ID: 1180707113

View in Genome Browser
Species Human (GRCh38)
Location 22:17816855-17816877
Sequence CGGCCTCCTTGGCTGCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180707113_1180707123 -10 Left 1180707113 22:17816855-17816877 CCCATGTGCAGCCAAGGAGGCCG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1180707123 22:17816868-17816890 AAGGAGGCCGGGTGGGGGGCTGG 0: 1
1: 1
2: 4
3: 100
4: 1007
1180707113_1180707125 8 Left 1180707113 22:17816855-17816877 CCCATGTGCAGCCAAGGAGGCCG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1180707125 22:17816886-17816908 GCTGGATTCATTTTAGTTTAAGG 0: 1
1: 0
2: 0
3: 20
4: 197
1180707113_1180707129 29 Left 1180707113 22:17816855-17816877 CCCATGTGCAGCCAAGGAGGCCG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1180707129 22:17816907-17816929 GGGATCCATCCCCCATCCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 212
1180707113_1180707128 28 Left 1180707113 22:17816855-17816877 CCCATGTGCAGCCAAGGAGGCCG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1180707128 22:17816906-17816928 AGGGATCCATCCCCCATCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 197
1180707113_1180707127 27 Left 1180707113 22:17816855-17816877 CCCATGTGCAGCCAAGGAGGCCG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1180707127 22:17816905-17816927 AAGGGATCCATCCCCCATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 95
1180707113_1180707126 9 Left 1180707113 22:17816855-17816877 CCCATGTGCAGCCAAGGAGGCCG 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1180707126 22:17816887-17816909 CTGGATTCATTTTAGTTTAAGGG 0: 1
1: 0
2: 3
3: 26
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180707113 Original CRISPR CGGCCTCCTTGGCTGCACAT GGG (reversed) Intronic
900312032 1:2038223-2038245 CGACCTCCATGGCTGCACAGAGG + Intergenic
900645864 1:3708511-3708533 CAGCCTCCTTGGCTGTAAAAGGG - Intronic
901773083 1:11540725-11540747 CAGCTTCCTTGGGTGGACATGGG - Intergenic
906274377 1:44505387-44505409 CCGCCTCCTTGGCTCTACGTGGG + Intronic
919760047 1:201092040-201092062 CCGGCTCCTTTGCTGCTCATTGG + Exonic
919801789 1:201358843-201358865 CTGCCTCCTGGGCTGCACCCTGG + Intergenic
921676084 1:217977792-217977814 TGTCCTCCTTCTCTGCACATTGG + Intergenic
922025058 1:221742213-221742235 CCGCCCCCTAGGCTGCCCATTGG - Intergenic
923542116 1:234896012-234896034 CTGCTTCCTGGGCTGCCCATAGG + Intergenic
924083083 1:240419977-240419999 AGGCCTCCTTGGCTGCCCCTTGG + Intronic
1067920193 10:50447874-50447896 TAGTCTCCTTTGCTGCACATGGG - Intronic
1070940381 10:80340097-80340119 TGGGCTGCTTTGCTGCACATGGG - Intronic
1072804888 10:98418011-98418033 CGTCCTCCCTCGCTGCACACAGG + Intronic
1073105099 10:101028213-101028235 CTGCTTCCTTGGCTGCACAGTGG + Intronic
1075089622 10:119436474-119436496 CGGCCTCCTTGGCTGATAAGGGG - Intronic
1075351972 10:121732282-121732304 CACCCTCCTTGCCTGCCCATTGG + Intergenic
1075879023 10:125834137-125834159 CAGCCTCCTTGCCTGCACTGTGG + Intronic
1075928596 10:126273869-126273891 TGGCCTCCTTGTCTGCAAAATGG - Intronic
1077132066 11:978025-978047 CGGCCTCCTTGACTGCAAAGCGG - Intronic
1079551803 11:21708790-21708812 TGTTCTCCTTGGTTGCACATGGG + Intergenic
1083618657 11:64038309-64038331 CGGCTTCCTTGCCTGCGCAGGGG + Intronic
1083630886 11:64094787-64094809 CGGCATCCTTGGCTGTGCCTGGG + Intronic
1083831290 11:65235488-65235510 TGGCAGCCCTGGCTGCACATTGG - Intergenic
1084392860 11:68890196-68890218 AGGCCTCCAGGGCTCCACATGGG - Intergenic
1085518524 11:77124902-77124924 CGGCCTCCTAGGCTGCATTTTGG - Exonic
1086912565 11:92489910-92489932 CTGCCTCTTTCGCTGCTCATGGG - Intronic
1087518159 11:99193702-99193724 CGGTCTCCTGGGTTGCCCATGGG - Intronic
1088939245 11:114436927-114436949 CCAACTCCTTGGCTGCAGATCGG - Intronic
1091213754 11:133886872-133886894 CTGCTTCCTTGGCTCCACACTGG + Intergenic
1094272784 12:28635944-28635966 GGGCCTCCTTAGGTGTACATTGG - Intergenic
1096526767 12:52214685-52214707 TGGCCTCCATGGCTGCAGAGGGG - Intergenic
1103447815 12:121005731-121005753 CAGTCTCCTTGTCTGTACATGGG + Intronic
1104508970 12:129358702-129358724 TGGCCTCCTTGGCTACACTCAGG - Intronic
1104994079 12:132643191-132643213 GGCCCTCCATGGCAGCACATTGG - Intronic
1105437790 13:20391893-20391915 AGGCCTCCTTGGCTGAACGAGGG + Intergenic
1106358200 13:29005031-29005053 TGGCCTCATTGGCTGCACCATGG - Intronic
1106541835 13:30697355-30697377 AGTCCTCCTTGTCTGCAAATCGG + Intergenic
1112976096 13:105319967-105319989 CTATCTCCTTGCCTGCACATGGG - Intergenic
1113654323 13:112058437-112058459 CGGCCTCCTCCCCTGCACCTAGG + Intergenic
1113811329 13:113144256-113144278 CAGCCTCCTTGGCTGCCCGGAGG - Intronic
1114466157 14:22924322-22924344 CGGCCTGCTTGGCTGCCCGCAGG + Exonic
1121291534 14:92779844-92779866 GGGGTTCCTAGGCTGCACATAGG - Intergenic
1121866575 14:97367711-97367733 TGGCCTCCTTGGCTGGACCAAGG + Intergenic
1128682734 15:69663433-69663455 CAGCTTCCTTAGCTGCACAATGG - Intergenic
1132565288 16:619660-619682 CGGCCTCCCTGGGCCCACATGGG - Intronic
1133230734 16:4365366-4365388 CAGTCACCTTGGCTGCACAGGGG + Intronic
1134829432 16:17311330-17311352 CAGCCTCGTGGGCTGCTCATGGG + Intronic
1135573579 16:23567811-23567833 CTGCCTCCTTGGATGAACAATGG - Intronic
1142372633 16:89691551-89691573 TGGTCTCCTGGTCTGCACATTGG + Intronic
1147758176 17:42781729-42781751 CAGCCTCCTGGTCTGCAAATAGG - Intronic
1147763387 17:42816054-42816076 TGGCCCCCTTGGCTGCTCACAGG - Exonic
1151831800 17:76557201-76557223 CGGCCTCCGCGGCTGCCCAGGGG - Intergenic
1152252388 17:79218811-79218833 CGGCCTCCATGTCTGCACCGAGG - Intronic
1152300832 17:79494682-79494704 TGGCCTCCTTGCCTGGGCATGGG - Intronic
1152811615 17:82385329-82385351 GGGTCTCCTTGGCTGCAGGTGGG - Intergenic
1157134760 18:45042920-45042942 AGACCTCCTTGGCTGCACCAGGG - Intronic
1157529859 18:48410726-48410748 CGCCCTCCTTGGTAGTACATCGG + Intronic
1157570519 18:48709417-48709439 TGGCCTCCTTACCTGCACACAGG - Intronic
1159954844 18:74511987-74512009 CGGCCTCCTCGCCTGCAAATGGG - Intronic
1160435678 18:78850651-78850673 TTGCCTCCTTTGCTGCACAGAGG + Intergenic
1161067393 19:2245449-2245471 TGGCCTCCTTGGCTGCTCGCCGG - Exonic
1163193542 19:15697262-15697284 CTGCCTCTTTGGCTGAGCATAGG + Intergenic
1163199955 19:15760057-15760079 CTGCCTCTTTGGCTGATCATAGG - Intergenic
1163290085 19:16373635-16373657 AGGCCTCCTGGGCTGCACGTGGG + Intronic
1165007001 19:32815330-32815352 CTGCCACGTTGGCTGCACTTCGG - Intronic
1165095277 19:33406763-33406785 CAGCCACCTTGGCCTCACATGGG - Intronic
1165675643 19:37719968-37719990 CGGCCTCCTTGGTAACACATGGG + Intergenic
1168491759 19:56816870-56816892 GTGCCGCCTTGGCTGAACATCGG - Exonic
927860793 2:26558842-26558864 CGCACTCCCAGGCTGCACATTGG - Intergenic
931929165 2:67109728-67109750 TGGCCTCCTTGTATGCACCTTGG + Intergenic
935639746 2:105279548-105279570 TGCCTTCCTTGGCTGGACATGGG - Intronic
939531540 2:143369035-143369057 TGGGCTCCCTTGCTGCACATTGG - Intronic
940013859 2:149082947-149082969 CTGACTCCCTGGCTGCACCTGGG + Intronic
948426041 2:237887063-237887085 CGGCCTCCTGGGCTGCCCATGGG + Intronic
1169653416 20:7894541-7894563 GAACCACCTTGGCTGCACATTGG - Intronic
1170329156 20:15189610-15189632 ATGCCTCCCTGGCTGCACTTCGG + Intronic
1171012231 20:21514996-21515018 CGTCCTCCTTGGCCGCAGAGAGG - Intergenic
1172588462 20:36101311-36101333 TGGACTCCCGGGCTGCACATGGG - Intronic
1174310704 20:49651739-49651761 CAGCAGCCTTGGTTGCACATTGG + Intronic
1174992249 20:55523306-55523328 CCGCCTCCTTGGCTGGGGATGGG - Intergenic
1175284430 20:57828622-57828644 TGGCCTCCTTGTCTGGACAGTGG + Intergenic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1177510009 21:22074515-22074537 CTGCCTACTTGGCTGCCTATGGG + Intergenic
1178025428 21:28460862-28460884 TGGGCACCTTGGGTGCACATAGG - Intergenic
1180707113 22:17816855-17816877 CGGCCTCCTTGGCTGCACATGGG - Intronic
1182487260 22:30646970-30646992 TGGCCTCCTGGGCTGCCCGTCGG + Exonic
1182628040 22:31662648-31662670 CGGTCTCCCTGGCAGCACAGCGG - Intergenic
1183329484 22:37211813-37211835 CAGCCTCCTTACCTGCCCATGGG + Exonic
1183603168 22:38851742-38851764 CGGCTTCCTTGGCTGCACCACGG + Intergenic
1184495485 22:44838815-44838837 CAGCCTCCCAGGCTGCACACAGG - Intronic
1185220358 22:49626466-49626488 CACCCCCCTTGGCTGCACAGGGG + Intronic
950425708 3:12923790-12923812 TGGTCCCCTCGGCTGCACATGGG + Intronic
952915040 3:38230998-38231020 CTGCCTCCTTTCCTTCACATTGG - Intronic
953900518 3:46838969-46838991 CTGCCTCTCTGGCTGAACATGGG + Intergenic
954159323 3:48709226-48709248 CTGCCTCTGTGGCTGCCCATTGG - Intronic
961915070 3:130365755-130365777 CGTCAACCTTGGCTGCACATTGG + Intronic
966443507 3:179974437-179974459 CTCCCTCCTCGGCTGCACCTAGG - Intronic
968079208 3:195834959-195834981 CAGCCTCCTTGGCTGCCCAGTGG - Intergenic
968182475 3:196606541-196606563 TGGCCTCTTTGTCTACACATAGG + Intergenic
968225038 3:196968191-196968213 CGGCCTCGGGGGCTGCACTTCGG - Intronic
968602730 4:1518006-1518028 AGGCCAGCTTTGCTGCACATAGG - Intergenic
973395085 4:49587090-49587112 CGGGCTTCTTGGCTGCAAAGAGG + Intergenic
981398915 4:144288712-144288734 GTGCAGCCTTGGCTGCACATTGG + Intergenic
982052000 4:151511294-151511316 CGGCCATCTTGGCTCCACCTCGG - Intronic
982340479 4:154293083-154293105 CTTCACCCTTGGCTGCACATTGG + Intronic
987078486 5:14405413-14405435 CGGCCTCCTTTGCTGGACTCAGG - Intronic
987667698 5:20966013-20966035 CTGCCTCTTTGCCTGCAGATTGG + Intergenic
988924091 5:35971676-35971698 CTGCCTTCTTGGCTGCAGTTTGG - Intronic
988995063 5:36706824-36706846 CTCCAACCTTGGCTGCACATTGG + Intergenic
993105282 5:83593271-83593293 CCTCCACCTTGGCTGCAAATTGG - Intergenic
996337241 5:122398147-122398169 CTGCCTCCTTGACTGAGCATGGG - Intronic
997806382 5:136922252-136922274 CCGCCCCCTTGGCTACATATTGG + Intergenic
1004012556 6:11703285-11703307 CTTCAACCTTGGCTGCACATGGG + Intergenic
1007723852 6:43902389-43902411 CGTCCTGCTTGGCTGGCCATGGG + Intergenic
1011701600 6:89960268-89960290 TGGCCTCCTTGTCTGTAAATTGG - Intronic
1011955251 6:93017525-93017547 CGGGTTCCTTGGTTGCAGATAGG - Intergenic
1013636921 6:112037962-112037984 CCGCAACCCTGGCTGCACATCGG + Intergenic
1015281135 6:131434734-131434756 CAGGCTCCTTGGTTGCAGATAGG - Intergenic
1018803686 6:167242316-167242338 CGGCTTCCTGGGCTGCCCCTGGG - Intergenic
1018806525 6:167266186-167266208 CGGCTTCCTGGGCTGCCCCTGGG + Intergenic
1021357804 7:19675001-19675023 GGGCCTCCTTTCCTGCTCATCGG + Intergenic
1021696363 7:23279890-23279912 CAGCCTCCTTATCTGCAAATTGG + Intergenic
1022247030 7:28570544-28570566 AGCCCTCCTTGGCTGCCCCTGGG + Intronic
1022443950 7:30454966-30454988 CAGCCACCTGGGCTGCACTTGGG + Intronic
1022654672 7:32307743-32307765 CGGCCATCTTGGCTCCACCTCGG - Intergenic
1023597950 7:41852504-41852526 TGGGCTCATTGACTGCACATTGG - Intergenic
1024001654 7:45193990-45194012 CGGCCACCTTAGCTGAACATTGG - Intergenic
1024253135 7:47521225-47521247 CAGCCTCCTTGGGAGCACAGAGG - Intronic
1035470448 7:159105785-159105807 CTGTCTCCTTGTCTGCACAATGG - Intronic
1035619446 8:1026411-1026433 CCGCCGCCTTGGCTGCACCCTGG + Intergenic
1051350888 9:16196990-16197012 CAGCTTCCTTGCCTGCCCATAGG - Intergenic
1056102424 9:83312686-83312708 TCTCCGCCTTGGCTGCACATTGG + Intronic
1057739119 9:97696863-97696885 GGGCCTTCTTCGCTGCACCTCGG - Intronic
1058468278 9:105250745-105250767 TTTCATCCTTGGCTGCACATTGG + Intronic
1191013084 X:55781699-55781721 TCTCCTCCTTGGCTTCACATTGG + Intergenic
1193123505 X:77847560-77847582 AGGCCATCTTGGCTGCACAAAGG + Intronic
1196040927 X:111203010-111203032 GGATCTCCTTGGTTGCACATTGG + Intronic
1199012740 X:142776873-142776895 ATGCCTCCTTTGCTGAACATTGG - Intergenic
1200821306 Y:7586071-7586093 CTGCCTCCTTGCCTCCTCATAGG + Intergenic
1202238997 Y:22746680-22746702 CTGCCTCCTTGCCTCCTCATAGG - Intergenic