ID: 1180697953

View in Genome Browser
Species Human (GRCh38)
Location 22:17765463-17765485
Sequence AACCTTGGACTGATACTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180697953_1180697955 2 Left 1180697953 22:17765463-17765485 CCATTTAGTATCAGTCCAAGGTT 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1180697955 22:17765488-17765510 AAGTTACCTAAGCTTTATTTTGG 0: 1
1: 0
2: 2
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180697953 Original CRISPR AACCTTGGACTGATACTAAA TGG (reversed) Intronic
901294717 1:8152111-8152133 AAACCTGGATTGATACGAAATGG - Intergenic
902085745 1:13860310-13860332 ATCCTTGAAATGATAGTAAAAGG - Intergenic
903947927 1:26975628-26975650 AGCCTTGGGCTGATATTAAGCGG - Intergenic
904985304 1:34542377-34542399 ATCAATGGACTGATTCTAAAGGG + Intergenic
912247845 1:107979317-107979339 TGCCTTTGACTGATGCTAAATGG + Intergenic
913080510 1:115381040-115381062 AGCATTGCTCTGATACTAAAAGG - Intergenic
919032379 1:192259677-192259699 AATCTGGGACTAAAACTAAAAGG - Intergenic
921407221 1:214793549-214793571 GACCTTGGGCTGATACTACTTGG + Intergenic
923363563 1:233236633-233236655 AACCTTGGGTTGATATTAACAGG - Intronic
923966387 1:239144655-239144677 AAACTTGAACTGTTACTAAAAGG + Intergenic
1063848942 10:10162662-10162684 AACCTTGAATTGAAATTAAAAGG + Intergenic
1064944812 10:20775587-20775609 AACCTTTGAATGATCCTAAGAGG + Intergenic
1068410981 10:56653894-56653916 AGCCTTGGACTGAAATTCAATGG - Intergenic
1068438111 10:57017156-57017178 AACCTAGCACTGATACTATATGG + Intergenic
1076023902 10:127096698-127096720 AACCTTAAGCTGATACTAGATGG + Intronic
1078698548 11:13659267-13659289 AACTTTAGAGTGATACTATAGGG + Intergenic
1080410757 11:32022836-32022858 TACCTGGGACTGATATTCAAGGG - Intronic
1080432790 11:32214190-32214212 ACCCTTGAACTGAAACTAAAAGG + Intergenic
1081080643 11:38735218-38735240 AACCCTTGACTGAGACTATATGG - Intergenic
1081736869 11:45410447-45410469 AGCCTTGGTCTGAACCTAAAGGG - Intergenic
1083030978 11:59591921-59591943 AACCTTGGACTGAGAGTACTGGG - Intronic
1084778031 11:71390107-71390129 AACCTTGGACTCATGACAAAAGG + Intergenic
1099193894 12:79591863-79591885 AACCTTGGAACGATAAAAAAAGG + Exonic
1105817008 13:24045368-24045390 AAACTTTGGCTCATACTAAAAGG - Intronic
1105994994 13:25662404-25662426 AACTTTTGACTGATTCTATATGG + Intronic
1111663770 13:91242719-91242741 AACCTAAGGCTGAAACTAAAAGG - Intergenic
1113662812 13:112118640-112118662 CACCTTGGGATGATTCTAAAAGG + Intergenic
1118881497 14:69830230-69830252 AACCTTTGACTGATTTTAAGTGG + Intergenic
1124170579 15:27368932-27368954 GACCTTGGACAGATAGTCAAGGG + Intronic
1126564826 15:50084245-50084267 ACACTTGGACTGATATTAGAAGG - Intronic
1134428830 16:14181239-14181261 ACCTTTAGACTGTTACTAAATGG - Intronic
1148257697 17:46150094-46150116 TTCCTTGGCCTGATACTCAAAGG + Intronic
1153154865 18:2136856-2136878 AACAATGGAGTGATACTACACGG + Intergenic
1160042379 18:75357439-75357461 AAACTTGGTCTGATACTTAAAGG - Intergenic
1167965346 19:53140414-53140436 AGGCTTGAACAGATACTAAAGGG + Exonic
932680397 2:73819617-73819639 AACATTGGAAAGATACAAAATGG + Intergenic
934087189 2:88519681-88519703 AACCCTGCCCTGACACTAAAAGG - Intergenic
934649974 2:96085159-96085181 AAACTTGGCCTCATACCAAAAGG - Intergenic
934649999 2:96085290-96085312 AAACTTGGCCTCATACCAAAAGG - Intergenic
935601293 2:104924562-104924584 AACTTTGGACTCATATTAACAGG + Intergenic
937053903 2:118914949-118914971 AAGCTTGGACTTAGAATAAAAGG - Intergenic
940457385 2:153917784-153917806 AGCCTTGGAGTCAAACTAAAAGG + Intronic
940614263 2:156030319-156030341 AAGCGTGGACTGTTACAAAATGG + Intergenic
941102724 2:161314114-161314136 ATCATTGGACTAATTCTAAATGG - Intronic
945873260 2:215250288-215250310 AACCTTGTACAGATATAAAATGG + Intergenic
1169886498 20:10404309-10404331 AACCATAGACTGATAGAAAAAGG - Exonic
1171824543 20:29882441-29882463 AAACTTTGAGTGATACTGAAGGG + Intergenic
1174913069 20:54627506-54627528 AGCCCTGGACTGATACTCACTGG + Intronic
1177536036 21:22428523-22428545 AACTTTGGTTTAATACTAAATGG + Intergenic
1177681485 21:24377036-24377058 TACCATGGACTGAGAATAAATGG - Intergenic
1180697953 22:17765463-17765485 AACCTTGGACTGATACTAAATGG - Intronic
952509949 3:34042943-34042965 GACATTGGGCTGCTACTAAAAGG + Intergenic
956061756 3:65355415-65355437 AACCATGGGCTTCTACTAAAAGG + Intronic
964432781 3:156623546-156623568 AACCTTGTACTGACACCATATGG + Intergenic
968992204 4:3921993-3922015 ACCCTGGGAATGATACTAAGGGG + Intergenic
970194319 4:13540712-13540734 ATCCTTGGTCCGAGACTAAAAGG + Intergenic
970612393 4:17737947-17737969 AACCATGAAATGATACAAAATGG + Intronic
971292918 4:25360866-25360888 AACCTAGTACTGATACCATATGG + Intronic
972369004 4:38404131-38404153 AACGTTGGACTGAAACTGGAGGG + Intergenic
974650899 4:64752826-64752848 TACCAAGGACTGTTACTAAAAGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
984868282 4:184302709-184302731 AACCTTAGAGAAATACTAAAAGG + Intergenic
985369615 4:189271800-189271822 AAGCTTTGAGTGATACTGAAGGG + Intergenic
986883800 5:12208778-12208800 AACCTTGGAGAGATACTAAATGG - Intergenic
987599977 5:20055233-20055255 AGCCTTGAACTGATCCCAAAAGG - Intronic
993212035 5:84963541-84963563 AATCTCGCACTGAAACTAAAAGG + Intergenic
998210990 5:140198183-140198205 AACATGGGACTGATACTATGGGG - Intronic
998910792 5:146957980-146958002 AACCTAGGACTGACAGAAAAGGG + Intronic
1001975393 5:175994544-175994566 AACTTTGGACAGATTCTCAAAGG - Intronic
1002242040 5:177849226-177849248 AACTTTGGACAGATTCTCAAAGG + Intergenic
1008594698 6:53029833-53029855 ATCCTTGGACTGAGAGTAAATGG + Intronic
1010112768 6:72260345-72260367 AAATTTGGCCTGATACTAATGGG - Intronic
1010162380 6:72871792-72871814 ATCCTTGGACTAATACTCAGAGG - Intronic
1011698499 6:89934219-89934241 AACCTTGGGCTAGTACTCAAGGG - Intronic
1014603735 6:123447487-123447509 AACCTCAGACTGAATCTAAAAGG + Intronic
1016059131 6:139610288-139610310 AACTATGGAATGATTCTAAAAGG + Intergenic
1024694586 7:51841838-51841860 ACCCATGGAGAGATACTAAATGG + Intergenic
1028760899 7:94495325-94495347 AACATTGGAATGATACAAGAAGG + Intergenic
1030737199 7:113063624-113063646 AACCTTTGAATGATACCAGATGG + Intergenic
1035086896 7:156267710-156267732 AACGTTGGACTGTTAGGAAAGGG + Intergenic
1035656724 8:1313598-1313620 GACTTTGGACTGTTACTGAATGG - Intergenic
1035848383 8:2889427-2889449 GACCATGCACTCATACTAAAAGG + Intergenic
1037058142 8:14470602-14470624 AAACTTGGACAGAAAATAAATGG - Intronic
1041914714 8:63127423-63127445 AATCTTGGACTAATTCAAAATGG - Intergenic
1055681993 9:78724801-78724823 CACCTAGGAATGATACTAAGGGG + Intergenic
1055828743 9:80357100-80357122 AACCATGGACTGATGGAAAAAGG + Intergenic
1058386628 9:104444170-104444192 AGGCTTGGTTTGATACTAAAAGG + Intergenic
1186060177 X:5696396-5696418 AAACTTGGAATGAAAATAAAGGG + Intergenic
1187745572 X:22405498-22405520 AACATTGTACTGATGCTACAGGG - Intergenic
1193982189 X:88195832-88195854 AACAATGGACTTAAACTAAATGG + Intergenic