ID: 1180697001

View in Genome Browser
Species Human (GRCh38)
Location 22:17757904-17757926
Sequence AGACCAAGTAGAGAACCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180697001_1180697004 10 Left 1180697001 22:17757904-17757926 CCTATGGGTTCTCTACTTGGTCT 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1180697004 22:17757937-17757959 GGAAGCAGAGACAAAACTTCAGG 0: 1
1: 1
2: 2
3: 44
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180697001 Original CRISPR AGACCAAGTAGAGAACCCAT AGG (reversed) Intronic
902806067 1:18862058-18862080 AGGGCATGGAGAGAACCCATGGG - Intronic
903340040 1:22647947-22647969 AGAGGAAGGAGAGAACCCATGGG - Exonic
904542990 1:31246309-31246331 GAACAAAGTAGAAAACCCATTGG + Intergenic
905239987 1:36575328-36575350 AGACAAGCTAGAGAACCCACAGG - Intergenic
908565289 1:65348365-65348387 AGAACAAGTAGACAAAACATTGG - Intronic
911720993 1:101190943-101190965 AGTCCAAGTAGACATCCCAGGGG + Intergenic
912481913 1:109988854-109988876 ACACCAAGTAGAGCCCCAATGGG + Intronic
915815895 1:158964233-158964255 AGACAAAGTCTAGAACTCATTGG + Intronic
915968028 1:160329384-160329406 AGAGCAAGTATAAACCCCATGGG + Intronic
918893607 1:190310163-190310185 ACACCAAGGAAAGAACCCACAGG + Intronic
919072680 1:192775512-192775534 AGACTAAGTAGATAACCCTGGGG + Intergenic
921221993 1:212979957-212979979 TGACCCAGTTGAGAACCCCTGGG - Intronic
923882246 1:238116542-238116564 AGCCCATGTATAGAAACCATGGG + Intergenic
924301415 1:242642401-242642423 AGATGAAGTGGAGAACCCCTTGG - Intergenic
924954273 1:248911816-248911838 AGAGGAAGTAGAGCACCCAGAGG - Intronic
1067364977 10:45617963-45617985 AGAACAAGTAGATAGCTCATGGG - Intronic
1069070508 10:63986790-63986812 AAACCAAGTATAAATCCCATGGG - Intergenic
1071133897 10:82430832-82430854 AGCACAAGTAGAGAGCCCATTGG - Intronic
1072539772 10:96389601-96389623 AAACCAAGGAAAGAGCCCATTGG + Intronic
1074230663 10:111531785-111531807 AGACCAAGAAGAGCATCCAGGGG - Intergenic
1075279358 10:121126520-121126542 AGTCCATGTAGAGAGGCCATAGG - Intergenic
1076169765 10:128309468-128309490 AGTCCAAGTAGAGAAAGAATGGG + Intergenic
1077907027 11:6542545-6542567 AGAGAAAGGAGAGAACCCATAGG - Intronic
1091259940 11:134225614-134225636 AGACAATGGGGAGAACCCATAGG - Intronic
1095616418 12:44195104-44195126 AACCTAAGTAGAGAACCCAGTGG - Intronic
1095823275 12:46504370-46504392 AGAAAAAGTAGAAAACTCATTGG - Intergenic
1098750629 12:74289791-74289813 AGAGCAAGTAGAGAAAACACTGG + Intergenic
1099335977 12:81358104-81358126 AGACCAAGGAGAGGCCGCATGGG - Exonic
1100331766 12:93589366-93589388 AGACAAATGATAGAACCCATGGG - Intergenic
1101633102 12:106514728-106514750 GGACCAAGTGCAGAACCCATAGG + Intronic
1103512927 12:121487656-121487678 TGACCCAGTAGAGAACCCCATGG + Intronic
1105964989 13:25375550-25375572 AGACCAAGTGCAGAACCCAGAGG + Intronic
1106638670 13:31559505-31559527 AGACTAAGTTAAGAACGCATGGG + Intergenic
1106849490 13:33774419-33774441 GGGCCAAGAAGAGAAACCATAGG - Intergenic
1108714277 13:53063631-53063653 AGACCGAGCAAAGAACCCACGGG - Intergenic
1108837174 13:54565416-54565438 AGCCCAAGTAGAGAGCCAGTGGG + Intergenic
1109325982 13:60868653-60868675 AGACCAAATCTACAACCCATTGG - Intergenic
1111148854 13:84221631-84221653 AGAGTAAGTAGACAACCCACAGG + Intergenic
1112656657 13:101458882-101458904 AGTTAAAGTAGAGAACCAATGGG + Intronic
1114532159 14:23402960-23402982 GGACCAAGGAGTGAACCCAGAGG + Intronic
1116416146 14:44679701-44679723 AAACCAGGTATAGAACCAATGGG - Intergenic
1124858341 15:33412555-33412577 AGACCCAGAAGAGAAACCGTGGG - Intronic
1125604648 15:40932988-40933010 ACACCAGGTAGAGACCGCATGGG - Intronic
1129799422 15:78402540-78402562 AGACCCAGTAGAGAACAACTTGG + Intergenic
1130090289 15:80815136-80815158 AGACAGAGTAGAGAAGCCACTGG + Intronic
1131378083 15:91941629-91941651 AGAAAAAGTACAAAACCCATGGG - Intronic
1131546990 15:93323937-93323959 TGACCAAGCAGAGAACCCTCAGG - Intergenic
1132220484 15:100101461-100101483 AGACATAGCAGAAAACCCATAGG - Intronic
1136063186 16:27740759-27740781 ACACCAAGGAGAGACCCCAGAGG + Exonic
1141535375 16:84676187-84676209 TGACCAAGCAGAAAAGCCATTGG - Intergenic
1141628284 16:85273074-85273096 AGAACAAGTAGGGCCCCCATGGG - Intergenic
1143621235 17:8081196-8081218 AGACCAAGGAGAGGACTCAAGGG + Exonic
1143875567 17:9988201-9988223 AGGGCAAGGAGAGAAGCCATGGG - Intronic
1144423897 17:15123249-15123271 AGACCAAGGACAGGACCTATGGG + Intergenic
1148006856 17:44439550-44439572 AGACCAAGGAAAGATCCCAGTGG + Intronic
1149562701 17:57620049-57620071 TAACCAAGTAGAGAACCCTTTGG + Intronic
1153409156 18:4774232-4774254 AGACCAGGTATAGACCCCTTTGG + Intergenic
1154226207 18:12506804-12506826 AAAGCAAGTAGAGAATCCACAGG + Intronic
1156074364 18:33255501-33255523 AGAAAAAGTAAAGTACCCATTGG + Intronic
1156420834 18:36950977-36950999 AGACTGAGTTGAGAAGCCATTGG - Intronic
1158104461 18:53870025-53870047 AGAGCAAGAAGGGAACTCATGGG - Intergenic
1158300867 18:56051177-56051199 AGACCAAGGAGTGAGTCCATGGG + Intergenic
1164800750 19:31074121-31074143 GGACCAAGTAGAGCCCTCATGGG - Intergenic
1166585861 19:43948285-43948307 AGACCAAATCTACAACCCATTGG - Intergenic
1167676868 19:50892725-50892747 ACTCCAGGTACAGAACCCATGGG - Intergenic
927517730 2:23681945-23681967 AGACAAGGTAGAGAGCCCAGCGG - Intronic
928762828 2:34604758-34604780 AGACTGAGAATAGAACCCATTGG + Intergenic
930540466 2:52699682-52699704 AGACCAAGCAGAAAACAGATTGG + Intergenic
940213610 2:151281546-151281568 AGACCCAGAAGGGAACCCAAGGG - Intronic
943132942 2:183878237-183878259 AGAGTAAGCAGACAACCCATAGG - Intergenic
944889633 2:204103900-204103922 AGACTAAGTAGTGGTCCCATAGG - Intergenic
945874913 2:215268004-215268026 AGCCCATGAAGAGAACTCATGGG - Intergenic
1170151005 20:13225917-13225939 AGACAAAATATAGAATCCATAGG + Intronic
1174688178 20:52475839-52475861 AAACCAAGTTGAGAAGACATAGG - Intergenic
1178911140 21:36674629-36674651 AGACCATGTGGAGAAGCCAGAGG + Intergenic
1180697001 22:17757904-17757926 AGACCAAGTAGAGAACCCATAGG - Intronic
1180976473 22:19851464-19851486 TGACCAAGGAGAGCACCCCTGGG - Exonic
1181144122 22:20831957-20831979 AGACCAAATATACAACTCATTGG - Intronic
1184932293 22:47690388-47690410 AGAGTAAGTAGAGAACCTGTTGG + Intergenic
954191054 3:48961466-48961488 AGACAAAGCAGAGAACCAAGAGG + Intronic
955245148 3:57217986-57218008 ATACAAAGTGGAGAAGCCATGGG - Intronic
956580074 3:70801001-70801023 AAACCAAATAGAGAACTAATGGG - Intergenic
958729129 3:97941846-97941868 AGAAAAAGTAGATAATCCATTGG - Exonic
959694046 3:109230838-109230860 AGAATAAATAGACAACCCATAGG + Intergenic
961129157 3:124449278-124449300 AGACCAAGTAGAAGAACCATTGG + Intronic
962926628 3:139999534-139999556 TGACCAAGCAGATAACCCACAGG - Intronic
964146995 3:153475729-153475751 AGACAAAGTAGAAAACCTAGAGG - Intergenic
964262011 3:154849829-154849851 AGACCAAGGATAGAATCCTTGGG + Intergenic
970809307 4:20072960-20072982 AGACCAATCAGAGAACCCTGAGG + Intergenic
972057079 4:34816381-34816403 AGACCAAATTGATAACTCATTGG + Intergenic
976380951 4:84398027-84398049 ATACCAAGTCCAGAAACCATTGG - Intergenic
979810389 4:125029181-125029203 AGATAAAGTATAGAACCCAAGGG + Intergenic
981926552 4:150146905-150146927 AGACAATGTAGATAACCCTTAGG - Intronic
983287201 4:165754800-165754822 GGACCAAGGACAGAACCCAGAGG + Intergenic
983633550 4:169875118-169875140 ATACCAAGCATAGAATCCATGGG - Intergenic
986204038 5:5606690-5606712 AGACTAAATAAAAAACCCATTGG + Intergenic
986249241 5:6041327-6041349 AGACAAAATACAAAACCCATAGG - Intergenic
990072373 5:51799580-51799602 AAACAAAGCAGACAACCCATTGG + Intergenic
990843696 5:60112788-60112810 GGTCCAAGTAGAGAACACAGAGG + Intronic
991334192 5:65528728-65528750 ATAACAAGTAGAGAAACCAAAGG + Intronic
993007075 5:82440185-82440207 TGAGCAAGTACAGAAGCCATTGG + Intergenic
1000583634 5:163066032-163066054 AGACCTAGTAGAGAACCTAATGG + Intergenic
1000626261 5:163542748-163542770 AAACCAAGTATATATCCCATTGG - Intergenic
1001108745 5:168877669-168877691 AGACTAACTAGAGAACACAAAGG + Intronic
1011503568 6:88016979-88017001 AGACCAAGTAGCTAGGCCATTGG - Intergenic
1012423882 6:99093646-99093668 AGACCAAGTAGCAAACCAGTGGG - Intergenic
1014076733 6:117244522-117244544 AGATTAAGTAGAAAATCCATTGG + Intergenic
1014712425 6:124822868-124822890 AGAGCAAGTAGAGATCTGATTGG + Intronic
1017368964 6:153682073-153682095 AGACCAAATATACAACTCATTGG + Intergenic
1018096168 6:160389016-160389038 AAACCAAGGAGAGAAGCCAAGGG + Intronic
1019951966 7:4380564-4380586 AGTCCAACTGGAGTACCCATTGG + Intergenic
1020038731 7:4985069-4985091 AGACCAAGTAGAGTACCTTTCGG - Intronic
1020156570 7:5729416-5729438 AGACCAAGTAGAGTACCTTTCGG + Exonic
1022146812 7:27551848-27551870 AGATCAAGAAGAGGACCAATGGG + Intronic
1031714827 7:125096078-125096100 ACACCAATTAGAGAAGCCCTAGG - Intergenic
1031746964 7:125511427-125511449 AAACCAAGTAGAAAACCAAGAGG + Intergenic
1033161238 7:138998994-138999016 AGACAAAGTAGAGATGTCATGGG - Intergenic
1044185981 8:89252760-89252782 AGACCAAATAAATAACTCATTGG - Intergenic
1047445102 8:124912635-124912657 TGACCAGGTAGAGAGCCCATTGG + Intergenic
1047903066 8:129444678-129444700 AGAGAAGGTAGAGAACCCAATGG + Intergenic
1048521325 8:135158123-135158145 AGAGCAAGTATAGCACCAATTGG - Intergenic
1051297662 9:15613931-15613953 AAACCAAGTAGAGATTTCATTGG - Intronic
1051748375 9:20317103-20317125 AGACACAGGAGAGCACCCATGGG - Intergenic
1055851882 9:80641698-80641720 ATACCAAGACAAGAACCCATGGG - Intergenic
1186164191 X:6809265-6809287 TGACCATGTTGAGAACCCATGGG - Intergenic
1187999210 X:24963413-24963435 ACAGCCGGTAGAGAACCCATAGG + Intronic
1189136013 X:38550962-38550984 CAACCAAATAGAGAACCCAGAGG - Intronic
1192011672 X:67279384-67279406 AGACAAAATATACAACCCATTGG + Intergenic
1193357897 X:80543484-80543506 AGACCAAATACACAACTCATTGG + Intergenic
1197556415 X:127960483-127960505 AGACTAAATAGACAACCCACAGG - Intergenic
1199465378 X:148129544-148129566 AGAACAGGTAGAAAACACATTGG + Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200515472 Y:4139240-4139262 AGACCAAATATATAACTCATTGG - Intergenic
1200962995 Y:9012070-9012092 AGACCATGGAGACAACCCAAGGG + Intergenic