ID: 1180712089

View in Genome Browser
Species Human (GRCh38)
Location 22:17846279-17846301
Sequence CAGTGTTTCCAAAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180712084_1180712089 -8 Left 1180712084 22:17846264-17846286 CCATTGCCGGGGGTTCAGTGTTT 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG 0: 1
1: 0
2: 3
3: 37
4: 500
1180712076_1180712089 30 Left 1180712076 22:17846226-17846248 CCTGTGGAGAGACAAGGACACGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG 0: 1
1: 0
2: 3
3: 37
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180712089 Original CRISPR CAGTGTTTCCAAAGGGAAGG TGG Intronic
900847136 1:5113011-5113033 CAGTAATTCCAAAATGAAGGAGG + Intergenic
903519706 1:23937444-23937466 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
903555658 1:24191280-24191302 CAGTGTTTGAAAAGGCCAGGGGG - Intergenic
904862547 1:33549697-33549719 CAGTGATAAGAAAGGGAAGGAGG + Intronic
905132901 1:35774829-35774851 CAGTGTTTCCCCAGGGACGAAGG - Intergenic
905216566 1:36412495-36412517 CAGTGTTTCAAAAGGAAGTGAGG + Intergenic
906339926 1:44970628-44970650 CAGTGTTTGCTAAGGGATGTCGG - Intronic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
907315610 1:53569131-53569153 CGGTGGTTGCCAAGGGAAGGAGG + Intronic
907508022 1:54936018-54936040 CAGTGTTCTCAATGGCAAGGTGG + Intergenic
907566291 1:55437362-55437384 CAGTGGTTCCATGGGGTAGGAGG + Intergenic
907653656 1:56320775-56320797 CAGTGTTTGCCAAGGGTTGGAGG - Intergenic
907858943 1:58332214-58332236 GGGAGTTTCAAAAGGGAAGGTGG - Intronic
908493133 1:64666552-64666574 GAGTGTTTCCCAAGAAAAGGAGG + Intronic
909352501 1:74671400-74671422 AAGGGTTTCAAAAGGGAAGGGGG - Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
909529796 1:76669658-76669680 TAATCTTTCCAAAAGGAAGGGGG + Intergenic
909784062 1:79587378-79587400 CAGAGTTTCCAAAGAGAAGGGGG - Intergenic
911031682 1:93495562-93495584 CAGTGTTTCCAAATGAAACAGGG + Intronic
911283564 1:95961181-95961203 CAGTGTTTGCAAAGGCAACAAGG - Intergenic
911487934 1:98525873-98525895 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
911592000 1:99759204-99759226 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
911638663 1:100264655-100264677 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
913075246 1:115336514-115336536 CAGTGTTTCCAGAGGGTCAGAGG - Intronic
913164260 1:116170375-116170397 CAGTTCTTCCTAAGGGCAGGAGG + Intergenic
913669105 1:121078666-121078688 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
914020850 1:143866071-143866093 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
914430439 1:147615944-147615966 CAGTGACTGCAAAGGAAAGGAGG + Intronic
914659348 1:149774013-149774035 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
914778139 1:150757390-150757412 CACTGTTGCCAAAGTGAAGAAGG - Intronic
916869556 1:168898077-168898099 CAGTGTTTCTAAAGGCATGAGGG - Intergenic
917078868 1:171236291-171236313 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
917765221 1:178208754-178208776 AAGAGTTTCAAAAGGGAAGGGGG - Intronic
917803766 1:178595199-178595221 CAGTGTTTCTAATGAGAATGAGG - Intergenic
918175963 1:182045427-182045449 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
919582855 1:199399293-199399315 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
920399209 1:205666725-205666747 TACTGTCTCCAAAAGGAAGGTGG + Intronic
920603675 1:207357439-207357461 CAGTATTTCAAAAGGAAAGTTGG - Intronic
920908976 1:210196253-210196275 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
920961082 1:210664687-210664709 CAGTGGATCCAAAGAGATGGTGG + Intronic
921086425 1:211797832-211797854 CACTATTTCCAAAGGGAAAAAGG + Intronic
922152755 1:223019413-223019435 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
922998134 1:229983145-229983167 GAGGATTCCCAAAGGGAAGGAGG + Intergenic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
1064779023 10:18812729-18812751 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1065499695 10:26367436-26367458 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1065868524 10:29935278-29935300 AAGGATTTCAAAAGGGAAGGTGG - Intergenic
1066651121 10:37656018-37656040 AAGGGTTTCAAAAGGGAAGGGGG + Intergenic
1067013953 10:42741383-42741405 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1067769967 10:49115807-49115829 CACTTATTCCTAAGGGAAGGCGG + Intergenic
1067856326 10:49796709-49796731 CAGTAATTCCAAAAGGGAGGGGG + Intergenic
1068155723 10:53195618-53195640 CAGAGTTTGGAAAGGGTAGGAGG - Intergenic
1068568046 10:58597266-58597288 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1070522614 10:77267501-77267523 CAGAGTTTCACAAGGGAAAGTGG - Intronic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1070798344 10:79230244-79230266 CAGTGGTCCCAAGGGGAAAGGGG - Intronic
1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG + Intronic
1071386250 10:85124249-85124271 CAGTGGTTCTTAAGGGCAGGAGG - Intergenic
1071414429 10:85427881-85427903 CAGTGTTTCTCAACAGAAGGTGG - Intergenic
1071435542 10:85645898-85645920 ATGTGTTTCCAAAGCAAAGGGGG + Intronic
1072228911 10:93396511-93396533 CAGTGTTTCCAAAGGGTGACTGG - Intronic
1072535424 10:96359258-96359280 CATTGTTTCCAAAGGGCTGCAGG - Exonic
1072678650 10:97489255-97489277 CATTGTTTTTAAAGGGAGGGGGG + Intronic
1073323505 10:102629575-102629597 CAAAGGCTCCAAAGGGAAGGAGG - Intronic
1073828230 10:107351332-107351354 CATTGTTTCCAAGGAGAAGTTGG - Intergenic
1075023345 10:118967011-118967033 AACTGTTTGCAAAGGGGAGGTGG - Intergenic
1076378685 10:130010454-130010476 CAGTGATTCCAAAAGGGAGGAGG + Intergenic
1076822887 10:132949763-132949785 CAGTAATTCCAAAAGGGAGGAGG + Intergenic
1076823411 10:132953682-132953704 CAGTAGTTCCAAAAGGGAGGAGG + Intergenic
1078036418 11:7810165-7810187 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1078096696 11:8301798-8301820 AGGTGTTTCCAAAGGAAAGGAGG - Intergenic
1080278570 11:30530586-30530608 CAGCGTTTTCAAAGGGAAAGAGG + Intronic
1080299839 11:30771766-30771788 CACTGTTTCAGAAGGGGAGGCGG - Intergenic
1080694116 11:34585986-34586008 CAGGGTTTACAAAGATAAGGAGG - Intergenic
1080699199 11:34630179-34630201 TTGTGTTTCTAAAGAGAAGGAGG - Intronic
1081328387 11:41774202-41774224 AAGTGTTTCAAAAGGGGAGGGGG + Intergenic
1081615001 11:44585612-44585634 CAGTGTTTCCCAAGGTCATGTGG + Intronic
1081674029 11:44957822-44957844 CAGCGTTTGCAAAGGCCAGGAGG - Intergenic
1082047915 11:47745655-47745677 AAGGGTTTCAAAAGGGGAGGAGG - Intronic
1082291818 11:50384589-50384611 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084099079 11:66933681-66933703 AAGTGGTTGCAATGGGAAGGAGG - Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084223438 11:67699367-67699389 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1086056121 11:82649099-82649121 CATTATTTCAAAAGAGAAGGAGG - Intergenic
1086312594 11:85550886-85550908 CCGTATTTCCAAAGGAAAGAAGG + Intronic
1087680194 11:101211391-101211413 AAGTGTTTCAAAAGGGGGGGGGG + Intergenic
1087681277 11:101220487-101220509 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1090055290 11:123418280-123418302 CAGGGTTTCCCAAGGGGAGTTGG + Intergenic
1090475838 11:127019135-127019157 CAGTGTTTTCAGCAGGAAGGAGG + Intergenic
1091243832 11:134074636-134074658 CAGTGTGTTCAAAAAGAAGGGGG - Intronic
1092069744 12:5623027-5623049 AAGTGTTTCCAGAGGCCAGGTGG + Intronic
1092645724 12:10569932-10569954 CAGTAATTCCAAAAGGTAGGAGG - Intergenic
1092852224 12:12639850-12639872 AAGGGTTTCAAAAGGGGAGGTGG + Intronic
1093735130 12:22612634-22612656 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1094506795 12:31069173-31069195 AAAAGTTTCCAAAAGGAAGGAGG - Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095494159 12:42767512-42767534 CAGTGCCTTTAAAGGGAAGGTGG + Intergenic
1095594859 12:43947865-43947887 TAGGGTTTCCAAGGGGAAGAAGG + Intronic
1096511511 12:52132238-52132260 CAGTGATTGCACAGGGAGGGGGG + Intergenic
1097135807 12:56853935-56853957 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1097309064 12:58098881-58098903 GAGTGTTTATAAAGGGAAGCAGG - Intergenic
1097346487 12:58499043-58499065 CAGTATCTCCAAATAGAAGGAGG + Intergenic
1097608230 12:61782242-61782264 CAGTAATTCCAAAGGGAGGCGGG - Intronic
1097664437 12:62463739-62463761 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1098302565 12:69069053-69069075 CCTTGCTTCCAAAGGCAAGGCGG + Intergenic
1098569939 12:71976952-71976974 CAGTGGTTACAAGGGGCAGGAGG + Intronic
1098720963 12:73896856-73896878 CAGAGTTTCCCATGGAAAGGTGG + Intergenic
1098741133 12:74174934-74174956 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1099265600 12:80442903-80442925 CACTGTTTCTAAAAGAAAGGAGG - Intronic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100087499 12:90929506-90929528 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
1100870881 12:98908745-98908767 CATTGTTCCCAAGAGGAAGGTGG + Intronic
1101101259 12:101395578-101395600 GACTGTTTCCAAAGGGAGAGAGG + Exonic
1102900061 12:116629493-116629515 CAGTATTTCCAAAAGCAGGGCGG + Intergenic
1103282390 12:119770721-119770743 TAGAGTTTGCAAAGGGAAGGGGG - Intronic
1104292171 12:127480908-127480930 CCCTGTCTCCAAAGAGAAGGAGG + Intergenic
1104293372 12:127489154-127489176 CCCTGTCTCCAAAGAGAAGGAGG + Intergenic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1104927782 12:132322547-132322569 GAGTGTTTGCACAGGGAATGGGG + Intronic
1105454093 13:20525146-20525168 CGATGTTTCCAGAGGGGAGGTGG - Intronic
1105584081 13:21727530-21727552 CAGGGATTCCAAACGGGAGGCGG + Intergenic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1105797884 13:23874410-23874432 CAGTGTTTACACTGGGATGGAGG - Intronic
1105883125 13:24620974-24620996 CAGTGTTTCCAGAGGGGATTAGG + Intergenic
1105897737 13:24731409-24731431 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1108711802 13:53040532-53040554 CCATGTTTCTAAATGGAAGGAGG + Intronic
1108960498 13:56221830-56221852 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1109647211 13:65274327-65274349 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1109918077 13:69018100-69018122 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1110183700 13:72647508-72647530 CATTGTTTCCAAAAAAAAGGGGG + Intergenic
1110274939 13:73632668-73632690 CAGTGTTGCCAAAAAGGAGGAGG + Intergenic
1111460643 13:88537030-88537052 CAGTTTTTCCACAGAGAAGGCGG + Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112281381 13:98065736-98065758 CAGTATTTTCAAAAGGGAGGAGG + Intergenic
1112408077 13:99138374-99138396 CAGTAATTCCAAAAGGGAGGAGG + Intergenic
1112593093 13:100782455-100782477 CTCTGCTTACAAAGGGAAGGAGG + Intergenic
1112957153 13:105073875-105073897 AAGTGTTTCCATAGAGAAAGCGG + Intergenic
1113214083 13:108017800-108017822 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1113216163 13:108043085-108043107 AAGTGTTTCAAAAGGGGAGGGGG - Intergenic
1113536576 13:111071349-111071371 TAGGGTTTCAAAAGGGGAGGAGG + Intergenic
1114750503 14:25199557-25199579 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1114814228 14:25937626-25937648 CAGTGTTTAAAAAGGAAAGGAGG - Intergenic
1115171891 14:30517774-30517796 CAGGATTTTCAAAGGAAAGGGGG - Intergenic
1115532702 14:34341903-34341925 CAGTAATTCCAAAAGGGAGGAGG + Intronic
1115810958 14:37106735-37106757 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1117047911 14:51831236-51831258 AAATGTTTTTAAAGGGAAGGAGG - Intronic
1119106015 14:71924558-71924580 CAGTGGTTACCAAGGGCAGGTGG - Intergenic
1120130399 14:80800055-80800077 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1120397130 14:83982226-83982248 CATGGTTTCAAAAGGGGAGGGGG - Intergenic
1121364668 14:93297968-93297990 AAGTGTTTCTAAAGGTAAGACGG + Intronic
1121582445 14:95040953-95040975 CAGTGTTTGGAAGGGGGAGGGGG + Intergenic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1124225810 15:27893990-27894012 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1124630830 15:31336168-31336190 CAGTGCTCCAAAAGGGAATGAGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126129681 15:45328030-45328052 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
1126915335 15:53460115-53460137 CAGTGTTCCCCAAGGGGAAGGGG - Intergenic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1128350051 15:66882379-66882401 CAGCGCTTCCAAAGGGAGGCCGG + Intergenic
1128369591 15:67030656-67030678 GTGTGTTTCCAAAGGAAAGAGGG + Intergenic
1128685170 15:69678916-69678938 CAGTAATTCCAAAAGGGAGGAGG + Intergenic
1129590168 15:76907698-76907720 AAGTATTTCCAGAAGGAAGGAGG - Intergenic
1130074456 15:80676645-80676667 CAGTAATTCCAAAAGGCAGGAGG - Intergenic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1130286275 15:82557692-82557714 GTGTGTGTCCAAGGGGAAGGAGG - Intronic
1130889769 15:88123920-88123942 CAGTAATTCCAAAAAGAAGGAGG + Intronic
1130984982 15:88838820-88838842 CCGTGTGTCCAAGGAGAAGGAGG + Exonic
1131638287 15:94260862-94260884 CAGTAATTCCAAAAGGGAGGAGG - Intronic
1133359410 16:5162191-5162213 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1133483352 16:6193800-6193822 CAGAGCTTTCAAAAGGAAGGAGG - Intronic
1133717027 16:8459595-8459617 CAGAGTTTCCAAGGGGGAGATGG - Intergenic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1135796379 16:25446903-25446925 GAGTGTTTCCAAACGGGAGATGG - Intergenic
1136031300 16:27505037-27505059 CAGTGTTTCCAAAATACAGGGGG + Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1136922484 16:34344318-34344340 TAGTGATTCAACAGGGAAGGGGG - Intergenic
1136982089 16:35067488-35067510 TAGTGATTCAACAGGGAAGGGGG + Intergenic
1137716372 16:50600866-50600888 GAGAGTTTGCACAGGGAAGGTGG - Intronic
1137850916 16:51741746-51741768 CAGTCTTTCCATAGTGAGGGAGG + Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1138947731 16:61872636-61872658 CAGTAATTCCAAAAGGGAGGAGG + Intronic
1139058563 16:63220026-63220048 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
1139094982 16:63694601-63694623 AAGTGTTTCCAAGTGGGAGGAGG + Intergenic
1139456890 16:67087021-67087043 CAGTGTATGCAAAGGCATGGAGG + Intronic
1139670913 16:68492159-68492181 CAGTGTTTCCAAAAGCTGGGAGG + Intergenic
1139698993 16:68695677-68695699 CAGAGTATCCAAAGGGTAGGGGG + Intronic
1141624447 16:85253893-85253915 CTGTGTGTGCAAAGGGCAGGAGG + Intergenic
1141668700 16:85480264-85480286 CAGTGTTTCGATGGGGATGGAGG + Intergenic
1142539648 17:648134-648156 CAGCTTTTCCAAAGTGAGGGGGG - Intronic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143989650 17:10945813-10945835 CAGTGTTTCTAAGAGGCAGGAGG + Intergenic
1144096843 17:11907484-11907506 CAGTAATTCCAAAAGAAAGGAGG + Intronic
1144482690 17:15640561-15640583 CAGTGTTTGCAATGTCAAGGAGG - Intronic
1144915998 17:18724471-18724493 CAGTGTTTGCAATGTCAAGGAGG + Intronic
1145230499 17:21170181-21170203 GAGGGTTTCCTAGGGGAAGGAGG - Intronic
1146268080 17:31466220-31466242 CAGTGGGTCCCAGGGGAAGGAGG + Intronic
1147158506 17:38557687-38557709 TAGTGTTTTCAGAAGGAAGGAGG - Intronic
1147325102 17:39666266-39666288 CTGAGTTCCCAAAGGGAGGGTGG + Exonic
1148398544 17:47331741-47331763 CAGTGTTTGCCAGGGGATGGGGG - Intronic
1148983528 17:51600127-51600149 CAGTAATTCCAAAAGGAAAGTGG - Intergenic
1150119485 17:62588301-62588323 CAGTGTTTCAAAAGGCTAGATGG - Intronic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1150859872 17:68790444-68790466 CAGTGTTTCCACAGGTCATGTGG + Intergenic
1150981115 17:70142602-70142624 CTGTGTTTCCACAGGGTAGAAGG - Intergenic
1151037054 17:70812753-70812775 CAGTGTGTACTAAGGGATGGGGG - Intergenic
1151246617 17:72799910-72799932 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1151267154 17:72965696-72965718 GAGTATCTCCAAAAGGAAGGAGG + Intronic
1151273523 17:73015266-73015288 CAGTATTCCCAAAGGCAGGGAGG - Intronic
1151668756 17:75560029-75560051 CTGTGGTTCCAAGGGGCAGGAGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152784096 17:82239114-82239136 CAGTGTTTTGAGGGGGAAGGTGG + Exonic
1155323438 18:24642356-24642378 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155630380 18:27886310-27886332 CAGTGGTCCCCAAGGGAATGAGG - Intergenic
1156572885 18:38279179-38279201 CTTTGTTTCCACAGGAAAGGAGG - Intergenic
1158167380 18:54555641-54555663 CAGTCATTCCAAAAGGAAGGAGG + Intergenic
1158502076 18:58011408-58011430 AAGTGTTTCCATAGGGAACAGGG - Intergenic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1159815740 18:73072094-73072116 AAGGGTTTCAAAAGGGGAGGTGG - Intergenic
1159930478 18:74307854-74307876 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1160901018 19:1428772-1428794 GGGTGTGTCTAAAGGGAAGGGGG + Intronic
1162835587 19:13315408-13315430 CAGTTTTCTCAAAGGGAAAGTGG + Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1164268844 19:23650236-23650258 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1164405819 19:27945125-27945147 AAGGGTTTCAAAAGGGTAGGGGG - Intergenic
1164479155 19:28598185-28598207 CAGTGATTCCAAAAGGCAGGAGG + Intergenic
1164871154 19:31644651-31644673 CAGTGTTTCCACAGAGAACTTGG - Intergenic
1166156869 19:40920088-40920110 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1166413461 19:42573589-42573611 CAGTGGTTCCAAAGGTATTGCGG + Intergenic
1166682519 19:44777798-44777820 CAGTGTCTCCAAAGGGGGCGGGG - Intergenic
1167437419 19:49487468-49487490 CAGAGATTCCCCAGGGAAGGCGG - Intergenic
1167834510 19:52056797-52056819 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
925393483 2:3515695-3515717 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
925981132 2:9178489-9178511 CAGTAATTCCAAAAGGGAGGAGG + Intergenic
926108966 2:10170067-10170089 CAGGCTTTCCAGAGAGAAGGAGG + Intronic
929009543 2:37427383-37427405 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
929474932 2:42236798-42236820 CAGTGTTCCCAAAGATATGGAGG - Intronic
929801549 2:45108758-45108780 GAGTGTTTCAAGAAGGAAGGAGG + Intergenic
929819688 2:45263031-45263053 CAATGTTTTCAAATCGAAGGTGG - Intergenic
930164188 2:48187632-48187654 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
930300696 2:49612120-49612142 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
930571620 2:53093261-53093283 CAGTAATTCCAAAAGGGAGGAGG + Intergenic
931168293 2:59775157-59775179 AAGTGTTTGGAAAGGGAAGAAGG - Intergenic
931198286 2:60073630-60073652 CTGTGTTTCGAAAGGCAGGGTGG + Intergenic
931785916 2:65619402-65619424 CAGGGCTTACACAGGGAAGGAGG - Intergenic
932484294 2:72073245-72073267 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
932859965 2:75280572-75280594 CAGTGTTTCTAAATGCAACGTGG + Intergenic
933349549 2:81136551-81136573 AAGTGTTTGCACAGGGAATGGGG - Intergenic
933412298 2:81941390-81941412 CAGTGTTTCCTTACTGAAGGGGG + Intergenic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934557661 2:95296031-95296053 GACTGTTTCCAGAGGGGAGGTGG - Intergenic
935751186 2:106235198-106235220 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
935762095 2:106330495-106330517 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
935824145 2:106926704-106926726 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
937074087 2:119088435-119088457 CACAGTTGCCAAAGGGCAGGAGG - Intergenic
937112060 2:119373941-119373963 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
938140243 2:128789475-128789497 ACGTGAGTCCAAAGGGAAGGAGG + Intergenic
939133198 2:138262588-138262610 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
939513396 2:143135673-143135695 GAGAGTTTCAAGAGGGAAGGAGG - Intronic
939840483 2:147182058-147182080 CAGTGTTTTCAGGGGGAAAGGGG - Intergenic
940062311 2:149586346-149586368 CAGTTTTTCAAAGGGGTAGGCGG + Intronic
940276170 2:151943085-151943107 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
940903407 2:159147267-159147289 GATTGTTTCGAAAGGGAAGGGGG + Intronic
941755165 2:169177612-169177634 TAGTCTTTCCCAGGGGAAGGGGG + Intronic
944381156 2:199112207-199112229 GAGTGTTTCCAAAGTCCAGGAGG - Intergenic
945723695 2:213449441-213449463 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
947949724 2:234136621-234136643 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
1168745138 20:233046-233068 CAAAGTTTCCAAAGGAAAAGAGG + Intergenic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1175122193 20:56724407-56724429 TCCTGTTTTCAAAGGGAAGGAGG - Intergenic
1176425812 21:6547598-6547620 CAGTGCTTCCAAGGGAAAGCAGG - Intergenic
1177576575 21:22964307-22964329 CATTGTTGCTGAAGGGAAGGGGG + Intergenic
1178517804 21:33263587-33263609 AAGTGTTCTCCAAGGGAAGGAGG + Exonic
1178702933 21:34848736-34848758 CAGTGTTTCAAAAGTGAACCAGG - Intronic
1178858237 21:36267850-36267872 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
1179137348 21:38691739-38691761 CACTGTTTTTAAAAGGAAGGAGG + Intergenic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179701303 21:43155915-43155937 CAGTGCTTCCAAGGGAAAGCAGG - Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1184928686 22:47663444-47663466 AAGTGCTTCAAAAGGTAAGGAGG - Intergenic
949217550 3:1587875-1587897 AAGGGTTTCAAAAGGGGAGGAGG - Intergenic
951240731 3:20283353-20283375 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
952073269 3:29665467-29665489 TAGTGTTTGGAAAGGGGAGGAGG - Intronic
954898909 3:54002124-54002146 CAGCGTTTCCAAGGTGAAGAAGG + Intergenic
954910019 3:54096720-54096742 GAGAGGCTCCAAAGGGAAGGCGG + Intergenic
955105769 3:55896200-55896222 AAGGGTTTCCACAGGGAAGTTGG + Intronic
956118414 3:65941611-65941633 CAGTGGTTCTTAAGGGGAGGTGG - Intronic
957064659 3:75511701-75511723 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
958497429 3:94863253-94863275 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
958914581 3:100034747-100034769 CAGTTTTCCTAATGGGAAGGAGG + Intronic
959220023 3:103506543-103506565 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
960070232 3:113421823-113421845 TAGGGATTCCAAAGGGAGGGAGG + Intronic
960454590 3:117854884-117854906 CAGTGTTTTCAGAGAGAAAGAGG + Intergenic
961115576 3:124326271-124326293 CAGTGTTTCAAAAAGACAGGTGG - Intronic
962288380 3:134107412-134107434 CAGTGTTGCCAGAGAAAAGGAGG - Intronic
962925795 3:139992345-139992367 CAGGGTTATCAAAGAGAAGGAGG - Intronic
963361117 3:144273034-144273056 CAGTGTTTCCATAAAGAGGGCGG - Intergenic
963473248 3:145771106-145771128 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
963750636 3:149175788-149175810 CTGTGCTTCCAAGGGGAAGGAGG - Intronic
964180211 3:153874429-153874451 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
965569855 3:170161404-170161426 CAATTTTTCCACAGAGAAGGTGG + Intronic
965792601 3:172405619-172405641 CAGTGTTTCCCAAAGTAAGGTGG + Intergenic
966292574 3:178377434-178377456 CATTGTTTCCTTAGGGATGGAGG + Intergenic
966399384 3:179532873-179532895 CAGTGGTTACCAGGGGAAGGAGG - Intergenic
967407735 3:189136262-189136284 CATTGTTTCAGAAGGGAAGGTGG + Intronic
969571481 4:8011277-8011299 CAGTGTTTGCAAAGGAAACTTGG - Intronic
970547055 4:17140441-17140463 AAGGGTTTCAAAAGGGAAGGGGG - Intergenic
970990204 4:22204261-22204283 CAGGTTTTCCCAAGGGAAGCAGG + Intergenic
972556164 4:40183095-40183117 CAGTGTTTCCAAAGACTATGAGG - Intergenic
973659075 4:53083790-53083812 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
974645635 4:64687574-64687596 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
974741441 4:66013277-66013299 CAGGGTTTCAAAAGGGGAGGGGG - Intergenic
974998374 4:69192141-69192163 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
975228692 4:71905872-71905894 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
975491181 4:74990382-74990404 CAATGTTTCCAGCTGGAAGGAGG + Intronic
976338525 4:83918996-83919018 CAGTGTTTACAAAGAGTATGAGG + Intergenic
976636737 4:87293756-87293778 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
976736821 4:88318550-88318572 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
977354372 4:95926748-95926770 AAGGGTTTCAAAAGGGAATGGGG - Intergenic
978024007 4:103849449-103849471 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
978300537 4:107264970-107264992 CCGATTTTCCAAAGGCAAGGTGG + Intronic
979733460 4:124053116-124053138 CAGAGCTTCCAGAGGGAATGTGG - Intergenic
979810856 4:125034042-125034064 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
979952720 4:126914483-126914505 CAGTGGTTCCAAGGGTAAGCAGG + Intergenic
980158168 4:129131781-129131803 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
980600483 4:135018549-135018571 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
981754203 4:148123510-148123532 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
982166273 4:152616372-152616394 CATAGTTTCCAAAGGGAAATGGG + Intergenic
982513635 4:156317114-156317136 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
983189630 4:164741198-164741220 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
983190959 4:164753041-164753063 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
983303392 4:165956010-165956032 AAGGGTTTCTAAAGGGGAGGGGG + Intronic
983655550 4:170080069-170080091 CAGTGTTTTCAAAAGGGTGGGGG + Intronic
983759493 4:171387373-171387395 AAGGGTTTCAAAAGGGGAGGAGG + Intergenic
984640271 4:182157339-182157361 AAGTTATTCCACAGGGAAGGAGG - Intronic
984869295 4:184312453-184312475 CAGTAATTCCTAAAGGAAGGAGG - Intergenic
984869301 4:184312496-184312518 CAGTCATTCCTAAAGGAAGGAGG - Intergenic
985362366 4:189189234-189189256 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
987902579 5:24031747-24031769 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
990614205 5:57490499-57490521 CAGTATTTCCAAAAGGGAAGAGG + Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
991202683 5:64012655-64012677 TCGAGTTCCCAAAGGGAAGGTGG + Intergenic
991640748 5:68749430-68749452 CAGTGCTTCCACCAGGAAGGGGG - Intergenic
991972679 5:72156135-72156157 CAGTGTTTCTGAAGGAGAGGAGG - Intronic
992146706 5:73857850-73857872 AAGTGATTTCAAAGGGAAAGTGG - Intronic
992164803 5:74038825-74038847 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
992200436 5:74378631-74378653 CAGTGTTTCCCAAGTGTAGCTGG + Intergenic
992733171 5:79692145-79692167 CAGTAATTCCAAAAGGGAGGGGG + Intronic
993288499 5:86033976-86033998 CAGGGTTTCCACAGGAAAGCAGG - Intergenic
994502328 5:100595388-100595410 CTTTGTTTGCAAAAGGAAGGAGG + Intergenic
994875788 5:105419214-105419236 AAGGGTTTCGAAAGGGGAGGGGG + Intergenic
994877016 5:105436788-105436810 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
996097489 5:119414331-119414353 AAGCGTTTCGAAAGGGGAGGGGG - Intergenic
996101623 5:119450671-119450693 AAGGGTTGCAAAAGGGAAGGGGG + Intergenic
996517150 5:124383360-124383382 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
997059120 5:130479360-130479382 GAGAGTTTGCAAAGGGAATGGGG + Intergenic
998005330 5:138653173-138653195 CTTTGTTTCTAAAGGGAATGTGG - Intronic
998847775 5:146327558-146327580 CAGCTTTAGCAAAGGGAAGGAGG - Intronic
999257539 5:150217930-150217952 CAGAGTGTCAAAAGGGGAGGAGG + Intronic
999324153 5:150632736-150632758 CAGGGATTCCAAGGGGAAGAGGG - Intronic
999412810 5:151366925-151366947 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
999483140 5:151967196-151967218 CAGTAATTCCAAAAGGGAGGAGG + Intergenic
1000124922 5:158234973-158234995 CATTGCTTCCAAAGAGAAGCAGG - Intergenic
1003032787 6:2616984-2617006 CAGTGATTCCCTAGGGAATGTGG + Intergenic
1003068116 6:2920499-2920521 CAGTAATTCCAAAAGAAAGGAGG + Intergenic
1003100845 6:3175502-3175524 CAGCATTTCCAAACGGGAGGAGG + Intergenic
1004086417 6:12453709-12453731 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1004459941 6:15826398-15826420 TAGAGCTTCCAAAAGGAAGGTGG + Intergenic
1004672152 6:17807711-17807733 GAGGGTTTCAAAAGGGGAGGAGG - Intronic
1004770777 6:18778662-18778684 CATTCTTTCCAAAAGGAAGATGG - Intergenic
1004884022 6:20034844-20034866 CAGAATTTCCAAAAGGAGGGAGG + Intergenic
1005374092 6:25164611-25164633 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1006041941 6:31263368-31263390 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1006856400 6:37136492-37136514 TAGTGTTTGGAAAGGGAGGGAGG + Intergenic
1007022063 6:38530410-38530432 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1007038451 6:38700014-38700036 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1007598533 6:43066918-43066940 CAGTCCTTCCAAAGGGAAGGAGG + Intronic
1008395066 6:50996565-50996587 ATGTGTTTCCAAAGGAAGGGTGG - Intergenic
1008459923 6:51756885-51756907 CAATTTTTCCACAGGGGAGGTGG + Intronic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1009063462 6:58425932-58425954 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1009251127 6:61300518-61300540 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1009720155 6:67458179-67458201 AAGGGTTTCAAAAGGGGAGGAGG + Intergenic
1010810622 6:80294989-80295011 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1010816581 6:80365005-80365027 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1011314760 6:86019037-86019059 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1011608575 6:89128644-89128666 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1011681045 6:89783648-89783670 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1011833547 6:91403277-91403299 CATTGTTTGGAAAGGAAAGGTGG - Intergenic
1012086730 6:94836199-94836221 CTGTGTTTCCAAAAGTACGGTGG - Intergenic
1013243604 6:108268199-108268221 CAGTAATTCCAAAAGGGAGGAGG + Intergenic
1013920926 6:115402563-115402585 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1014320696 6:119924807-119924829 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1014450988 6:121581482-121581504 CAGTCTTTCAAAAGGCAGGGAGG - Intergenic
1014887390 6:126798105-126798127 CACTGTTTCGAAAGGGAAGGTGG + Intergenic
1015605966 6:134954918-134954940 CAGTGTTTCCATACTGGAGGAGG - Intergenic
1015775786 6:136812662-136812684 CAGTAATTCCAAAGGAGAGGAGG - Intergenic
1016455464 6:144225898-144225920 CAGTGTTTCAGAAGGGAAACAGG + Intergenic
1016534807 6:145098007-145098029 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017678372 6:156838792-156838814 CATTGTTTCCAAAGAGAACTGGG + Intronic
1017849936 6:158296457-158296479 AAGGGTTTCAAAAGGGAAGGGGG + Intronic
1017965323 6:159259370-159259392 CATTGTGTCAACAGGGAAGGTGG + Intronic
1018102127 6:160449871-160449893 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
1018351315 6:162962158-162962180 AAGAGTTTCCCAAGGTAAGGTGG - Intronic
1018557105 6:165061169-165061191 CTGATTTTCCAAAGAGAAGGAGG - Intergenic
1019230205 6:170554236-170554258 CTGTGTTTCCATAGGTAAGGAGG - Intergenic
1019882805 7:3878020-3878042 CAGCCTTTCCAAAGTGAATGTGG - Intronic
1022478503 7:30727650-30727672 CAGGGGTTGCAAAGAGAAGGGGG - Intronic
1023313500 7:38911337-38911359 CAGTCTCTCCAAAAGGAAAGAGG - Intronic
1023603842 7:41909121-41909143 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1024358099 7:48438407-48438429 TAGTGTTTCCATAGGGACAGGGG + Intronic
1024375854 7:48637159-48637181 AAGTGTTTACATAAGGAAGGGGG - Intronic
1024945640 7:54805174-54805196 CAGTGATTCCAGAGAGAATGCGG + Intergenic
1025030307 7:55551592-55551614 CCCTTTTTCCTAAGGGAAGGGGG - Intronic
1025755277 7:64332381-64332403 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
1027224299 7:76234369-76234391 CAGTGTTTCCAGAACAAAGGAGG + Intronic
1027820004 7:83030740-83030762 CAGTGTTGCAAAATGGGAGGAGG + Intronic
1028055456 7:86235453-86235475 CAGCATTTCTAAATGGAAGGTGG + Intergenic
1028120809 7:87054770-87054792 GAGTGTTTCCTATGGGATGGTGG - Intronic
1028360257 7:89958309-89958331 CACTGTTTCCCTAGGGCAGGTGG - Intergenic
1029580418 7:101433474-101433496 AGGTGTTTCCAGAGGGAGGGTGG + Intronic
1030896558 7:115068377-115068399 CAGTGTTTGCCAAGGGCAGGAGG + Intergenic
1031424506 7:121588936-121588958 TAGTACTTCCAAAGGGGAGGAGG - Intergenic
1031818032 7:126463691-126463713 CAGCATTTCCAAAAGGAAGTTGG + Intronic
1032005385 7:128298285-128298307 AAGGGTTTCAAAAGGGGAGGGGG - Exonic
1034251794 7:149698182-149698204 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1035135254 7:156697164-156697186 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
1035435044 7:158853344-158853366 CCGTGATTCCAAAAGGGAGGAGG - Intergenic
1035622701 8:1045946-1045968 CAGTAATTTCAAAGTGAAGGGGG + Intergenic
1035963407 8:4162903-4162925 CAGTGGTTGCAAAGGGTTGGAGG - Intronic
1036249844 8:7152464-7152486 AAGGGCTTCAAAAGGGAAGGGGG - Intergenic
1036997523 8:13676168-13676190 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1037312707 8:17573698-17573720 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1037555810 8:20021161-20021183 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038659189 8:29482071-29482093 CAGTGAGTGCAAATGGAAGGTGG + Intergenic
1039057400 8:33547909-33547931 TACTATTTACAAAGGGAAGGAGG + Exonic
1039580418 8:38661686-38661708 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1040926422 8:52688730-52688752 AAGGGTTTCAAAAGGGGAGGGGG - Intronic
1041000410 8:53444034-53444056 CAGTAATTCCAAAGTGGAGGAGG - Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1042428833 8:68680517-68680539 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
1043528879 8:81128080-81128102 CAGTGTTTCCAAAGAGCATTAGG + Intergenic
1044064810 8:87686248-87686270 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1044522250 8:93212357-93212379 CAGTTTTTTAAAAGGTAAGGAGG - Intergenic
1045593402 8:103625102-103625124 CAGTGTTTTTAGGGGGAAGGAGG + Intronic
1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG + Intergenic
1045868526 8:106898096-106898118 CCGTGATTCCAAAGGCAAGGTGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1048033763 8:130657437-130657459 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1048073712 8:131045531-131045553 TCCTGTTTCCAAAGGGAAGGAGG + Intergenic
1048237112 8:132701656-132701678 CACTTTATCCAAAGGGAAGCAGG - Intronic
1048493666 8:134917625-134917647 TAGTGAATCCAGAGGGAAGGAGG - Intergenic
1049005072 8:139849879-139849901 CAGTGTTTCCGACCTGAAGGAGG + Intronic
1049201007 8:141340641-141340663 CAGTCATTCCAAAAGGGAGGGGG + Intergenic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1050211616 9:3264889-3264911 CAGTGTTGTCAAAGTGAATGTGG - Intronic
1050394519 9:5180925-5180947 AAGAGTTTCAAAAGGGGAGGGGG - Intronic
1051065663 9:13099343-13099365 CAGTAATTCCAAAAGGGAGGAGG - Intergenic
1051375141 9:16394870-16394892 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1053051867 9:34968647-34968669 CAGTGTTTCCGAAAAGAAGATGG + Intronic
1053364694 9:37514361-37514383 TGGGGTCTCCAAAGGGAAGGAGG + Intronic
1055622647 9:78142587-78142609 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1055826041 9:80325982-80326004 CTGTGTTACCAATGGGAAGTGGG - Intergenic
1056730287 9:89160204-89160226 CAGTGTTTGCCAAGGGGATGGGG - Intronic
1057094221 9:92290726-92290748 CAATGTTTCCAAAAGTAAGCAGG + Intronic
1057100562 9:92354920-92354942 AAGGGTTTCAAAAGGGGAGGGGG + Intronic
1058071719 9:100608221-100608243 CAGTTTTTTCTAAGGGAAGATGG + Intergenic
1058137883 9:101327453-101327475 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1058533790 9:105933838-105933860 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1058991481 9:110257935-110257957 CAATGTTCCCAAAGAGAGGGAGG + Intergenic
1059546722 9:115183374-115183396 CAGTAATTCCAAAAGGGAGGAGG + Intronic
1060263649 9:122096371-122096393 CAATGTTTACAAAGGCATGGAGG - Intergenic
1060962607 9:127691645-127691667 CTGTTTTTCCAAAGAGATGGAGG - Exonic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061887498 9:133599188-133599210 CAGTGTGTGCAAAGGCCAGGAGG - Intergenic
1062208147 9:135348535-135348557 CCGTGTATCTAAAGGGAACGTGG - Intergenic
1062298677 9:135850844-135850866 CCGTGTTTGTAAAGGGCAGGGGG + Intronic
1062608916 9:137364098-137364120 CAGTGATGCCTAAGGGAAGTAGG - Intronic
1185839609 X:3376369-3376391 CAGTGATTCCAAAAGGGAGGAGG - Intergenic
1185966673 X:4613655-4613677 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1186417289 X:9394743-9394765 GTGTGTTTCCAGAGAGAAGGGGG + Intergenic
1186462532 X:9759777-9759799 CAGTCCTTCCAAAGAGAAGATGG + Intronic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1187685104 X:21808137-21808159 AAGGATTTCCAAAGGGGAGGGGG + Intergenic
1190752831 X:53377037-53377059 CAGTGTTTCCAAGAGCAAGCTGG - Exonic
1192657361 X:73004759-73004781 CGGTGTGTTAAAAGGGAAGGCGG - Exonic
1192664760 X:73078248-73078270 CGGTGTGTTAAAAGGGAAGGCGG + Exonic
1193623232 X:83783187-83783209 AAGGATTTCAAAAGGGAAGGGGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194262230 X:91710520-91710542 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1194341621 X:92712847-92712869 CAGTAGTTCCAAAAGGGAGGAGG - Intergenic
1194821099 X:98508298-98508320 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1195311397 X:103634822-103634844 CATTGTTTCCTAAGAGCAGGGGG - Intergenic
1195566575 X:106346039-106346061 CAGTAATTCCAAAAGGGAGGGGG + Intergenic
1196002203 X:110797441-110797463 CACTGTTAACAAAGGAAAGGGGG + Intergenic
1196541832 X:116919373-116919395 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1197004672 X:121481404-121481426 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1197004725 X:121481874-121481896 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1197051803 X:122068090-122068112 GAGTGTTTCCAAAGGCAAAATGG + Intergenic
1197520624 X:127491869-127491891 AAGGGTTTCAAAAGGGGAGGGGG + Intergenic
1197677468 X:129346089-129346111 TAGTATTGCAAAAGGGAAGGTGG + Intergenic
1197702486 X:129609806-129609828 CAGCCATTACAAAGGGAAGGAGG + Intergenic
1198276867 X:135103025-135103047 CAGTAATTCCAAAAGGGAGGAGG + Intergenic
1198824316 X:140683294-140683316 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1198996527 X:142579474-142579496 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1199107697 X:143890322-143890344 AAGGGTTTCAAAAGGGGAGGTGG - Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1200060051 X:153480152-153480174 CAGTGTGTCCCAAGGGTGGGGGG - Intronic
1200206421 X:154319843-154319865 CAGGCTTTCCAAAGGGGATGTGG - Intronic
1200251969 X:154558685-154558707 CAGGGTTTCCAAAAGCAATGAGG + Intronic
1200265799 X:154645731-154645753 CAGGGTTTCCAAAAGCAATGAGG - Intergenic
1200372415 X:155740830-155740852 AAGGGTTTCAAAAGGGGAGGGGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200581526 Y:4955353-4955375 CAGTAATTCCAAAAGGAAGAAGG + Intergenic
1200649970 Y:5829545-5829567 CAGTAGTTCCAAAAGGGAGGAGG - Intergenic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic
1201236206 Y:11914495-11914517 CAGTGATTCCAAAAGGGAGGAGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1201400676 Y:13600739-13600761 TCCTGTCTCCAAAGGGAAGGAGG - Intergenic