ID: 1180713273

View in Genome Browser
Species Human (GRCh38)
Location 22:17854509-17854531
Sequence CCTGTTCACCAGGCAGTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180713273_1180713281 22 Left 1180713273 22:17854509-17854531 CCGAGAACTGCCTGGTGAACAGG 0: 1
1: 0
2: 2
3: 17
4: 260
Right 1180713281 22:17854554-17854576 AGACAGGAAATCCATGAGAGAGG 0: 1
1: 0
2: 1
3: 24
4: 292
1180713273_1180713278 6 Left 1180713273 22:17854509-17854531 CCGAGAACTGCCTGGTGAACAGG 0: 1
1: 0
2: 2
3: 17
4: 260
Right 1180713278 22:17854538-17854560 TGGGCTTGCCGTCCACAGACAGG 0: 1
1: 0
2: 1
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180713273 Original CRISPR CCTGTTCACCAGGCAGTTCT CGG (reversed) Intronic
900230725 1:1555794-1555816 CCTGTTGCCCAGGCTGGTCTTGG - Intronic
900983008 1:6057298-6057320 CAGGTTCACCAGGAAGTACTTGG + Intronic
902389202 1:16092923-16092945 GCTGGTCCCCAGGCAGATCTGGG - Intergenic
904058256 1:27686384-27686406 CCTGTTTTCCAGGCAGCTCCTGG - Intergenic
904648426 1:31986174-31986196 CCTGTTGCCCAGGCTGGTCTTGG - Intergenic
905906316 1:41620863-41620885 ACTGTGCACCAGGCAGTGCTGGG + Intronic
906383557 1:45347983-45348005 CCTCTTTATCAGGCAGTTCTAGG + Exonic
907262083 1:53226500-53226522 CATGTTAGCCAGGCAGGTCTTGG + Intergenic
907677640 1:56533254-56533276 CATGTTGACCAGGCTGGTCTCGG + Intronic
908909293 1:69054319-69054341 CATGTTGCCCAGGCTGTTCTTGG - Intergenic
909788347 1:79642782-79642804 CCTCCTCACCAGGCAGAGCTAGG - Intergenic
910330145 1:86063714-86063736 CTTGTTCACCTGGAAGTCCTGGG + Exonic
911312115 1:96306040-96306062 CATGTTGACCAGGCTGGTCTTGG - Intergenic
912194861 1:107385734-107385756 CCTGTGCAGCAGGAAGTTTTAGG - Intronic
912863737 1:113237877-113237899 CCTCTTCATCAGGCTGTTGTAGG + Intergenic
913016635 1:114743391-114743413 CATGTTGACCAGGCTGTTCTCGG + Intronic
913146200 1:115992825-115992847 CATGTTGACCAGGCTGCTCTTGG + Intronic
915329752 1:155103359-155103381 CATGTTGGCCAGGCTGTTCTCGG + Intergenic
915522263 1:156454132-156454154 CATGTTCCCCAGGCTGGTCTTGG - Intergenic
918569470 1:185971768-185971790 AGTGTTCACCAGACAGTTCAGGG - Intronic
920093556 1:203471211-203471233 CATGTTGACCAGGCTGGTCTTGG - Intergenic
920849475 1:209618817-209618839 CCTGTTCTCCAGGGATTTCTGGG + Intronic
920856811 1:209669527-209669549 GGTGTTCACCAGGTGGTTCTGGG - Intergenic
922857129 1:228784627-228784649 CCTGTTCCCCAGGCCTTCCTTGG + Intergenic
924105995 1:240649606-240649628 CCTGTTGCCCAGGCCGGTCTCGG + Intergenic
924473096 1:244360681-244360703 CATGTTGACCAGGCTGGTCTTGG - Intronic
1065388084 10:25153592-25153614 CCTATGCATCAGACAGTTCTTGG + Intergenic
1065586157 10:27219098-27219120 CATGTTGACCAGGCTGGTCTTGG - Intronic
1066003990 10:31130409-31130431 ACTGTGCACCAGGCACCTCTTGG - Intergenic
1067254971 10:44628602-44628624 CCTGTCCACATGGCATTTCTTGG + Intergenic
1069410049 10:68143954-68143976 CATGTTGGCCAGGCTGTTCTTGG + Intronic
1069644003 10:69978728-69978750 CCTGTTGGCCAGGCTGGTCTTGG - Intergenic
1070283466 10:75067159-75067181 CATGTTGACCAGGCTGGTCTCGG + Intergenic
1070364500 10:75723243-75723265 CCAGCTCACCAGCCAGTTCATGG - Intronic
1070671940 10:78383942-78383964 CAGATTCACCAGGCAGGTCTTGG + Intergenic
1072663247 10:97375900-97375922 CATGTTGGCCAGGCAGGTCTCGG - Intronic
1072690459 10:97569510-97569532 CCTGGTCATCAGGCTGTCCTAGG + Intronic
1074569458 10:114611263-114611285 CATGTTGGCCAGGCTGTTCTCGG - Intronic
1075245598 10:120819357-120819379 CCTTCTCACCACGCAGCTCTTGG + Intergenic
1075456823 10:122590244-122590266 CCTGTACACCAGTCAGGTGTAGG + Intronic
1075761764 10:124863026-124863048 CATGTTGCCCAGGCAGGTCTCGG + Intergenic
1076677213 10:132153375-132153397 CCAGCTCACCAGGCAGGTCAGGG - Intronic
1077068531 11:656355-656377 CCTGTTGGCCAGGCTGGTCTCGG + Intronic
1077186278 11:1236789-1236811 CCGGTTCCCCAGGCAGTGCCTGG - Intronic
1077498013 11:2896075-2896097 CCTGCTCACCAGCCAGAACTGGG - Intronic
1079478037 11:20851763-20851785 CCTTGCCACCAGGAAGTTCTTGG + Intronic
1081750736 11:45509088-45509110 CCTGTACAGCAGGCAGAGCTTGG + Intergenic
1081865281 11:46356295-46356317 CCAGTGCAGCAGGAAGTTCTCGG + Intronic
1082881374 11:58041359-58041381 GCTGTGCACCAGGCAGATTTTGG - Intronic
1085203033 11:74713214-74713236 CCAGATCCCCAGGCAGTGCTGGG - Intronic
1088382173 11:109205667-109205689 ACTGTGAACCAGGCAGTTTTAGG + Intergenic
1088893608 11:114062027-114062049 CCTGTCCACCGGGCAGTTGTGGG + Intronic
1090071267 11:123546581-123546603 CCTGTTCCCCAGTGAGGTCTGGG + Intronic
1090247963 11:125230125-125230147 CCTGTGCCACAGGCAGTGCTGGG - Intronic
1091699466 12:2650572-2650594 CCTGCTCACCAGGCCGATGTGGG + Intronic
1093961998 12:25284316-25284338 CATGTTGGCCAGGCTGTTCTTGG - Intergenic
1097474928 12:60042112-60042134 CATGTTGGCCAGGCTGTTCTGGG - Intergenic
1099683019 12:85852056-85852078 CCTGTTCAACTGGAAGTCCTAGG - Intergenic
1100134385 12:91537561-91537583 CATGTTGACCAGGCTGATCTTGG + Intergenic
1101586831 12:106092313-106092335 CATGTTGACCAGGCTGGTCTCGG - Intronic
1102206738 12:111096152-111096174 TCTGAGCACCAGGCAGCTCTTGG - Intronic
1103351366 12:120286036-120286058 CATGTTGACCAGGCTGGTCTCGG - Intergenic
1103474448 12:121208629-121208651 CCTGTTCACTGGACAGTACTTGG + Intergenic
1103617578 12:122164378-122164400 CATGTTGACCAGGCTGGTCTTGG + Intergenic
1103864392 12:124040346-124040368 CCTGATCCCCAGGAAGTCCTAGG - Intronic
1103940749 12:124500044-124500066 GCTGTTCCCCAGGCACCTCTCGG - Intronic
1104673120 12:130693988-130694010 CCTGCACACCAGGAAGCTCTGGG + Intronic
1113726354 13:112605541-112605563 CCATTTGACCAGGCAGTGCTGGG + Intergenic
1114588611 14:23838080-23838102 CCTGGTCACCAGGAAGATCAAGG - Intergenic
1114933825 14:27507792-27507814 CATGTTTCCCAGGCTGTTCTTGG + Intergenic
1117982726 14:61357930-61357952 TCTGGTCACCAGGCAGTGCAAGG - Intronic
1118351635 14:64976309-64976331 CATGTTGGCCAGGCTGTTCTTGG - Intronic
1118930631 14:70236920-70236942 TCTGTTCTCTAGGCAGGTCTTGG - Intergenic
1118954234 14:70465334-70465356 TCTGTTCTCTAGGCAGGTCTTGG + Intergenic
1119458728 14:74780003-74780025 CATGTTGACCAGGCTGGTCTTGG + Intronic
1121114796 14:91336197-91336219 CCTCTGCATCAGGGAGTTCTTGG - Intronic
1121311239 14:92936290-92936312 CCTGTCCAGGTGGCAGTTCTGGG + Intergenic
1123668431 15:22628855-22628877 TCTATTCAGCAGGCAATTCTGGG - Intergenic
1124952128 15:34333430-34333452 CGTGTTCCCCAGGCTGGTCTCGG + Intronic
1125710807 15:41784316-41784338 TCTTTTCACTAGCCAGTTCTAGG - Intronic
1125809832 15:42528785-42528807 CATGTTGACCAGGCTGGTCTTGG + Intronic
1126697815 15:51341021-51341043 CCTGTTGGCCAGGCAGTCCTGGG + Intergenic
1128052211 15:64674469-64674491 CCTATTCTCCATGCAGATCTTGG + Exonic
1128321315 15:66696651-66696673 TCAGTTCACAAGGCAGTTCAAGG + Intergenic
1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG + Intronic
1128699825 15:69796042-69796064 CCTCTTCTGCAGGCAGTCCTTGG + Intergenic
1128971125 15:72107345-72107367 CATGTTGACCAGGCTGGTCTGGG - Intronic
1132400467 15:101501960-101501982 CCTGGTCACCAGGGAGTCCTCGG - Intronic
1133294541 16:4744919-4744941 CCTGTGCACCACGCAGTCCAAGG + Exonic
1133334516 16:4998205-4998227 CATGTTGGCCAGGCTGTTCTTGG + Intronic
1135051547 16:19196974-19196996 TCTGTTTACCAGGCAGTTTTTGG - Intronic
1135393502 16:22113424-22113446 CATGTTGACCAGGCTGGTCTTGG + Intronic
1135547660 16:23376904-23376926 CCTGTCCACCAGGCAGGGATGGG + Intronic
1136455345 16:30377009-30377031 CGTGTTGGCCAGGCTGTTCTTGG - Intronic
1137837978 16:51612198-51612220 CCTTTTCACCAGGGAATTCCAGG + Intergenic
1138573809 16:57893594-57893616 CATGTTGACCAGGCTGGTCTGGG - Intronic
1140784675 16:78329060-78329082 CATGTTCGCCAGGCTGGTCTTGG + Intronic
1141670016 16:85486743-85486765 CCTGTTGCACAGGCTGTTCTCGG + Intergenic
1144569990 17:16391480-16391502 CCAGTTGACCAGGCAGTTAGTGG - Intergenic
1146290629 17:31604381-31604403 CCTGTGCACCTGGCTCTTCTTGG + Intergenic
1146428179 17:32763716-32763738 CATGTTGACCAGGCTGGTCTCGG - Intronic
1146491742 17:33288282-33288304 CCTGCTCAACAGGCAGCTCTGGG - Intronic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1147752169 17:42743068-42743090 CATGTTGCCCAGGCAGCTCTCGG + Intronic
1148027563 17:44599300-44599322 CCTGTTCTGCAGCCTGTTCTGGG - Intergenic
1148209719 17:45800825-45800847 CCTGTTCCCCAGGAACTTGTAGG + Intronic
1148714100 17:49703268-49703290 CCTGTTCACTGGGGAGCTCTGGG - Exonic
1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG + Intronic
1149653738 17:58297801-58297823 CATGTTGACCAGGCTGGTCTCGG - Intergenic
1151613020 17:75189072-75189094 CCTGTTGGCCAGGCTGATCTTGG - Intergenic
1151672900 17:75581833-75581855 CATGTTGACCAGGCTGGTCTCGG - Intergenic
1152753101 17:82075284-82075306 CATGTTCGCCAGGCTGGTCTTGG + Intergenic
1156961419 18:43036336-43036358 CATGTTGGCCAGGCTGTTCTAGG - Intronic
1158404754 18:57151305-57151327 CCTGCACCCCAGGCACTTCTAGG + Intergenic
1161888328 19:7014200-7014222 CATGTTGACCAGGCTGGTCTTGG - Intergenic
1164432745 19:28202055-28202077 CATGTTGGCCAGGCTGTTCTTGG + Intergenic
1164926149 19:32131587-32131609 TGTGTTCACCAGGCAGATATTGG - Intergenic
1165138698 19:33686596-33686618 CTGTTTTACCAGGCAGTTCTGGG + Intronic
1165787910 19:38473444-38473466 CATCTCCACCAGGCTGTTCTGGG - Exonic
1165920122 19:39291942-39291964 CCTGTTGGCCAGGCTGGTCTTGG + Intergenic
1168232107 19:55039328-55039350 CATGTTAACCAGGCTGGTCTCGG - Intronic
925359697 2:3268694-3268716 CCTGTTGACCAGGAAGCTTTGGG + Intronic
927009704 2:18890293-18890315 CCTGGTCACTAGGCATGTCTTGG - Intergenic
927738146 2:25541275-25541297 CATGTTGACCAGGCTGGTCTTGG - Intronic
927976956 2:27345914-27345936 CATGTTGACCAGGCTGGTCTTGG + Intronic
928020382 2:27699937-27699959 CATGTTGACCAGGCTGGTCTCGG - Intergenic
929150361 2:38742262-38742284 CTTGTTGCCCAGGCTGTTCTTGG - Intergenic
929745498 2:44653258-44653280 CCTCTTCACAAGGCAGGTGTGGG + Intronic
931904739 2:66830352-66830374 CTTTTTCACCTGGCATTTCTGGG + Intergenic
931969799 2:67573429-67573451 TCTGTCCACCAGGCAGGTCAAGG + Intergenic
933053777 2:77634912-77634934 CATGTTGGCCAGGCTGTTCTTGG + Intergenic
933673065 2:85027574-85027596 CATGTTGACCAGGCTGGTCTTGG + Intronic
933862406 2:86483079-86483101 CCTGTGCTGAAGGCAGTTCTAGG + Intronic
934522936 2:95031278-95031300 CCTGCCCACCTGGCAGCTCTGGG + Intronic
934652740 2:96101730-96101752 CCCGTGGACCAGGCAGTCCTGGG - Intergenic
934678182 2:96265010-96265032 CATGAACACCAGGCAGTTATGGG + Intronic
936267038 2:111018577-111018599 CCTGATCACATGGGAGTTCTAGG + Intronic
937554273 2:123133893-123133915 ACTGTTCATCAGGCAGTCATTGG - Intergenic
939549925 2:143602543-143602565 CCAGTTCACCAGGCTGATTTAGG - Intronic
941709304 2:168695140-168695162 CCTGTTCTCCTGGCAGCCCTAGG + Intronic
942462274 2:176176644-176176666 CCTCTTCATCTGGGAGTTCTTGG + Intergenic
944090550 2:195905055-195905077 CATATTCACCTGGTAGTTCTTGG - Intronic
946213261 2:218164218-218164240 CCTGGTCAGCAAGGAGTTCTTGG - Exonic
948075554 2:235162877-235162899 CCAGGTCCCCAGGCAGGTCTGGG + Intergenic
948130166 2:235594773-235594795 CATGTTGACCAGGCTGGTCTTGG + Intronic
1169171638 20:3470468-3470490 CCTGTTGGCCAGGCTGGTCTCGG + Intergenic
1169492211 20:6080871-6080893 CCAGTTCAAGAGACAGTTCTGGG + Intronic
1172151549 20:32794156-32794178 CCTGTTGCCCAGGCTGGTCTTGG - Intronic
1172919324 20:38468160-38468182 CCTGTTGGCCAGGCTGGTCTCGG + Intergenic
1173402453 20:42737427-42737449 CATGTTGACCAGGCTGGTCTTGG - Intronic
1175200115 20:57270927-57270949 CCTGTGCAGGAGGCAGCTCTTGG - Intergenic
1175929580 20:62487411-62487433 CCTGTTCACCAGGCAGATCGGGG + Intergenic
1176097457 20:63350829-63350851 CATGTTCACCAGGTCGATCTTGG + Exonic
1176172664 20:63703165-63703187 CCTGGTCAGCATCCAGTTCTAGG - Intronic
1176893446 21:14347199-14347221 CATGTTGACCAGGCTGGTCTCGG - Intergenic
1177915584 21:27084758-27084780 CATGTTGACCAGGCTGGTCTCGG - Intergenic
1178744147 21:35231260-35231282 CTTGTTCACCAGGAAGTTTAAGG + Intronic
1178851096 21:36212981-36213003 CCTGTTGGCCAGGCTGATCTTGG + Intronic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1181043387 22:20203460-20203482 CCTGTTCTGGAGGCAGTGCTGGG + Intergenic
1183696385 22:39425906-39425928 CCTGTTGGCCAGGCTGGTCTCGG + Intronic
1184016518 22:41789891-41789913 CCTGTTCACTAGGCAATTATAGG - Intronic
1184104535 22:42359805-42359827 CCTGCTCACCATGCTGTTCCTGG + Intergenic
1184393908 22:44221460-44221482 GCTGTTAACCTGGCAGCTCTGGG - Intergenic
1185427126 22:50778377-50778399 CCTGTTGGCCAGGCTGCTCTCGG - Intronic
949114205 3:299939-299961 CCTCTTCAACAGGAAGTTGTTGG + Intronic
949312361 3:2714135-2714157 CCTGTTGGCCAGGCAGTGTTGGG + Intronic
949415482 3:3809343-3809365 CATGTTAACCAGGCTGGTCTCGG + Intronic
952567007 3:34670791-34670813 CATCTTCACCAGGCTGGTCTTGG - Intergenic
954622284 3:52003042-52003064 TCTGCTCACCAAGCAGTCCTGGG + Intergenic
955851505 3:63224922-63224944 CCTGTTCATCAGGGAGATCTGGG - Intergenic
956804599 3:72796617-72796639 CATGTTGACCAGGCTGGTCTCGG - Intronic
958040134 3:88217678-88217700 ACTGTTCTTCAGGAAGTTCTTGG + Intergenic
958441490 3:94161556-94161578 CCTCTTCACTAGGCAGTATTTGG + Intergenic
959050818 3:101523449-101523471 GCTGTTCGCCAGGCTGGTCTAGG + Intergenic
959071397 3:101705064-101705086 CCTGTGCAGCCTGCAGTTCTTGG - Intergenic
959784977 3:110285244-110285266 CGTGTTGGCCAGGCAGGTCTCGG + Intergenic
960466100 3:117997812-117997834 CCTTTTCACGAGGAAGCTCTTGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961677579 3:128577035-128577057 CCTGGGCACCAGGCTGGTCTCGG + Intergenic
962030080 3:131590273-131590295 CCTGCTCCCCATTCAGTTCTTGG - Intronic
963624144 3:147649348-147649370 CATGTTGACCAGGCTGGTCTCGG - Intergenic
963974520 3:151466221-151466243 CCTGGTCACCTGGTATTTCTGGG - Intergenic
965981188 3:174693149-174693171 ACTATTCACCAGGATGTTCTTGG + Intronic
968265829 3:197362769-197362791 CATGTTGACCAGGCTGGTCTCGG + Intergenic
968707526 4:2087166-2087188 CCAGTTCATCAGGCAGTCCTGGG - Intronic
968978745 4:3835466-3835488 GCTGCTCCCCAGGCAGGTCTCGG - Intergenic
969057171 4:4409259-4409281 ACTGTTGCCCAGGCAGCTCTCGG - Intronic
971552178 4:27971154-27971176 CCAATTCACCATGAAGTTCTTGG + Intergenic
971563999 4:28116071-28116093 CCTGTTAACCAGGATGGTCTCGG + Intergenic
974022056 4:56700448-56700470 CCTGTTCACCCTGCAGATTTTGG + Intergenic
974060153 4:57026033-57026055 CATGTTGACCAGGCTGGTCTTGG - Intronic
976804418 4:89029943-89029965 CCTGTTAACCAGGTAGTGCTGGG - Intronic
977490782 4:97707316-97707338 CCTGTTGCCCAGGCTGGTCTTGG - Intronic
977939799 4:102845990-102846012 CCTGTTGGCCAGGCTGGTCTCGG + Intronic
978149943 4:105421839-105421861 CGTGTTAACCAGGCTGGTCTTGG - Intronic
978360751 4:107929236-107929258 CCTGTTGGCCAGGCTGGTCTAGG - Intergenic
979169316 4:117580455-117580477 CCTGTACCCTAAGCAGTTCTTGG - Intergenic
979209053 4:118077801-118077823 CATGTTCCCCAGGAAGTACTTGG - Intronic
979937064 4:126711072-126711094 CCTGTTCACCCTGCATTTATGGG + Intergenic
981498984 4:145426430-145426452 CATGTTGACCAGGCTGGTCTTGG - Intergenic
983276569 4:165624705-165624727 CCTATATACCAGGCATTTCTGGG + Intergenic
985959177 5:3286805-3286827 CCTGTTTACCAGGGAGTGCTGGG - Intergenic
986605895 5:9522379-9522401 CATGTTGGCCAGGCTGTTCTCGG - Intronic
986689398 5:10301801-10301823 CATGTTCGCCAGGCTGGTCTGGG + Intronic
986773727 5:10995409-10995431 CCAGACCACCAGGCAGCTCTTGG - Intronic
987860668 5:23483584-23483606 CCAATTCACCCTGCAGTTCTTGG + Intergenic
990470571 5:56111547-56111569 CCTGATCACCAGGCTGTTCTTGG + Exonic
990725122 5:58744941-58744963 CCTGGTCACCAGGCCATTATTGG + Intronic
990843816 5:60113864-60113886 CCTGTAAACCTGGCAGTTTTAGG - Intronic
991731941 5:69598142-69598164 CATGTTGACCAGGCTGGTCTCGG + Intergenic
991808375 5:70453286-70453308 CATGTTGACCAGGCTGGTCTCGG + Intergenic
991863011 5:71029715-71029737 CATGTTGACCAGGCTGGTCTCGG - Intergenic
995201971 5:109435323-109435345 CATGTTCACCGGGCTGGTCTCGG - Intergenic
996881375 5:128300270-128300292 CATGTCCACTAGGCAATTCTGGG + Intronic
997337894 5:133120687-133120709 CCTCTTCACCAAGGAGATCTGGG + Intergenic
997408182 5:133669243-133669265 CCTGCTCACCAGGAAGAGCTGGG - Intergenic
997975953 5:138441300-138441322 CATGTTCAACAGGCAGAGCTGGG + Intronic
998147484 5:139738495-139738517 ACTTTTCAGCAGGGAGTTCTGGG - Intergenic
999287092 5:150400608-150400630 GCTGTTCACCAGGCACCTCCAGG - Intergenic
999732381 5:154484246-154484268 GCTGTGCACCAGGCTGTTTTCGG + Intergenic
1000268681 5:159662054-159662076 AGAGTTGACCAGGCAGTTCTAGG - Intergenic
1002300654 5:178255730-178255752 CCAGTGAGCCAGGCAGTTCTGGG - Intronic
1005405027 6:25477514-25477536 CCTGTTCACCAGCTTGCTCTTGG + Intronic
1006621577 6:35368443-35368465 CATATTCACCAGGGAGTTTTGGG + Intronic
1010116683 6:72320231-72320253 CCTGTCTATCAGGCAATTCTTGG - Intronic
1010389896 6:75324846-75324868 CCTGTTCAACAGACGGTGCTGGG + Intronic
1013565644 6:111357964-111357986 CCAGCTCACAAGCCAGTTCTTGG - Intronic
1014434994 6:121410841-121410863 CCTGTTGGCCAGGCTGATCTCGG - Intergenic
1016287107 6:142485817-142485839 CATGTTGACCAGGCTGGTCTCGG - Intergenic
1020012842 7:4815909-4815931 CATGTCCACCGGGCAGTTCTGGG + Intronic
1023452552 7:40303233-40303255 CATGTTGACCAGGCTGGTCTTGG + Intronic
1023597831 7:41851224-41851246 ACTATGCACCAGGCATTTCTGGG - Intergenic
1023980835 7:45069000-45069022 CCTTAACACCAGGCAGGTCTAGG - Intronic
1024679030 7:51664411-51664433 CATGTTGACCAGGTAGTTTTTGG - Intergenic
1026142260 7:67716389-67716411 CATGTTGCCCAGGCTGTTCTCGG - Intergenic
1026495457 7:70897871-70897893 CCTGTTGTCCAGGCTGGTCTTGG + Intergenic
1032110919 7:129074602-129074624 CCTTTTCAAAAGGCAGCTCTAGG + Intergenic
1033235335 7:139633741-139633763 CATGTTGACCAGGCTGGTCTTGG - Intronic
1033841623 7:145381393-145381415 CCTCTTCAACAAACAGTTCTGGG - Intergenic
1035564437 8:631766-631788 CCTGTAAACATGGCAGTTCTCGG - Intronic
1035892064 8:3356471-3356493 CATGTTGACCAGGCTGGTCTCGG - Intronic
1039942850 8:42106048-42106070 TCTGTCCACCAAGCAGATCTAGG + Intergenic
1040361838 8:46672977-46672999 CATGTTGACCAGGCTGGTCTCGG + Intergenic
1042949828 8:74189487-74189509 CCTGTTCTGCAGGAAGTTCGAGG - Intergenic
1044443406 8:92246109-92246131 CATGTTGACCAGGCTGGTCTTGG + Intergenic
1047019823 8:120763201-120763223 CATCATTACCAGGCAGTTCTTGG - Intronic
1047190346 8:122673751-122673773 CTTCTTCACCAATCAGTTCTGGG - Intergenic
1047616265 8:126564887-126564909 GCATTTCACCAGGCAGTTCCAGG + Intergenic
1048546503 8:135392328-135392350 CATGTTGACCAGGCTGATCTTGG + Intergenic
1048771376 8:137898949-137898971 GCTGATGCCCAGGCAGTTCTTGG + Intergenic
1049615246 8:143573039-143573061 CCTGTTGACCAGGGAGCTCAGGG + Intergenic
1049959899 9:728397-728419 CGTGTTGACCAGGCTGGTCTCGG + Intronic
1051823354 9:21192916-21192938 ACTGTTCTCCACGCAGTTCCTGG + Intergenic
1051825173 9:21211452-21211474 ACTGTTCTCCACGCAGTTCCTGG + Intronic
1052868046 9:33477845-33477867 CATGTTCCCCAGGCTGGTCTTGG + Intergenic
1056113162 9:83416048-83416070 CCTCTTCAACAGGTACTTCTTGG + Intronic
1056406417 9:86280380-86280402 CATCTTCACCAGGCTGGTCTTGG - Intronic
1056809714 9:89754769-89754791 CCTTCTCACCAGGCCGTTCCTGG + Intergenic
1058185398 9:101848641-101848663 TCCGTTCAGCAGGCAGTTCCAGG - Intergenic
1058196518 9:101983662-101983684 CATGTTGACCAGGCTGGTCTTGG + Intergenic
1058545314 9:106054876-106054898 CCTGTGCACCAGTCAGTTTTTGG + Intergenic
1058655676 9:107218438-107218460 CCTGTTCACCAGAGAGCTCAAGG + Intergenic
1059335952 9:113568596-113568618 CCTGTTCCCCAGGCGCCTCTGGG + Intronic
1060319995 9:122549594-122549616 CCTATTCAACAAACAGTTCTAGG - Intergenic
1062339482 9:136087601-136087623 TCTGGTCACCAGGAAGGTCTAGG - Intronic
1185548318 X:964007-964029 CATGTTGACCAGGCTGGTCTCGG - Intergenic
1189496933 X:41517098-41517120 CCTGTGCTCCAGGCAGGCCTGGG - Intronic
1190238749 X:48639793-48639815 CATGTTGACCAGGCTGGTCTTGG - Intergenic
1190407197 X:50099922-50099944 TCTGTTAGCCAGGCAGTACTAGG + Intergenic
1191722373 X:64243932-64243954 CCTGTTCAACAAACAGTGCTAGG - Intergenic
1191892599 X:65960059-65960081 CCTGTTCTTCAGTCAGTTTTTGG - Intergenic
1192296699 X:69857104-69857126 CCTGTTCAACAACCGGTTCTGGG - Intronic
1192460690 X:71314556-71314578 CATGTTGACCAGGCTGGTCTTGG - Intergenic
1193141153 X:78028388-78028410 CATGTTGGCCAGGCAGGTCTCGG + Intronic
1193677053 X:84467423-84467445 CATGTTGACCAGGCTGGTCTTGG - Intronic
1194403695 X:93468223-93468245 ACTGTTTTCCAGGCAGGTCTCGG + Intergenic
1196687388 X:118523386-118523408 CATGTGCAGCAGGCAGTTCATGG + Intronic
1198691334 X:139288105-139288127 CTTGTTGACCAGGCTGGTCTCGG - Intergenic
1199971601 X:152865807-152865829 ACTCTCCTCCAGGCAGTTCTGGG + Exonic