ID: 1180685776

View in Genome Browser
Species Human (GRCh38)
Location 22:17665327-17665349
Sequence CAAAATGCTGACAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180685776_1180685779 4 Left 1180685776 22:17665327-17665349 CCCATATCACTGTCAGCATTTTG No data
Right 1180685779 22:17665354-17665376 AAACCATTCAATAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180685776 Original CRISPR CAAAATGCTGACAGTGATAT GGG (reversed) Intronic