ID: 1180695046

View in Genome Browser
Species Human (GRCh38)
Location 22:17746533-17746555
Sequence CTGGTGACACAGTTAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180695041_1180695046 -4 Left 1180695041 22:17746514-17746536 CCTGCCTCAAGCGACAGTCCTGG 0: 1
1: 1
2: 0
3: 17
4: 374
Right 1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1180695043_1180695046 -8 Left 1180695043 22:17746518-17746540 CCTCAAGCGACAGTCCTGGTGAC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180695046 Original CRISPR CTGGTGACACAGTTAGTGCT GGG Intronic
902379346 1:16045346-16045368 GTGGTGACACAGTGGGTGCCAGG - Intronic
905863343 1:41364327-41364349 CTGGTCACACAGTTAGTAGATGG + Intronic
906101539 1:43266980-43267002 CCGGTTACACAGCTAGAGCTGGG + Intronic
906665850 1:47621522-47621544 CTGGTGACACACTTCACGCTGGG - Intergenic
907474129 1:54694253-54694275 CAAGTCACACAGCTAGTGCTGGG + Intronic
911456911 1:98136558-98136580 CTAGTGGCAAAGTTAGTGGTTGG + Intergenic
911969324 1:104410025-104410047 CTGATGACACTGTCAATGCTAGG + Intergenic
917810877 1:178657372-178657394 CTGTTGACTCAGTTTGGGCTGGG + Intergenic
918693638 1:187514074-187514096 CTGGTGTCACCATTAATGCTTGG + Intergenic
920045466 1:203129500-203129522 ATGGGGTCACAGTGAGTGCTGGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
1063101673 10:2955216-2955238 GTGGTGGCACAGTCAGTGTTCGG + Intergenic
1065150833 10:22821559-22821581 CTGGACACACAGAAAGTGCTTGG + Intergenic
1069593410 10:69655641-69655663 CGGATCACACAGTCAGTGCTGGG - Intergenic
1069616413 10:69809147-69809169 CAGGTCACACAGTTAGTGGCAGG - Intronic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1070833558 10:79434500-79434522 CTGGGGTCACAGTAAGAGCTTGG - Intronic
1072725939 10:97814064-97814086 CAGGTCACACTGTCAGTGCTAGG - Intergenic
1073065378 10:100755733-100755755 CTGGTTACAGAGTTATTGATTGG - Intronic
1074890174 10:117729344-117729366 CTGGTGACACACTCAGCCCTGGG + Intergenic
1079579691 11:22048232-22048254 CTAGTGACACAGTTAGTACATGG + Intergenic
1081543920 11:44056291-44056313 CAGTTGACACAGCTTGTGCTGGG - Exonic
1083011059 11:59399925-59399947 ATGGTGACACAGTTAGTTTATGG - Intergenic
1084562010 11:69910538-69910560 ACGGTGACACAGTGAGGGCTGGG + Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1090370378 11:126246908-126246930 CTGGTGGCAAATTTAGTTCTAGG + Intronic
1092102953 12:5901295-5901317 CTGGTGACAAAGAAATTGCTGGG + Intronic
1092748261 12:11693720-11693742 CTGGGGACAGAGATAGTGCAGGG - Intronic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1095762334 12:45853744-45853766 CTGCTGACACAGTTCTGGCTTGG + Intronic
1104156721 12:126140189-126140211 CTTGGGACACAGGCAGTGCTGGG - Intergenic
1104659134 12:130596652-130596674 CATGGGACACAGTAAGTGCTCGG + Intronic
1104727328 12:131086044-131086066 CTGGTGACAAAGTGCCTGCTGGG - Intronic
1105901039 13:24753435-24753457 CAGGAGAGCCAGTTAGTGCTTGG + Intergenic
1107457606 13:40569270-40569292 CTGGAGGCAGAGTTACTGCTGGG + Intronic
1107986588 13:45781633-45781655 CTGGTCACACAGTAATCGCTGGG - Exonic
1108147657 13:47496684-47496706 CTGGTGACATTGTCAGTGTTTGG - Intergenic
1109340352 13:61050523-61050545 CTGGGGACTCTCTTAGTGCTGGG - Intergenic
1114191389 14:20441940-20441962 CTGGGGACACAGGCACTGCTGGG - Intergenic
1116434230 14:44878245-44878267 CTGGTGCCCCATTTAGTTCTGGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1124801002 15:32832775-32832797 ATGGAGACTCAGGTAGTGCTTGG + Intronic
1127180077 15:56406111-56406133 CTGGTGCCATAGTTAGAGGTTGG - Intronic
1131717372 15:95127880-95127902 CTGGTGGCTTAGTTAGTGCAGGG - Intergenic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1138431292 16:56970844-56970866 ATGGTGCCACAGTTAATTCTTGG + Intronic
1138853334 16:60656738-60656760 GTGGTGACACACTTTGTGCTTGG + Intergenic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142474140 17:179968-179990 CTGGTGGCACATTTGATGCTTGG + Intronic
1142663721 17:1449284-1449306 CTGGTGAAACAGTTTGTCTTGGG - Intronic
1146625854 17:34434976-34434998 GTGGTGACACAGGAAGTGCATGG - Intergenic
1146909323 17:36638382-36638404 CTGGAAACATAGTAAGTGCTTGG + Intergenic
1153279714 18:3403231-3403253 CTGGTGTCACAAGCAGTGCTTGG - Intergenic
1155612126 18:27677604-27677626 CTGTTCACACAGGTAGAGCTGGG + Intergenic
1156112501 18:33745093-33745115 CTGGTGACGCAGTTACTACAGGG + Exonic
1156647573 18:39184797-39184819 CTGGTGCCACAGATAGCACTGGG - Intergenic
1159487840 18:69088568-69088590 CTGGTGACCAAGTTAGTCTTTGG + Intergenic
1162575693 19:11497559-11497581 CTGGGCACACAGTGAGTGCTGGG + Intronic
1163303645 19:16463488-16463510 CTGCTTACACAGGGAGTGCTTGG - Intronic
1163850464 19:19660170-19660192 CTGGTGCCACACTTAAAGCTGGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166315600 19:41987924-41987946 CTGGTGACAACGTGAGTGCCTGG - Exonic
1167828590 19:51998451-51998473 CTGGTGGAACAGTAAGTGTTAGG - Intronic
1168387583 19:55978461-55978483 CTGGTGAGAGCCTTAGTGCTGGG + Intronic
929363239 2:41120358-41120380 CTGGTGAAACAGGTAGAGCTAGG + Intergenic
932430248 2:71669907-71669929 GTGGTGACACTGGCAGTGCTGGG - Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
937665099 2:124477784-124477806 CTGCTGACACAGATTGTGATTGG + Intronic
938114035 2:128591337-128591359 GAGGTGACAAAGTTAGTGGTGGG - Intergenic
938374854 2:130798440-130798462 CAGCTGACACACTAAGTGCTGGG + Intergenic
939521536 2:143237512-143237534 ATGGTGACACACCTAGTTCTTGG - Intronic
939988225 2:148853180-148853202 CAGGTGATACTGTTAGGGCTGGG - Intergenic
941656507 2:168150294-168150316 CTTATGACACAGTTAGTCCAAGG + Intronic
941948103 2:171122391-171122413 TTGGTGATACAGTTGCTGCTGGG - Intronic
943733272 2:191325900-191325922 CTGGAAACATACTTAGTGCTAGG + Intronic
948864101 2:240766806-240766828 CTCGCGACCCACTTAGTGCTGGG + Intronic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1170681921 20:18533588-18533610 CAGGTGAAGCAGTTAGTGCCTGG + Intronic
1172972249 20:38882136-38882158 CCTGGCACACAGTTAGTGCTGGG + Intronic
1174005997 20:47411286-47411308 CTGGTGCCCCACTTCGTGCTTGG + Intergenic
1174399141 20:50266665-50266687 CAGGTCACACAGTTAGTGAGAGG + Intergenic
1175873405 20:62218853-62218875 CAGGGGACACAGATAGTGCTGGG - Intronic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1180943207 22:19673842-19673864 CTGGGGACAGAGTTAGTCATAGG + Intergenic
1183097719 22:35563354-35563376 CTGGAGACAGAGGAAGTGCTGGG + Intergenic
1184716728 22:46286874-46286896 CTGGTGACCCCTCTAGTGCTTGG + Intronic
952019469 3:28999715-28999737 GTGGTGAGACAATTAATGCTTGG - Intergenic
952202082 3:31140709-31140731 CTGAAGACACAGTTATTCCTTGG + Intergenic
952832603 3:37577441-37577463 CTGGTTCCACTGTTAGTGTTTGG - Intronic
954540600 3:51391118-51391140 CAGGTGACCCTGTGAGTGCTGGG - Intergenic
954922121 3:54200227-54200249 CTGGTTACACAGCTAGTGGGTGG + Intronic
961240196 3:125403973-125403995 CCAGTCACACAGTTAGTGCCAGG - Intergenic
961534289 3:127560163-127560185 ATGGTGGAACAGTAAGTGCTAGG - Intergenic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961601808 3:128068139-128068161 TTAGTGACCCAGTAAGTGCTAGG - Intronic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
962179487 3:133190757-133190779 TTGGTCACACAGTCTGTGCTGGG + Intronic
962898027 3:139733545-139733567 ATGGTGACACAGTTAGTTAGTGG - Intergenic
962966013 3:140355071-140355093 CTGATAACACAGTGAGAGCTGGG - Intronic
962993399 3:140601106-140601128 CTGGAGATGCAGCTAGTGCTGGG - Intergenic
964743587 3:159990752-159990774 TTGGTGACACAGTTCCTTCTTGG + Intronic
965413794 3:168366897-168366919 CTGGTGAAGGAGTAAGTGCTAGG + Intergenic
966434272 3:179865820-179865842 CAGGTGATACTGGTAGTGCTAGG + Intronic
968679135 4:1904157-1904179 CTGGATACACAGGTAGTGATTGG + Intronic
969075807 4:4576719-4576741 CTGGTGTCACAGTCCCTGCTGGG - Intergenic
973152056 4:46900453-46900475 CTGGTGAGACAGTGAGAGCCAGG - Intronic
978445159 4:108773182-108773204 CTGGTGCCCCAGGTAGTGCATGG + Intergenic
978873862 4:113613968-113613990 CTGTTGACACAGTTTCTACTTGG - Intronic
980984071 4:139678595-139678617 CTGGTGACCCAGTGACTGCTGGG - Exonic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
990866565 5:60386856-60386878 TCTGTGACACAGTTTGTGCTTGG + Intronic
991614106 5:68478211-68478233 CTGCTTACATAGTTAGGGCTCGG - Intergenic
991898262 5:71428601-71428623 CTGGTAACACTGTTAACGCTGGG + Intergenic
993110154 5:83646761-83646783 CTGGGAACCCAGTGAGTGCTGGG + Intronic
996129434 5:119763939-119763961 CTGGTGACAGATTTAGTGTGAGG + Intergenic
997599132 5:135127499-135127521 CAGGTGACCCAGTCAGTGGTGGG + Intronic
998275926 5:140753471-140753493 CTGGTGACAATGTTGGTGCTGGG + Intergenic
1001874183 5:175185146-175185168 CTGGTGAGCCAGTTAGTGGGAGG - Intergenic
1003581041 6:7341193-7341215 CAGTTGACACAGCTTGTGCTAGG + Intronic
1007566707 6:42857115-42857137 CTGGTGTCACAGTGTGGGCTTGG - Exonic
1010802356 6:80191355-80191377 CAGTGGACACAGCTAGTGCTTGG + Intronic
1011687247 6:89833322-89833344 CTGGGGATACAGTGAGAGCTGGG + Intronic
1013731978 6:113178813-113178835 CTGGTGTCAAATTTAGTGCAGGG - Intergenic
1023483729 7:40662261-40662283 CTGGTGACACAGTGCAGGCTAGG - Intronic
1025939588 7:66065365-66065387 CTGGTGTCACCGTTAATGTTTGG - Intergenic
1027250629 7:76396629-76396651 ATGGTCACACAGTTAATGCAAGG - Intronic
1028850736 7:95534539-95534561 CTGGTGTCAGGGCTAGTGCTGGG - Intronic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1031660575 7:124419200-124419222 CTGATGAGAAAGTTAGAGCTGGG + Intergenic
1034186112 7:149178599-149178621 CTAGTGAGACAGTTATTGATGGG + Intronic
1034391979 7:150794052-150794074 CAGGTGACTCAGATATTGCTGGG - Exonic
1035170983 7:157017397-157017419 CTGGTGACACTCTTCGTGCCTGG - Intergenic
1037995538 8:23349617-23349639 CTGGTGACTCATTGAGTTCTTGG + Intronic
1043559166 8:81470273-81470295 CTTGTTACTCAGTCAGTGCTGGG + Intergenic
1046729875 8:117713405-117713427 CTGGTGACACAGTTATTGAGAGG - Intergenic
1048629536 8:136226912-136226934 CTATTGATACGGTTAGTGCTAGG + Intergenic
1050675943 9:8053328-8053350 CAGGTGACAGTGTTAGTGCAGGG + Intergenic
1055249191 9:74281902-74281924 CTGGTGACAAATTCAGTGCAGGG + Intergenic
1059127527 9:111706424-111706446 CAGGTCACACAGATAGTGGTGGG + Intronic
1062147618 9:134998704-134998726 TTGGTGACCCAGGGAGTGCTTGG + Intergenic
1193021325 X:76796871-76796893 CTGGTGGCAGAGGTACTGCTTGG + Intergenic
1193940759 X:87678932-87678954 CTGGTCACACTGGGAGTGCTGGG + Intergenic
1194179912 X:90698488-90698510 CTGTTGCCTCAGTTAGTGCAGGG + Intergenic
1195094062 X:101489350-101489372 CTGGTGCCACAGTTGATGCTAGG + Exonic
1195152276 X:102084273-102084295 ATGGTGACCCAGTGACTGCTGGG - Intergenic
1199843589 X:151674943-151674965 CTGGTGGCACAGTTAGTCAAGGG - Intronic
1200526568 Y:4280657-4280679 CTGTTGCCTCAGTTAGTGCAGGG + Intergenic
1201688709 Y:16737379-16737401 CTGGTGATACAGACAGTGTTGGG - Intergenic