ID: 1180699390

View in Genome Browser
Species Human (GRCh38)
Location 22:17773465-17773487
Sequence GTGTGGATAAGGCTCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180699381_1180699390 4 Left 1180699381 22:17773438-17773460 CCCCCACAGTGAGAGCGAGGACT 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1180699390 22:17773465-17773487 GTGTGGATAAGGCTCCAGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 162
1180699379_1180699390 15 Left 1180699379 22:17773427-17773449 CCTCTGCAGCTCCCCCACAGTGA 0: 1
1: 0
2: 3
3: 37
4: 292
Right 1180699390 22:17773465-17773487 GTGTGGATAAGGCTCCAGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 162
1180699383_1180699390 2 Left 1180699383 22:17773440-17773462 CCCACAGTGAGAGCGAGGACTGA 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1180699390 22:17773465-17773487 GTGTGGATAAGGCTCCAGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 162
1180699384_1180699390 1 Left 1180699384 22:17773441-17773463 CCACAGTGAGAGCGAGGACTGAG 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1180699390 22:17773465-17773487 GTGTGGATAAGGCTCCAGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 162
1180699382_1180699390 3 Left 1180699382 22:17773439-17773461 CCCCACAGTGAGAGCGAGGACTG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1180699390 22:17773465-17773487 GTGTGGATAAGGCTCCAGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 162
1180699378_1180699390 21 Left 1180699378 22:17773421-17773443 CCGCATCCTCTGCAGCTCCCCCA 0: 1
1: 1
2: 8
3: 94
4: 727
Right 1180699390 22:17773465-17773487 GTGTGGATAAGGCTCCAGGAAGG 0: 1
1: 0
2: 3
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180699390 Original CRISPR GTGTGGATAAGGCTCCAGGA AGG Intronic
901405166 1:9040280-9040302 GTGGGGTGCAGGCTCCAGGAGGG + Intronic
901416762 1:9121842-9121864 GTGTGGGTATGACTCCAGCAGGG - Intronic
902542805 1:17166486-17166508 GTGGGGAGAAGACTCCAGGCTGG + Intergenic
903569568 1:24294332-24294354 GGATGGATAAGGCTCCATAAGGG + Intergenic
906205752 1:43985475-43985497 GACTGGAACAGGCTCCAGGAAGG - Intronic
907469770 1:54665764-54665786 GTGTGGACAAGGCTGCTTGATGG + Intronic
907899812 1:58728053-58728075 GTGAGCATTAGACTCCAGGAAGG + Intergenic
909532888 1:76700644-76700666 GTTTGGATGAGGCCACAGGAAGG - Intergenic
909639851 1:77860612-77860634 GTGTGCAAATGGCTCAAGGAAGG - Intronic
909914043 1:81295505-81295527 GTTTGCATATTGCTCCAGGATGG - Intergenic
912490810 1:110061658-110061680 ATGGGGAGCAGGCTCCAGGATGG + Intronic
914257808 1:145974963-145974985 GAGTGGAGAAGGCTGCAGGGTGG - Exonic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
914984362 1:152443273-152443295 GAGTGGATCAGTCTCCAGGAAGG + Intergenic
915325422 1:155079284-155079306 GTGTGGAGGAGGCTGCTGGAGGG + Intronic
921568026 1:216744139-216744161 GGGTGGATAAGGAACCATGAGGG + Intronic
922807255 1:228396905-228396927 GTGGGGAGATGACTCCAGGAGGG - Intronic
1064143955 10:12812735-12812757 GTGGGCCTAAGGCTGCAGGAAGG - Intronic
1065071033 10:22023821-22023843 ATATGTACAAGGCTCCAGGAAGG - Intergenic
1067427002 10:46217911-46217933 AGGGGGCTAAGGCTCCAGGAGGG - Intergenic
1067696199 10:48537332-48537354 ATGAGGAGAGGGCTCCAGGAAGG - Intronic
1067716060 10:48691897-48691919 GTGTGCAGAAGGCTGCAGGGTGG + Intronic
1070656909 10:78277939-78277961 GAGTGGAGAAGGCTCCAGGAGGG + Intergenic
1071417727 10:85456817-85456839 GTGTGTGTAAAGGTCCAGGAAGG + Intergenic
1073061586 10:100736703-100736725 GTGGGGACAAGGCCCTAGGAGGG - Intronic
1074165746 10:110872289-110872311 GTGGGGAGATGGCTCCGGGAGGG - Intronic
1074680691 10:115904062-115904084 GTGTGGGGAAGGCTAAAGGAAGG + Intronic
1075081304 10:119385701-119385723 GTAAGGATGAGGCTGCAGGAGGG + Intronic
1075644931 10:124091362-124091384 GGATGGATAATGGTCCAGGAAGG + Intronic
1079438211 11:20479821-20479843 GTGTGTATCTGGATCCAGGAGGG - Intronic
1080266443 11:30406760-30406782 TTGTGGGGAAGGTTCCAGGATGG - Intronic
1082071633 11:47944107-47944129 GTTTGGAAAAGTCACCAGGAGGG + Intergenic
1083693357 11:64425282-64425304 GTGTAGAGAAGGGTCCATGAAGG + Intergenic
1084412647 11:69013340-69013362 GCGGGGATGAGGCTTCAGGAAGG + Exonic
1084468155 11:69339383-69339405 GGGAGGATGAGGCTACAGGAGGG - Intronic
1084493130 11:69489028-69489050 GTGTAGATAAGGCTTCAGAAAGG + Intergenic
1087053056 11:93905465-93905487 GTGGGAATGAGCCTCCAGGAGGG - Intergenic
1090994376 11:131852097-131852119 GTGTGGGGAAGGCTCCTGCAGGG + Intronic
1091295741 11:134472900-134472922 GTTTGGACAAGGCTCCATCAAGG + Intergenic
1091344815 11:134845510-134845532 GTCTGTGAAAGGCTCCAGGAGGG + Intergenic
1091765789 12:3119198-3119220 GGGTGGATAAGATACCAGGAGGG + Intronic
1092023490 12:5222049-5222071 GAGTGGATAAAGCACCAGGGGGG + Intergenic
1092247234 12:6870489-6870511 GTTTGGATGAGGCCACAGGAAGG - Exonic
1092478505 12:8839280-8839302 ATGTGGCTATGGCTGCAGGAAGG - Intronic
1095528420 12:43155784-43155806 GAGTGGATAGAACTCCAGGATGG + Intergenic
1096111518 12:49031810-49031832 CTGTAGATAAGGCTCCTGGTGGG + Exonic
1098114800 12:67163775-67163797 GAATGGATATGTCTCCAGGAAGG - Intergenic
1100588007 12:95997360-95997382 GTTTCAATAAGGCTCAAGGAAGG - Intergenic
1102001491 12:109560603-109560625 GGGTGCATAAGGCTCCTGAAAGG - Intronic
1102245331 12:111352409-111352431 CTGTGCATCAGGCTGCAGGAGGG + Intergenic
1104645433 12:130494213-130494235 GTGTGGAGTGGGCTCCAGGAGGG - Intronic
1106298465 13:28440094-28440116 GGGTGGAGAAGGGTGCAGGAAGG - Intronic
1113851288 13:113419914-113419936 GTGTGGAGGAGGCTCCTGGGAGG + Intergenic
1115034202 14:28837703-28837725 GTGTTGATAAGGCTGCAGGAGGG - Intergenic
1117070654 14:52052979-52053001 ATGAGGACAAGGCTCCAGGGAGG + Intronic
1125336146 15:38628123-38628145 ATGTTGACAAGGCTCCTGGAAGG + Intergenic
1128366275 15:67005710-67005732 TTTCTGATAAGGCTCCAGGAGGG - Intergenic
1129408103 15:75332903-75332925 GTGTCTGTAATGCTCCAGGAAGG + Intergenic
1129506663 15:76087201-76087223 GTGTGGAGAAGGCTGAAAGAGGG + Intronic
1130040516 15:80402599-80402621 GTGGGGAGAAGGATCCAGAAGGG + Intronic
1131463643 15:92637535-92637557 ATGTGGAAAAAGCCCCAGGAAGG - Intronic
1133681823 16:8126926-8126948 GAGGGGATAAGGATCCAGGAGGG + Intergenic
1135222207 16:20623006-20623028 GTCTGGATGAGGCCCCAGCAAGG - Intronic
1137751181 16:50862300-50862322 GTGTGCATAAAATTCCAGGACGG + Intergenic
1138096173 16:54213686-54213708 GAGTGGATAACCCACCAGGAGGG - Intergenic
1138551444 16:57751027-57751049 GTGTGGATGTGGCTGCAGAAAGG - Intronic
1139176813 16:64699271-64699293 GTGTGGAGAAGGCTGCAGAGAGG - Intergenic
1139184972 16:64795207-64795229 TTGTGGAGAATGCCCCAGGATGG + Intergenic
1139368368 16:66447919-66447941 ATGTGGAAAATGCCCCAGGAGGG + Intronic
1139947039 16:70648611-70648633 GAGGGGAAAAAGCTCCAGGAGGG + Intronic
1140984987 16:80149862-80149884 ATGTGGAAAAGTCTGCAGGATGG + Intergenic
1141758818 16:86013340-86013362 GTTGGGAAAAGCCTCCAGGAGGG + Intergenic
1143371192 17:6440690-6440712 GTGTGGGAAAGACTCCATGAAGG - Intergenic
1143490884 17:7284677-7284699 GTGTGGAGCAGCCTCCAGGCAGG + Intronic
1143575750 17:7792197-7792219 GGCTGGAGAAGGCTCAAGGAAGG + Intronic
1143789446 17:9281988-9282010 GTGGGGAGAAGGCCCCAGGAGGG - Intronic
1143858301 17:9869212-9869234 GTGAGGGTAAGGCTGGAGGAGGG - Intronic
1144601821 17:16622596-16622618 CTGTGGAAAAGCCTTCAGGAGGG - Exonic
1144630758 17:16871033-16871055 GTGAAGATGGGGCTCCAGGAAGG + Intergenic
1146407825 17:32554388-32554410 GTGTGGAGAAGGTTCCAGAGGGG - Intronic
1147167496 17:38601313-38601335 GCGTGGATGGGGCTCCAGGCAGG + Intronic
1148073497 17:44922162-44922184 TTGTGAAGAAGGATCCAGGAGGG - Intergenic
1150851749 17:68709909-68709931 GTGAGTATAAGGCTCCAGTTGGG - Intergenic
1150879947 17:69013428-69013450 GTGTAGATAAGGCCCTGGGAGGG + Intronic
1151267159 17:72965730-72965752 GTGTGGAAAAGATACCAGGATGG + Intronic
1152910268 17:83000950-83000972 GTGTGGGGAGGGCTCCGGGATGG + Intronic
1155201215 18:23519411-23519433 GTGGGGCTAAGGCTGGAGGATGG + Intronic
1156391637 18:36656067-36656089 GTGTGGATCAGGCTGCATCAGGG + Intronic
1156913262 18:42436466-42436488 GTGTGGTTAGGGCTACAGCAGGG + Intergenic
1157601858 18:48897712-48897734 GTGAGGACAAGACTGCAGGAAGG - Intergenic
1160580141 18:79879052-79879074 GTGGGGGTCAGGCTCCTGGAGGG + Intronic
1161666464 19:5579977-5579999 GTGTGCAGAAGCCCCCAGGAAGG - Intergenic
1163234565 19:16023073-16023095 GTGGGGATGTGGCTCCTGGAAGG - Intergenic
1163590934 19:18193745-18193767 GTGAGGCTGAGGCTCCGGGATGG + Intronic
1166977333 19:46612322-46612344 GATTGGATGAGGCTACAGGAAGG + Intergenic
926741100 2:16111568-16111590 GTGTGGCTGAAGCTCCAGGCCGG + Intergenic
928630339 2:33185104-33185126 GTGTGGATAAAGCTCTGGAAGGG + Intronic
929763995 2:44829189-44829211 GAGTGGAGAAGGCTCCATAACGG + Intergenic
929950651 2:46407210-46407232 GGGTGGGTGAGGCTTCAGGAAGG + Intergenic
931229165 2:60359683-60359705 GTGTGAACAAGACTGCAGGAGGG - Intergenic
933942011 2:87252863-87252885 GTGATGATGAGGCACCAGGAGGG + Intergenic
938654126 2:133413216-133413238 GACTGGAAAAGGATCCAGGAAGG + Intronic
938688924 2:133768664-133768686 GTGTGGCTGGGGCTCCAGGGAGG - Intergenic
944055916 2:195521641-195521663 GTCTGGATAAGGCTCAAGGACGG - Intergenic
944905434 2:204257237-204257259 GTGGGGATAAGACTCCCGGGAGG + Intergenic
945249740 2:207754740-207754762 GTGTGGCTGAGGCTAGAGGATGG - Exonic
946180513 2:217946203-217946225 GTCTGGAGAAGGATCCAGGGAGG - Intronic
946711444 2:222511190-222511212 GTGTGGAAAAGCTTCCAGCATGG - Intronic
948313822 2:237011355-237011377 GTGTGGAGAATTCTGCAGGAGGG - Intergenic
1168997148 20:2142042-2142064 GAGGGGATAAGGCTTCTGGAAGG - Intronic
1171093340 20:22306816-22306838 ATGTGGATAATGCACTAGGACGG + Intergenic
1172216774 20:33241320-33241342 GTGTGGAGAAGTCTCCAGAGGGG - Intronic
1180699390 22:17773465-17773487 GTGTGGATAAGGCTCCAGGAAGG + Intronic
1181020717 22:20100781-20100803 GTGTGGAAAAAGCCCCAGGCAGG - Intronic
1181670009 22:24421587-24421609 GTGAGGATATGGGTCCTGGAAGG + Intronic
1185354855 22:50362110-50362132 GTCTGCATTGGGCTCCAGGAAGG + Intronic
949513417 3:4786094-4786116 GTGTGCATCTGGGTCCAGGAGGG - Intronic
950506926 3:13400766-13400788 GTGTGACCAAGGCCCCAGGAGGG + Intronic
954632645 3:52055693-52055715 GTGGGGACCCGGCTCCAGGAGGG + Intronic
956253610 3:67260894-67260916 GTGTGGATCATGTTCAAGGATGG + Intergenic
956841545 3:73144463-73144485 GTGTGACTGAAGCTCCAGGAGGG + Intergenic
958929203 3:100190951-100190973 GTGTGGAGAATGCTGCAGGGGGG + Intronic
961002800 3:123385201-123385223 GTGTGGTTCTGGCTCCAGGGTGG - Intronic
961929982 3:130522932-130522954 GTGTGGAGAATGCTACAAGAGGG - Intergenic
962277741 3:134029034-134029056 GTCTGGAAATGGCCCCAGGAAGG - Intronic
963023894 3:140899699-140899721 GTGGGGGTTAGGCTCCAAGAGGG + Intergenic
964230487 3:154461310-154461332 GTGTGGATAAGGATAAAGAAGGG - Intergenic
964443729 3:156739080-156739102 GTGTGGACAAGTCTGGAGGATGG - Intergenic
966139207 3:176735457-176735479 GTGTGTATGAGACTCCATGATGG - Intergenic
966160458 3:176962123-176962145 GTGAGCAAATGGCTCCAGGAAGG + Intergenic
967389893 3:188945348-188945370 GTGGGGAGAAGGGTTCAGGATGG - Intergenic
970847532 4:20559062-20559084 GTGAGGATAATGCTACAGGTGGG + Intronic
974166067 4:58204504-58204526 GGGTGGATAAGACTTCAGCAAGG - Intergenic
982189870 4:152843210-152843232 GAGTGTATCTGGCTCCAGGATGG + Intronic
990147242 5:52776046-52776068 GGGTGGAAAAGGGTCCAGAATGG - Intergenic
990258917 5:54000165-54000187 GTTTGGAGGAGGCTCCAGCAAGG + Intronic
994712578 5:103283458-103283480 GTGTGGGTAAGGCTTCACCAGGG + Intergenic
1001460349 5:171906816-171906838 GCGTAGATAAGGCTTTAGGATGG - Intronic
1004140192 6:13011024-13011046 GTGTGAAGAAGGGCCCAGGATGG - Intronic
1004462124 6:15847462-15847484 GTGTGGCTGAGGCTAGAGGATGG + Intergenic
1006878431 6:37318329-37318351 TTATGGAGAAGGCTACAGGATGG + Intronic
1011190806 6:84726310-84726332 GTGTGGATGATGCTTCTGGAGGG - Intronic
1014485577 6:121994886-121994908 GTGTGGAAAAGGCCTCAGGCAGG + Intergenic
1018344681 6:162888258-162888280 TTGTGGCCAAGACTCCAGGATGG - Intronic
1018918888 6:168157036-168157058 GGGTGGATAAATCTCCATGACGG - Intergenic
1020486184 7:8723797-8723819 GTGTAGATAGGATTCCAGGAAGG + Intronic
1023805786 7:43872052-43872074 CTCTGCATTAGGCTCCAGGAAGG - Intronic
1027431291 7:78115094-78115116 GTGAGAATAAGACTCCTGGAAGG + Intronic
1028507131 7:91582942-91582964 CTGCTGATAAGGCTGCAGGATGG - Intergenic
1031170418 7:118286126-118286148 GTCTGGGTAAGGCTCAAGGAGGG - Intergenic
1032439083 7:131928204-131928226 GTGAGGAAAAGGCTCTGGGAAGG - Intergenic
1032462299 7:132121146-132121168 TTGTTATTAAGGCTCCAGGATGG + Intergenic
1032952934 7:136937215-136937237 GTGTGTTTAAGTCACCAGGAAGG - Intronic
1033398582 7:140999897-140999919 GTTAGGGAAAGGCTCCAGGATGG + Intergenic
1033724808 7:144103618-144103640 GTGAGGATGAGGGACCAGGAGGG - Intergenic
1034326879 7:150244607-150244629 GTGTGGAAAAGGCTCCCAAATGG - Intronic
1037923875 8:22829595-22829617 GAGTGGCTCAGGCCCCAGGAAGG + Intronic
1039274644 8:35921692-35921714 GTTTGCATAAGACTGCAGGAAGG - Intergenic
1040413983 8:47181290-47181312 GTGTGGAGAAGGCTGCAAGGGGG - Intergenic
1040697717 8:50022343-50022365 GAGTGGAGAAGGATCCAGCAAGG + Intronic
1042101773 8:65282008-65282030 GTATTGAGAATGCTCCAGGATGG - Intergenic
1043949496 8:86291991-86292013 CTGTGGATAGGTGTCCAGGAAGG - Intronic
1047229676 8:122985752-122985774 GAATGGCTAGGGCTCCAGGAAGG + Intergenic
1058503387 9:105645681-105645703 GTCTAGAAAAAGCTCCAGGAAGG + Intergenic
1060205233 9:121678867-121678889 GGGTCCATGAGGCTCCAGGAAGG - Intronic
1060818034 9:126645661-126645683 GTGTGCTCAAGGCTCCTGGAGGG - Intronic
1061362433 9:130152162-130152184 GTGTGGACAAGGCTCCCAGCAGG - Intergenic
1062125079 9:134855827-134855849 GGGTGGGCAAGGCTCCAGGGAGG - Intergenic
1062389842 9:136329602-136329624 ATGTGGATGGGGCTCCAGGTTGG + Intronic
1062636117 9:137492669-137492691 GGGTGGGTGAGGCTCCAGGATGG + Intronic
1186142432 X:6589968-6589990 GTGTGCAGAAGACACCAGGAAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1200137912 X:153883793-153883815 GAGTGGCCCAGGCTCCAGGAGGG - Intronic
1200897865 Y:8394992-8395014 TTGTGGATAGGGCTCCAGCAGGG + Intergenic