
2: 12
3: 107
4: 890
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675067_1180675082 20 Left 1180675067 22:17581196-17581218 CCCGGGGGAGGGATGGGGCCCCC 0: 1
1: 1
2: 4
3: 46
4: 511
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675074_1180675082 -5 Left 1180675074 22:17581221-17581243 CCCTCCAGTCTCCAGGCAGCGCG 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675076_1180675082 -9 Left 1180675076 22:17581225-17581247 CCAGTCTCCAGGCAGCGCGCGTG 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675071_1180675082 1 Left 1180675071 22:17581215-17581237 CCCCTTCCCTCCAGTCTCCAGGC 0: 1
1: 1
2: 8
3: 86
4: 837
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675068_1180675082 19 Left 1180675068 22:17581197-17581219 CCGGGGGAGGGATGGGGCCCCCT 0: 1
1: 0
2: 4
3: 47
4: 381
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675072_1180675082 0 Left 1180675072 22:17581216-17581238 CCCTTCCCTCCAGTCTCCAGGCA 0: 1
1: 0
2: 2
3: 60
4: 518
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271
1180675075_1180675082 -6 Left 1180675075 22:17581222-17581244 CCTCCAGTCTCCAGGCAGCGCGC 0: 1
1: 0
2: 1
3: 10
4: 172
Right 1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180675082 Original CRISPR GCGCGCGTGAGCCTGGGGGC TGG Intronic