ID: 1180713223

View in Genome Browser
Species Human (GRCh38)
Location 22:17854205-17854227
Sequence CTGTTGACACAGCTTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180713217_1180713223 10 Left 1180713217 22:17854172-17854194 CCTGGGTCACTTGGCAATGTCTG 0: 2
1: 4
2: 47
3: 142
4: 360
Right 1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 219
1180713216_1180713223 11 Left 1180713216 22:17854171-17854193 CCCTGGGTCACTTGGCAATGTCT 0: 1
1: 3
2: 57
3: 360
4: 1070
Right 1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 219
1180713215_1180713223 12 Left 1180713215 22:17854170-17854192 CCCCTGGGTCACTTGGCAATGTC 0: 1
1: 1
2: 12
3: 112
4: 519
Right 1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180713223 Original CRISPR CTGTTGACACAGCTTGGGGA GGG Intronic
900226018 1:1534058-1534080 CTGTGGACTCAGGATGGGGAGGG - Exonic
900339989 1:2183771-2183793 CTGTCAAGACAGCTTGGGCATGG - Intronic
903840183 1:26233626-26233648 CTGTGGACCAAGTTTGGGGAGGG + Intergenic
904090338 1:27940552-27940574 CTGTTCACACAGCTATGGGGTGG + Intronic
906070578 1:43013507-43013529 ATGGTGACAAAGCCTGGGGATGG + Intergenic
909356151 1:74712334-74712356 TGGTTGTCACAACTTGGGGAAGG - Intronic
912624201 1:111194339-111194361 CTCCTGACTTAGCTTGGGGAAGG - Intronic
913247766 1:116885348-116885370 GTGCAGACACGGCTTGGGGAAGG - Intergenic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
915602449 1:156930713-156930735 CTGCTGCCACAGCATGGGGCTGG - Intronic
917810877 1:178657372-178657394 CTGTTGACTCAGTTTGGGCTGGG + Intergenic
918145668 1:181753628-181753650 CGGAGGACACAGCTTGGGGAGGG + Intronic
919571360 1:199253018-199253040 CAGTGTACACTGCTTGGGGAGGG - Intergenic
919747070 1:201015479-201015501 CTGGTGAGACAGCCTAGGGAGGG + Intronic
920085241 1:203410807-203410829 CAGTTGAACCAGCTTGGGGCTGG + Intergenic
920445794 1:206015299-206015321 CAGTTGCCAGAGCCTGGGGAGGG - Intronic
921893986 1:220380016-220380038 CTGTGGGCACAGCCTGGGGGTGG + Intergenic
922865065 1:228852699-228852721 CTTCTGACAGTGCTTGGGGAGGG - Intergenic
924368419 1:243321110-243321132 CAGTTGTCACAACTTGGGGGAGG - Intronic
1065559318 10:26946295-26946317 GTGTTGGCCCAGCTTGGGGCTGG + Intergenic
1066156015 10:32678752-32678774 GTGCTGTGACAGCTTGGGGAAGG + Intronic
1067814512 10:49463138-49463160 CTAATGAGACATCTTGGGGATGG + Intronic
1068971627 10:62964075-62964097 CTGCTGACAGAGCTTGGCCAAGG - Intergenic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1072501473 10:96022554-96022576 CTTTGGTCACAGCTTTGGGATGG - Intronic
1075018161 10:118926417-118926439 CAGTTGTCACATCTTGGGGTGGG - Intergenic
1081543920 11:44056291-44056313 CAGTTGACACAGCTTGTGCTGGG - Exonic
1083384222 11:62295725-62295747 CTCTTGAGAGAGCTTGAGGAAGG + Intergenic
1085407143 11:76270037-76270059 CTTTGGAAGCAGCTTGGGGAAGG - Intergenic
1087947105 11:104176044-104176066 CTGTTGAGAGATCTAGGGGAGGG + Intergenic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1089597029 11:119586832-119586854 TTCTTCACACAGCTTGGTGAAGG - Intergenic
1089759472 11:120712440-120712462 CTGTTGACACTGCCTCTGGAAGG - Intronic
1090188478 11:124753042-124753064 CTGGGTACACAGCTTGGGAAGGG + Intronic
1090381424 11:126330225-126330247 GGGTTGTCACAACTTGGGGAGGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090634143 11:128678848-128678870 CTCTGGTCAGAGCTTGGGGAGGG + Intergenic
1090636009 11:128690991-128691013 CTCTGGGCCCAGCTTGGGGAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091656743 12:2351644-2351666 CTGCAGACACACCCTGGGGAAGG - Intronic
1091909041 12:4214013-4214035 CTGTTCACACACCTTTGGGATGG - Intergenic
1095956893 12:47812110-47812132 CTGCTGTGCCAGCTTGGGGAGGG - Intronic
1096258453 12:50076697-50076719 CTGCTGACAGAGCTGGGGGCAGG + Intronic
1096722611 12:53534532-53534554 GTGATGACAGAGGTTGGGGAGGG + Exonic
1101664221 12:106795528-106795550 ATGTTTACATAGCGTGGGGAGGG + Intronic
1102859414 12:116322294-116322316 TGGTTGTCACAACTTGGGGATGG - Intergenic
1104644390 12:130486584-130486606 GAGATGGCACAGCTTGGGGAGGG - Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104980603 12:132571690-132571712 CTCATGGCACAGCTTGGGGTGGG - Intronic
1106435633 13:29720977-29720999 CTGTGGACACAGCCTGGTTAAGG - Intergenic
1107464804 13:40639706-40639728 TTGTTGTCACAGCTTGGGTGGGG - Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107633210 13:42364089-42364111 CTGTTGACCCAGGTTAGGGTTGG + Intergenic
1109006598 13:56885464-56885486 CTGAACACACAGCTTCGGGAGGG + Intergenic
1111215795 13:85139766-85139788 ATGCTGACAGGGCTTGGGGAGGG - Intergenic
1111910763 13:94309416-94309438 CAGTTTACTCAGCTTGGGGTTGG - Intronic
1112441677 13:99428657-99428679 CTGGTGAGACCGCTTGGGGCAGG - Intergenic
1113553520 13:111212522-111212544 CTGTTCTCAGAGTTTGGGGATGG + Intronic
1115888711 14:38003635-38003657 CTGATGACCCAGATTGTGGAAGG - Intronic
1117904871 14:60574269-60574291 ATTATGAAACAGCTTGGGGAAGG - Intergenic
1118051000 14:62027821-62027843 CTTTTCAAGCAGCTTGGGGAAGG - Intronic
1120754888 14:88233502-88233524 CTGGGGACAAAGCATGGGGAAGG + Intronic
1122474069 14:101993715-101993737 GTGTGGGCACAGCATGGGGAAGG - Intronic
1124627049 15:31313999-31314021 CTGTTGCCCCAGATTGGGGTTGG - Intergenic
1126256960 15:46639185-46639207 GTGTTGACAAAGCTTTGGTATGG - Intergenic
1127077320 15:55339848-55339870 CTGGTGACTCAGGGTGGGGAAGG + Intronic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1130640924 15:85674398-85674420 ATGATGAGACATCTTGGGGAAGG - Intronic
1131153561 15:90061739-90061761 GTGCTGTCACAGCTTGGGGAAGG + Intronic
1133712634 16:8415987-8416009 CTGTTGTCGCAGCTGGTGGATGG - Intergenic
1136247927 16:28985825-28985847 AAGGAGACACAGCTTGGGGATGG - Intronic
1141743024 16:85906797-85906819 TGGTTGTCACAGCTAGGGGAGGG + Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1143097055 17:4483718-4483740 CTGTTGACAGATCCTGGTGATGG + Intronic
1143655208 17:8289802-8289824 CTGTTGTCAGGGCTTGGGGTGGG - Exonic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1147953666 17:44120877-44120899 CTGTTGGCCTAGCTTGGGGGAGG - Intronic
1148494202 17:48042855-48042877 CTGTTGAAGGAGTTTGGGGAGGG - Intergenic
1148838060 17:50476826-50476848 CTGCTGAGGCAGCTGGGGGATGG + Intergenic
1149034833 17:52122066-52122088 CCATTAACACAGCTTGGAGAGGG + Intronic
1149187587 17:54017544-54017566 ACGTTGACACAGTCTGGGGAAGG - Intergenic
1151126910 17:71855184-71855206 CTGTTATCAGAGCCTGGGGAGGG - Intergenic
1151815705 17:76470424-76470446 CTGTAGAGGCAGCTTGGGGCAGG + Intergenic
1152230967 17:79113970-79113992 CAGATAACACAGCTTGGGGACGG - Intronic
1158144720 18:54299137-54299159 CTGTTGACAGAGCCTGGGCCGGG + Intronic
1158501412 18:58005487-58005509 CGGTTGTCACAACTTGGGGGAGG + Intergenic
1160843334 19:1156032-1156054 CGGTGGACGGAGCTTGGGGAGGG + Intronic
1161744612 19:6048064-6048086 TGATTGCCACAGCTTGGGGAGGG - Intronic
1162785961 19:13035034-13035056 TGGTTGTCACACCTTGGGGAGGG - Intronic
1163125766 19:15243392-15243414 CTGGTGACACGGCTGGGGGCCGG + Exonic
1166525802 19:43508852-43508874 GTCTTGGCACAGCCTGGGGAAGG + Exonic
1167812776 19:51849115-51849137 CTATTTCCACAGTTTGGGGAAGG + Intergenic
925736761 2:6970521-6970543 CTGATGAGATATCTTGGGGATGG - Intronic
926691042 2:15733675-15733697 CTGTTGATAAAATTTGGGGAGGG - Intronic
927252810 2:21013332-21013354 CAGTTGATACAACTTGGGAATGG + Exonic
927574823 2:24192211-24192233 CTTTTGACCCAGCTTTGGGAAGG + Intronic
931906473 2:66848833-66848855 CTGTTGTCACAACTCGGGGTGGG + Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
935919334 2:107994120-107994142 CTGTTGAGGCAGCTGGGAGATGG + Intronic
940160777 2:150711121-150711143 CTGTTGACTCTGCGTGGGGGTGG + Intergenic
941510590 2:166403652-166403674 CTCTTTACACAGCTTTCGGAAGG + Exonic
942054956 2:172173449-172173471 CAGATGACCCAGTTTGGGGATGG - Intergenic
942525493 2:176848856-176848878 CTGTGGACACAACCTGTGGAAGG - Intergenic
943205719 2:184892310-184892332 CTGCTGACACACCATGGGGCTGG - Intronic
943642971 2:190379207-190379229 CTGTTGTCACAGTCTGGAGATGG - Intergenic
944983585 2:205149854-205149876 TAATTGTCACAGCTTGGGGAAGG + Intronic
945756498 2:213853874-213853896 TTGTGGACAAAGCTTGAGGAGGG + Intronic
946614715 2:221497114-221497136 CTGTGGAGGCAGTTTGGGGAAGG + Intronic
948295410 2:236856752-236856774 CTCTAGACACTGCCTGGGGAGGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169063286 20:2677097-2677119 CCAATGACACAGCCTGGGGAGGG - Intergenic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1170372092 20:15660365-15660387 CTGTTGAGAAAGTTTGGTGATGG + Intronic
1174523959 20:51156564-51156586 CTGTTGGACCAGCTGGGGGAAGG - Intergenic
1175721860 20:61292515-61292537 TGGTTGTCACAGCTTGGGGAGGG + Intronic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176696863 21:9988589-9988611 CTGTTGTCACAACTTGTGAATGG - Intergenic
1178024751 21:28453550-28453572 CTGTTGACCCATCTCGGGGCAGG - Intergenic
1178160966 21:29914156-29914178 TTATTGTCACAACTTGGGGATGG - Intronic
1178454064 21:32730434-32730456 CTGCTGACATAGCTTGGCTATGG - Intergenic
1178638017 21:34322324-34322346 CCCTTGACACAGCTTGCAGATGG + Intergenic
1180068213 21:45423450-45423472 GTGTGGACACAGCTTTGGGAGGG - Intronic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1181980190 22:26760621-26760643 CTGTGGACACAGCATGGTGTTGG + Intergenic
1183129640 22:35821753-35821775 GTGTTGCCAAAGCTTGGGGGTGG - Intronic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
949751256 3:7354972-7354994 CTGTTGAGATATCTTGCGGAAGG - Intronic
950449397 3:13057227-13057249 CTGAAGACACAGCCAGGGGATGG + Intronic
950482872 3:13255346-13255368 CTGTTGCCCCAGGTTGGAGAGGG - Intergenic
953751327 3:45610630-45610652 CTGTTGGCAGAGCTGGGGGGTGG - Intronic
957517607 3:81275950-81275972 ATGTTGTCCAAGCTTGGGGATGG + Intergenic
957900667 3:86484639-86484661 CTGTTGACACAGCTCTTAGAAGG - Intergenic
958078921 3:88720040-88720062 CTGTCAACCCAGCATGGGGATGG + Intergenic
959908675 3:111738367-111738389 ATTTTTACACATCTTGGGGATGG + Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
964799667 3:160541688-160541710 CTGTTAACTCATGTTGGGGAGGG - Intronic
965564342 3:170096488-170096510 TGGTTGTCACAGCTTGGGGGTGG - Exonic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG + Intergenic
969731497 4:8960250-8960272 CTGTGGACACCCCTTAGGGACGG + Intergenic
974780030 4:66543139-66543161 ATGTTGACACTGCTGGGGCATGG - Intergenic
975556358 4:75669711-75669733 CCATTGACTCAGCTTGTGGATGG - Intronic
975649169 4:76574803-76574825 CAGTTGCCACAGGTTGGGGGAGG + Intronic
976439923 4:85061420-85061442 GTGATGACACAGCCTGGAGATGG - Intergenic
976625451 4:87176346-87176368 TGGTTGTCACAGCTTGGGGATGG - Intronic
979853078 4:125597613-125597635 CTGTTGACACTGAGTGGTGATGG + Intergenic
980369463 4:131848776-131848798 CTGTTGTCACAACTTGTGAATGG - Intergenic
984892944 4:184509603-184509625 TGGTGGACACAGCTTGGGGCAGG - Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986959496 5:13196609-13196631 ATGTTGCCACTACTTGGGGATGG - Intergenic
987147894 5:15010740-15010762 TAATTGACACAGATTGGGGAGGG + Intergenic
988456572 5:31392301-31392323 CAGTTGTCACAACTAGGGGAAGG + Intergenic
989419451 5:41219384-41219406 CTGTTGAGAGAGCTTTGGGAGGG + Intronic
990669522 5:58112539-58112561 TAGTTGTCTCAGCTTGGGGAAGG - Intergenic
993994264 5:94702174-94702196 CTGTTGTCACAGTTATGGGAGGG + Intronic
995091135 5:108178744-108178766 CTGTTGAAGCTGCTTGGGGGTGG - Intronic
995805328 5:116045971-116045993 CAGCTGAAACAGCTTGGAGAGGG + Intronic
997356117 5:133264067-133264089 TGGTTGTCACAACTTGGGGAGGG + Intronic
997622688 5:135308934-135308956 CTTTTGGAACAGCTTGGAGAGGG + Intronic
999131832 5:149289510-149289532 CTGTTGTCCCAGCTTGGATAGGG - Intronic
1001100508 5:168810098-168810120 CTGTCCACACATGTTGGGGAAGG + Intronic
1001671204 5:173475427-173475449 CTGATGGCACAGCTTGGAAAAGG + Intergenic
1001672756 5:173487769-173487791 TTGTTGCCACGGGTTGGGGATGG + Intergenic
1003581041 6:7341193-7341215 CAGTTGACACAGCTTGTGCTAGG + Intronic
1008443884 6:51565328-51565350 TAGCTGTCACAGCTTGGGGATGG - Intergenic
1010815863 6:80357346-80357368 CTGTTGAAACAGAATGGAGAGGG + Intergenic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1017018284 6:150118711-150118733 CTGCGGGCACAGCCTGGGGAAGG + Intergenic
1018770990 6:166971351-166971373 GTGTTGTCACAACTTGGGTAGGG - Intergenic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1020261432 7:6532595-6532617 CTGAGGACAGGGCTTGGGGAGGG - Intronic
1020406283 7:7839331-7839353 CTGTGGTCCCAGCTTGGGGGAGG - Intronic
1024048960 7:45606049-45606071 CTGTTGACACCATGTGGGGAGGG + Intronic
1024295603 7:47839582-47839604 CTGATGAACCAGCCTGGGGAAGG + Exonic
1024969935 7:55059638-55059660 TGGTTGCCACAGTTTGGGGAGGG - Intronic
1025738082 7:64171873-64171895 CTGGTTACATATCTTGGGGAAGG + Intronic
1030658765 7:112196634-112196656 CTGGTGACAGAGAGTGGGGAAGG + Intronic
1031351288 7:120734583-120734605 ATTTTGACAAAGATTGGGGAAGG - Intronic
1031385620 7:121147017-121147039 TGGTTGACACATCTTGGGGAGGG - Intronic
1031616590 7:123888943-123888965 CTGTTAACCCAATTTGGGGAGGG - Intergenic
1031970140 7:128058871-128058893 CTGCTGAGACAGATCGGGGATGG - Intronic
1032598225 7:133264028-133264050 CTGTGGACAATGCTTGGAGAAGG + Intronic
1033502585 7:141966539-141966561 CTGTTGCCAAGGCATGGGGAGGG + Intronic
1033797470 7:144864146-144864168 CTGTTGTCCCAGCTATGGGATGG - Intergenic
1034034531 7:147804881-147804903 CTGTGGACATAGCTTGGTGTGGG - Intronic
1034513347 7:151553757-151553779 CGGTTGTCACAGCTTGGGGTGGG - Intergenic
1034998230 7:155591773-155591795 CTATGGAGAGAGCTTGGGGAAGG - Intergenic
1035058959 7:156055201-156055223 ATGTTGACACAGGTGGGGGTGGG - Intergenic
1036765461 8:11547023-11547045 ATGTCCACACAGCATGGGGAAGG + Intronic
1037090806 8:14915639-14915661 ATGTTTACATAGCATGGGGAAGG - Intronic
1038684945 8:29707895-29707917 CCCTTGATACAGCTGGGGGAGGG + Intergenic
1040275268 8:46010610-46010632 ATGTTGAGGCAGCTTGGGAAGGG - Intergenic
1041642505 8:60218184-60218206 CTCTTGACCTGGCTTGGGGAAGG + Intronic
1041726545 8:61023348-61023370 TTGTTTACACAGCTTGGAGACGG + Intergenic
1041904402 8:63015846-63015868 TTGATAACACAGCCTGGGGATGG + Intronic
1042776352 8:72436265-72436287 GTGTTGACACAGCTTGGGTATGG - Intergenic
1043270331 8:78325205-78325227 CAGTTCACACAGCTGGGGGCTGG - Intergenic
1044190166 8:89306560-89306582 CTGTAGACACTGATTTGGGAGGG - Intergenic
1044193185 8:89343352-89343374 ATGCTGCCACAGCTGGGGGATGG + Intergenic
1044771960 8:95645568-95645590 CTCTTTACTCAGCTTGGGGGTGG + Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1048169860 8:132096005-132096027 GAGTTGCCACAGCTTGAGGATGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049276181 8:141721189-141721211 GTGTGGACACAGCTGGGGGGAGG - Intergenic
1049372078 8:142272710-142272732 CTCCTGACACACCGTGGGGAGGG + Intronic
1049372096 8:142272792-142272814 CTCCTGACACACCGTGGGGAGGG + Intronic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1053633843 9:39974444-39974466 CTGTTGTCACAACTTGTGAATGG - Intergenic
1053771904 9:41489056-41489078 CTGTTGTCACAACTTGTGAATGG + Intergenic
1054210044 9:62276253-62276275 CTGTTGTCACAACTTGTGAATGG + Intergenic
1054314950 9:63572673-63572695 CTGTTGTCACAACTTGTGAATGG - Intergenic
1057955091 9:99401051-99401073 AAGTTGAAACAGCTGGGGGAGGG - Intergenic
1059842975 9:118239136-118239158 CAGTTTACACTGCTTGGGGTTGG + Intergenic
1060401120 9:123350116-123350138 CTGGCAAAACAGCTTGGGGAGGG - Intergenic
1060879052 9:127104922-127104944 CTGTTCAGAGAGCTTGGGGCAGG - Intronic
1060962587 9:127691546-127691568 CTGTGGACACAGGCTGGGGAGGG - Exonic
1061005475 9:127926716-127926738 CTGTTGCCACCGCCTGGGGTTGG - Intronic
1185814135 X:3138403-3138425 TTGTTGATACAGGTTGGGGGAGG - Intergenic
1186432100 X:9513667-9513689 GGGTTGTCACAGCTTGGGGAGGG + Intronic
1187971366 X:24662353-24662375 TTGTTGTCACATCTTGGGGCTGG + Intronic
1188365548 X:29310455-29310477 CTAATGAGACAGCATGGGGAAGG + Intronic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1191226497 X:58049733-58049755 CTTGTGACACAGATTCGGGAGGG + Intergenic
1194445738 X:93985708-93985730 CTGTTGAGGCAGCTTGGGTAAGG - Intergenic
1194915766 X:99706631-99706653 CTTTTGACCCTGTTTGGGGATGG - Intergenic
1195243539 X:102976720-102976742 GAGTTTACACAGCTTGAGGATGG - Intergenic
1195907601 X:109861052-109861074 CTGAAGGCTCAGCTTGGGGAAGG - Intergenic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1196731501 X:118945460-118945482 CAGTTGTCACAATTTGGGGAGGG + Intergenic
1197169501 X:123415452-123415474 ATGTTGACAAAGTTGGGGGAGGG + Intronic
1197627593 X:128820063-128820085 CTTTTGACCCATCTTGGGCAAGG + Intergenic
1198740893 X:139841635-139841657 CTGTAGTCTCAGCATGGGGATGG - Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200268567 X:154660153-154660175 CTGGAGACACAGCTACGGGAAGG - Intergenic
1201267572 Y:12223079-12223101 TTGTTGATACAGGTTGGGGGAGG + Intergenic