ID: 1180707383

View in Genome Browser
Species Human (GRCh38)
Location 22:17817960-17817982
Sequence CCCTGGCCAAGGAGAACGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 202}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180707383_1180707402 20 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707402 22:17818003-17818025 GGGCGCGGCCAGCAGGACGGGGG 0: 1
1: 0
2: 4
3: 30
4: 274
1180707383_1180707397 5 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707397 22:17817988-17818010 TGGCGAGGCTTCTCGGGGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 96
1180707383_1180707399 17 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707399 22:17818000-17818022 TCGGGGCGCGGCCAGCAGGACGG 0: 1
1: 0
2: 1
3: 7
4: 148
1180707383_1180707400 18 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707400 22:17818001-17818023 CGGGGCGCGGCCAGCAGGACGGG 0: 1
1: 0
2: 2
3: 16
4: 190
1180707383_1180707396 0 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707396 22:17817983-17818005 GCGGGTGGCGAGGCTTCTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
1180707383_1180707395 -1 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707395 22:17817982-17818004 GGCGGGTGGCGAGGCTTCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 135
1180707383_1180707394 -2 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707394 22:17817981-17818003 GGGCGGGTGGCGAGGCTTCTCGG 0: 1
1: 0
2: 3
3: 12
4: 195
1180707383_1180707401 19 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707401 22:17818002-17818024 GGGGCGCGGCCAGCAGGACGGGG 0: 1
1: 0
2: 2
3: 23
4: 309
1180707383_1180707398 13 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707398 22:17817996-17818018 CTTCTCGGGGCGCGGCCAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 126
1180707383_1180707392 -10 Left 1180707383 22:17817960-17817982 CCTCCCGTTCTCCTTGGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 202
Right 1180707392 22:17817973-17817995 TTGGCCAGGGGCGGGTGGCGAGG 0: 1
1: 0
2: 4
3: 38
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180707383 Original CRISPR CCCTGGCCAAGGAGAACGGG AGG (reversed) Exonic