ID: 1180709944

View in Genome Browser
Species Human (GRCh38)
Location 22:17832730-17832752
Sequence CTGTGGGTGTGGTGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2921
Summary {0: 1, 1: 1, 2: 36, 3: 402, 4: 2481}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180709936_1180709944 -10 Left 1180709936 22:17832717-17832739 CCTCTCAGGAGAGCTGTGGGTGT 0: 1
1: 0
2: 3
3: 20
4: 181
Right 1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG 0: 1
1: 1
2: 36
3: 402
4: 2481
1180709933_1180709944 1 Left 1180709933 22:17832706-17832728 CCTGTCAGAAGCCTCTCAGGAGA 0: 1
1: 0
2: 1
3: 28
4: 180
Right 1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG 0: 1
1: 1
2: 36
3: 402
4: 2481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180709944 Original CRISPR CTGTGGGTGTGGTGGGGGGA GGG Intronic
Too many off-targets to display for this crispr