ID: 1180701082

View in Genome Browser
Species Human (GRCh38)
Location 22:17781749-17781771
Sequence TCACCCCCATGGTGAAATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180701080_1180701082 -1 Left 1180701080 22:17781727-17781749 CCTGGGGGGGTGAAAATCATGTT No data
Right 1180701082 22:17781749-17781771 TCACCCCCATGGTGAAATCACGG No data
1180701079_1180701082 5 Left 1180701079 22:17781721-17781743 CCAGAGCCTGGGGGGGTGAAAAT No data
Right 1180701082 22:17781749-17781771 TCACCCCCATGGTGAAATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180701082 Original CRISPR TCACCCCCATGGTGAAATCA CGG Intergenic