ID: 1180717617

View in Genome Browser
Species Human (GRCh38)
Location 22:17882433-17882455
Sequence GAGATGCGGAGGGCCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180717609_1180717617 1 Left 1180717609 22:17882409-17882431 CCAGTCAGCCCTGCTTCTTGAAG No data
Right 1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG 0: 1
1: 0
2: 1
3: 21
4: 343
1180717612_1180717617 -7 Left 1180717612 22:17882417-17882439 CCCTGCTTCTTGAAGGGAGATGC 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG 0: 1
1: 0
2: 1
3: 21
4: 343
1180717608_1180717617 24 Left 1180717608 22:17882386-17882408 CCATGAGTCACAATGGGATGCTG 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG 0: 1
1: 0
2: 1
3: 21
4: 343
1180717613_1180717617 -8 Left 1180717613 22:17882418-17882440 CCTGCTTCTTGAAGGGAGATGCG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG 0: 1
1: 0
2: 1
3: 21
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180717617 Original CRISPR GAGATGCGGAGGGCCAGCCA TGG Intronic
900643075 1:3696555-3696577 GAGATGCAGAGGGGCAGCCTGGG + Intronic
900682606 1:3925106-3925128 CAGGTGCTGAGGGCCACCCAGGG - Intergenic
900755124 1:4429275-4429297 GAGGTGCTTAGGGCCAGGCATGG - Intergenic
900862252 1:5242032-5242054 GAGAGGCAGAAGGGCAGCCAAGG + Intergenic
901207912 1:7507883-7507905 GAGCTGCGGTGTGCCAGGCAGGG - Intronic
901436737 1:9251159-9251181 GCCATGATGAGGGCCAGCCAGGG - Intronic
901571512 1:10164723-10164745 GAGATGAGCAGGAACAGCCAGGG - Intronic
901774611 1:11551734-11551756 AAGATGGGAAGGGCCAGGCATGG + Intergenic
902331599 1:15733674-15733696 GAGATGGGGAGGGCCTGACAGGG + Intronic
902545209 1:17185640-17185662 GATATGGGGAGGGTCACCCAGGG - Intergenic
902551919 1:17224337-17224359 GAGATGGAGAGGGGCTGCCAGGG - Intronic
902587449 1:17449131-17449153 TAGATGAGGTGGGCCAGGCATGG - Intergenic
902688719 1:18096298-18096320 GAGATACGAAGGCCCAGCGAGGG + Intergenic
903044051 1:20552812-20552834 GAGATGCCCAGTGCCAGGCAGGG - Exonic
903218240 1:21854803-21854825 GGGGTGGGGAGGGCAAGCCAGGG - Intronic
909974505 1:82029467-82029489 GAGATGGGGACGGACAGACAGGG + Intergenic
912571969 1:110631368-110631390 GAGAAGAGGAGGGGCAGCAAGGG - Intronic
913037898 1:114990972-114990994 GAGATGCGTAGGGCAAGGTATGG - Intronic
913505430 1:119512498-119512520 TAAATGCGGAGGGCCAGGCCGGG - Intronic
914347034 1:146808741-146808763 GAGATGGGAAGGGCCATCAATGG + Intergenic
915093660 1:153444191-153444213 GAGATGCTGAGGCCCAGAGAGGG + Intergenic
917959167 1:180128780-180128802 GGGAAGAGGAGGGCGAGCCATGG - Intergenic
920112880 1:203599407-203599429 TAGTTGCTGTGGGCCAGCCATGG + Intergenic
920657292 1:207886430-207886452 GTGGTGGGGAGGACCAGCCAGGG - Intronic
920780783 1:208989107-208989129 GAGAGCCGGAGGGCCAGCTCTGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
921686578 1:218095649-218095671 GAGATGCAGAGAGCCAGGTATGG - Intergenic
923209539 1:231790806-231790828 GAGATGTGGAAGGCCAGGCGCGG - Intronic
923573733 1:235140137-235140159 GAGGTGCGGAGAGCAAGCGAGGG - Intronic
923637566 1:235715471-235715493 AAGAGTGGGAGGGCCAGCCATGG - Intronic
923856270 1:237848553-237848575 GAGATGCATAGGGCGAGGCATGG + Intergenic
924707808 1:246512864-246512886 GAGAGGCTGAGTCCCAGCCAGGG - Intergenic
1064432275 10:15281457-15281479 GATATGTGTGGGGCCAGCCAGGG + Intronic
1066111841 10:32204363-32204385 AAGATGCTCAGGGCCAGGCATGG + Intergenic
1067657385 10:48206502-48206524 GATATGTGGAGGTCCAGGCAAGG + Intronic
1068766844 10:60773748-60773770 GAGATGCTAAGGGGCAGCTATGG - Intergenic
1068821043 10:61377381-61377403 GAGGTGCTGAGAGCCAGCGAGGG + Intergenic
1069120462 10:64563667-64563689 GAGTTAGGGAGGGCCAGGCATGG + Intergenic
1069845347 10:71367179-71367201 GGGAGGCGGGGGGCCAGCCGTGG + Intergenic
1069868298 10:71517704-71517726 TAGATGCAGAGGGGCCGCCAAGG - Intronic
1070656972 10:78278362-78278384 GAGAAGCTGAGGCCCAACCAAGG - Intergenic
1070786667 10:79166061-79166083 GAGATGAGGACAGACAGCCACGG - Intronic
1071570107 10:86692101-86692123 GAGATGCTGAGGGGCCACCAGGG + Intronic
1071733610 10:88272999-88273021 GTGATGCTGTGGCCCAGCCAGGG + Intergenic
1072594855 10:96862110-96862132 GAGATGCATAGGGCAAGGCATGG + Intronic
1073262564 10:102201369-102201391 GAGGTGCTGAGAGCCAGCGAGGG + Intergenic
1073312794 10:102556181-102556203 GAGATGCCCACAGCCAGCCATGG + Intronic
1074763500 10:116684470-116684492 GTGTTGCTGAGGCCCAGCCATGG - Intronic
1074765442 10:116696705-116696727 GAGCTGCGGATGCCAAGCCAAGG - Intronic
1075174455 10:120146142-120146164 GAGATGCAGATAGCCAGGCATGG + Intergenic
1075316626 10:121458545-121458567 GGGATCCGCAGGGCCAGCCATGG - Intergenic
1076548269 10:131260455-131260477 GGGATGCAGAGGGTCAGCAAGGG + Intronic
1077430771 11:2514945-2514967 GAGGTGCGGAAGGACAGCGAAGG - Intronic
1077589942 11:3483581-3483603 AGGATGGGGAGGGCCAGTCACGG + Intergenic
1077972122 11:7205430-7205452 GAGACGCGTAGGGCCAGGTATGG - Intergenic
1078346508 11:10554436-10554458 GAGATGCATAGGGCCAGGTAGGG - Intergenic
1079187852 11:18253573-18253595 GAGATGTGGAGGGCGAGGTAAGG - Intergenic
1080105991 11:28512427-28512449 GAGATGGGGAGGCTCAGGCATGG + Intergenic
1080842701 11:35999466-35999488 GAGATGAGGAGGGGCAGGCTCGG - Intronic
1081705777 11:45181220-45181242 GCGCTGGCGAGGGCCAGCCAGGG - Intronic
1082142304 11:48623286-48623308 GAGATGTAGAGAGCCAGCAAAGG + Intergenic
1082272037 11:50183123-50183145 GAGGTGTGGAGAGCCAGCGAGGG - Intergenic
1082907104 11:58320358-58320380 CAGATGGGGAGGGCCAACCTGGG - Intergenic
1083305545 11:61760386-61760408 GCGATGGGGAGGGGCTGCCAGGG + Intronic
1083701034 11:64477800-64477822 GAGGTGCTAAGGGCAAGCCATGG + Intergenic
1083901502 11:65645665-65645687 GAGAGGAGGAGGGGCACCCAGGG + Intronic
1083993259 11:66259158-66259180 GAGTTATTGAGGGCCAGCCAGGG + Intronic
1084379374 11:68801337-68801359 GAGATGGGGTGGGCCAGGTATGG + Intronic
1085044074 11:73343283-73343305 GGGAGGGGGAGGGGCAGCCAGGG + Intronic
1085323604 11:75589975-75589997 GTGATGCTCAGGGACAGCCAGGG - Intronic
1085405565 11:76259777-76259799 GAGAGGAGGAGGGACAGACAAGG + Intergenic
1085645404 11:78219213-78219235 GAGATGGGAAGGGCCAGCTCTGG + Exonic
1085941088 11:81207584-81207606 GAGTTGCGGAGGGAGAGGCAGGG + Intergenic
1086130788 11:83400360-83400382 GAGATGAGCAAGGCCAGGCATGG + Intergenic
1086934112 11:92725257-92725279 TGAATGCTGAGGGCCAGCCAGGG + Intronic
1087805584 11:102552021-102552043 GAGATGAGAACGGCCAGGCAAGG + Intergenic
1088028722 11:105219680-105219702 GAGAAGTGGGGGGCCAGGCATGG + Intergenic
1088582267 11:111327807-111327829 GAGATGAGGTGGCCCACCCAGGG + Intergenic
1089190806 11:116651872-116651894 GGGGTGCAGAGGGCCAGGCAAGG + Intergenic
1089644638 11:119870619-119870641 GAAATGGAGAGGGACAGCCATGG - Intergenic
1090252880 11:125263638-125263660 GAGCTGCCGAGGGCCAGACTGGG + Intronic
1091283644 11:134396299-134396321 GAGGAGCTGAGGGCCAGACATGG - Intronic
1091396064 12:154909-154931 GAGATGGGGCGGGGCAGCGAAGG - Intronic
1091548614 12:1520973-1520995 AAGAAGGTGAGGGCCAGCCATGG - Intergenic
1091831454 12:3553554-3553576 GAGACGCTGAGGCCCAGACAGGG - Intronic
1093435292 12:19129598-19129620 GGGATGCGGAGGGGCGGCGACGG + Intergenic
1093707323 12:22288762-22288784 GAGAAACGGAGGGCCAGCGTAGG - Intronic
1093910328 12:24740302-24740324 AAGATGCAGAGGGCCAGGCGAGG + Intergenic
1095300365 12:40577686-40577708 GAGAGTCGGAGAACCAGCCAGGG - Intergenic
1095861601 12:46923889-46923911 GAGATGCAGAGGGCAAGGTATGG + Intergenic
1096639900 12:52985695-52985717 GAGAGGCAGAAGGCCAGTCACGG - Intergenic
1098354834 12:69602573-69602595 GAGGTGCTGAGAACCAGCCAGGG - Intergenic
1099790634 12:87330066-87330088 GAGGTGCCGAGGGCAAGCGAGGG - Intergenic
1100078836 12:90823904-90823926 GAGGTGCGGAGAGCGAGCAAGGG - Intergenic
1100521384 12:95379459-95379481 GAGGTGCCGAGAGCCAGCGAGGG - Intronic
1100584623 12:95968984-95969006 GAGATGCCGAGAGCAAGCGAGGG - Intergenic
1101603811 12:106233021-106233043 GAGGTGCGGAGGGAGAGGCACGG + Intergenic
1101912055 12:108867327-108867349 GAGATTCTGAGGCCCAGCAAGGG - Intronic
1103623269 12:122201373-122201395 GACCTGCTGAGGGCCAGCCCTGG + Intronic
1104614602 12:130257164-130257186 GAGGTGCGGAGAGCAAGCGAGGG + Intergenic
1107151862 13:37121100-37121122 GAGAGGGGGAGGGGCAGCCATGG - Intergenic
1107417162 13:40211476-40211498 GAGGTGAAGAGGGGCAGCCATGG - Intergenic
1107655979 13:42592436-42592458 GAGATGCTTAGGGCCAGGTATGG + Intronic
1107914088 13:45131613-45131635 GAGAGGCAGAGGACCAGGCACGG + Intronic
1108118673 13:47160079-47160101 AAGATGCTGCGGCCCAGCCATGG + Intergenic
1108644056 13:52408590-52408612 GAGGTGCTGAGAGCCAGCGAGGG + Intergenic
1112431067 13:99350591-99350613 GAGATGCACAGGGCAAGGCATGG - Intronic
1113812815 13:113152882-113152904 GAGATGCTGAGAGACAGACAGGG + Intergenic
1114810342 14:25891942-25891964 GTGGTGCGGAGGGGCAGTCAGGG - Intergenic
1116786839 14:49297232-49297254 TTGATGAGGAGGGGCAGCCAAGG - Intergenic
1118184690 14:63526148-63526170 GACATGAAGAGGGCCAGGCATGG - Intronic
1118349729 14:64965165-64965187 GAGATGGGGTCGGCCAGCCATGG + Intronic
1118850084 14:69576375-69576397 GTGATGGGGAGGGCCAGGGAAGG + Intergenic
1119264269 14:73254829-73254851 GAGATGCTGAGGGCGAGGCTGGG - Intronic
1119684037 14:76616154-76616176 GAGATGCATAGGGCAAGGCATGG + Intergenic
1119770753 14:77219424-77219446 GGAATGCAGGGGGCCAGCCAAGG + Intronic
1122273370 14:100578264-100578286 GAGAGGGGGAGGCCCAGCCTAGG - Intronic
1122401832 14:101471978-101472000 GGGATGAGGAGGGGCCGCCAGGG + Intergenic
1122514450 14:102297512-102297534 GAGGTGCCGAGAGCCAGCGAGGG - Intronic
1122692909 14:103539528-103539550 GGGATGAGGAGGGCCCGACACGG - Intergenic
1122910430 14:104825255-104825277 GAGATGCAGAGGCACAGACAAGG + Intergenic
1122987080 14:105217447-105217469 GAGCTGCCGGGGGCCAGCCGGGG - Intronic
1124381686 15:29172813-29172835 GAGAGGGGGAGGTTCAGCCAGGG - Intronic
1125112133 15:36046804-36046826 GAGGTGCGGAGAGCAAGCGAGGG - Intergenic
1125769290 15:42154305-42154327 GTGAAGGTGAGGGCCAGCCAGGG - Exonic
1127092030 15:55476878-55476900 GAGTTCTGGAGGGCCAGGCATGG + Intronic
1128987910 15:72234664-72234686 GAGATGCACAGGGCCAGGTATGG - Intergenic
1129374084 15:75116455-75116477 GAGGCGCGGAGAGCGAGCCAGGG + Intronic
1132019593 15:98348816-98348838 GAGATGAGGAGGGCCTTCCCTGG - Intergenic
1132075627 15:98817544-98817566 GAGATTGGAAGGTCCAGCCATGG + Intronic
1132354423 15:101160600-101160622 GAGATGGGAACAGCCAGCCAGGG + Intergenic
1134031413 16:10995394-10995416 GAGATGGGGAAGGTTAGCCAGGG + Intronic
1134078888 16:11311309-11311331 GAGATGTGGAGGGGCAGGGAGGG + Intronic
1135018849 16:18946898-18946920 GAGAGTCACAGGGCCAGCCAGGG + Intergenic
1135822100 16:25693193-25693215 GAGACGCGGAGGGGAAGCCGCGG + Intronic
1137982248 16:53079843-53079865 GAGATGCAGAGGGCAAGGTATGG - Intronic
1138496696 16:57413276-57413298 GAGAGGCTGAGGCCCAGCCAGGG - Intronic
1139249497 16:65481311-65481333 GAAATGTGAAGGGCCAGTCACGG - Intergenic
1139986951 16:70906529-70906551 GAGATGGGAAGGGCCATCAATGG - Intronic
1142424233 16:89992510-89992532 GAGTGGAGGAGGGCAAGCCAGGG - Intergenic
1142485737 17:246737-246759 GAGATGGTGAGGGCCTGCCTGGG + Intronic
1142984922 17:3689995-3690017 GACCCACGGAGGGCCAGCCAAGG + Intronic
1143417964 17:6763821-6763843 GAGATGCGCTGCCCCAGCCACGG + Intronic
1143876803 17:9997874-9997896 GAGATGCACAGGGCCAGGGATGG + Intronic
1144952702 17:19002822-19002844 GAGAAGGGGAGGGCCAGAGAAGG + Intronic
1146003271 17:29144384-29144406 GAGATGGAGAGGGTCAGCCAAGG - Intronic
1146633907 17:34490206-34490228 GAGATGAGGGGGTGCAGCCAGGG + Intergenic
1147265424 17:39231670-39231692 GGGCTGGGGAGGGGCAGCCAAGG - Intergenic
1147536532 17:41325886-41325908 GAGAGGCTGAGTCCCAGCCAGGG + Intergenic
1147611010 17:41801809-41801831 CAGGTGCAGAGGACCAGCCAGGG + Intergenic
1148161660 17:45453672-45453694 AAGATGCTGAGTGACAGCCACGG - Exonic
1150392897 17:64800317-64800339 AAGATGCTGAGTGACAGCCACGG - Intergenic
1151448686 17:74183629-74183651 GAGAAGCTGTGTGCCAGCCAAGG - Intergenic
1151879218 17:76885130-76885152 GAGATGGGGAGTGCCTGCAAAGG + Intronic
1152404147 17:80086983-80087005 GAGATGGGGAGGATCACCCATGG + Intronic
1153013788 18:565229-565251 GGGATCTGGAAGGCCAGCCATGG + Intergenic
1154962836 18:21327435-21327457 GAGATGAGGAGGGACTGGCAAGG - Intronic
1155397906 18:25405914-25405936 GAGATGCATAGGGCGAGCTATGG + Intergenic
1157885733 18:51364523-51364545 GAGATGCTGAGAGGCCGCCAAGG - Intergenic
1157989661 18:52479512-52479534 GAGATGAGGAGGGGGAGCCAGGG - Intronic
1158223273 18:55171442-55171464 GAGATGAGGAGGGCAAGGTAAGG + Intergenic
1160715628 19:575395-575417 GAGACGCGGACGGCCAACCTTGG - Intronic
1160939675 19:1614418-1614440 GAGGTGAGGAGGGGCTGCCACGG + Intronic
1162799201 19:13101704-13101726 GAGGTGCAGAGGGTCAGCCTGGG - Intronic
1163810738 19:19429831-19429853 GAGATGCGGAGAATCAGCCCCGG - Intronic
1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG + Intronic
1167427973 19:49439347-49439369 GGGATGCCGAGGGCCAGTAAGGG - Intronic
925188825 2:1867025-1867047 GAGAGGGAGAGGGGCAGCCAGGG + Intronic
925315827 2:2922333-2922355 GGCATGGGGAGGGCCAGCGAGGG - Intergenic
925379436 2:3414995-3415017 CAGATACGGAGGACCAACCAAGG + Intronic
925537888 2:4935823-4935845 GAGGTGCCGAGAGCCAGCGAGGG + Intergenic
926134657 2:10328070-10328092 GTGATGCGGAAAGACAGCCAAGG + Intronic
926225061 2:10961420-10961442 GAGGTGAGAAGGGCCAGCCGAGG - Intergenic
926651458 2:15351384-15351406 GAAATACGGAAGGCCAGGCATGG + Intronic
926722707 2:15973295-15973317 CAGATGCTCAGGGCCAGGCACGG - Intergenic
927198147 2:20562117-20562139 GAGATGCCTAGGGCGAGGCATGG - Intronic
927900350 2:26814322-26814344 GAGGCGCGGAGAGCGAGCCAGGG - Intergenic
928031903 2:27787173-27787195 GAGATGAGGTTGGCCAGGCACGG + Intronic
928278763 2:29925339-29925361 GAAAGGTGGAGGGGCAGCCAAGG + Intergenic
928429302 2:31204707-31204729 GAGATGCACAGGGCAAGGCATGG - Intronic
931570887 2:63668206-63668228 GAGATGGCCAGGGACAGCCAGGG - Intronic
932193535 2:69762722-69762744 TGGATGAGGAGGGCCAGCTATGG + Intronic
932408534 2:71530459-71530481 GAAATCCCCAGGGCCAGCCAAGG - Intronic
932486389 2:72086740-72086762 GAGGTGCGGAGAGCAAGCGAGGG - Intergenic
932566808 2:72916068-72916090 GAGGTGGGGAGGGGCGGCCAGGG - Intergenic
932586897 2:73036148-73036170 CAGATGAGCAGGGCCAGCCTGGG + Intronic
932735229 2:74249718-74249740 GGGATCCTGAGGGGCAGCCATGG + Intronic
933775004 2:85766531-85766553 GGGAGACGCAGGGCCAGCCAGGG - Intronic
934986893 2:98893989-98894011 GAGATTCCGAGGGGCAGCCAGGG + Intronic
936252308 2:110876295-110876317 GAAATGAGGTGGGCCAGCCACGG + Intronic
936519267 2:113201618-113201640 GGGCTGCGGAGGGACTGCCATGG - Exonic
937319317 2:120951460-120951482 GGGATGGGGAGGGGCAGCTAGGG + Intronic
937389896 2:121476209-121476231 GAGAGGCTGAGGGATAGCCAGGG + Intronic
939703474 2:145422072-145422094 TGGATGTGGAGAGCCAGCCATGG - Intergenic
941137093 2:161732020-161732042 GAGATGCGTAGGGCAAGGCATGG + Intronic
942299676 2:174549056-174549078 GAGGTGCGGAGAGCGAGCCAGGG + Intergenic
943707111 2:191047205-191047227 GAGATGCACAGGGCAAGGCATGG - Intronic
943926551 2:193791225-193791247 GAGCTGCAGAGGGCTGGCCATGG - Intergenic
946422201 2:219571279-219571301 GGGGTGCGGAGGGCGAGCCGAGG + Exonic
947755422 2:232560165-232560187 GAGATGCGTAGGGCAAGGTATGG - Intronic
948319201 2:237056144-237056166 GAGGTGCACATGGCCAGCCAAGG + Intergenic
1170218548 20:13917159-13917181 CAGATGTGGAGCGCCAGTCAGGG - Intronic
1171218923 20:23375875-23375897 GAAGTGGGAAGGGCCAGCCAAGG - Exonic
1172193320 20:33075404-33075426 GAGATGAGGAGGGACAGCTGGGG - Intergenic
1172634289 20:36399497-36399519 GAGCTGGGAATGGCCAGCCAAGG + Intronic
1173261172 20:41437733-41437755 CAGATCCAGAGGGCCAACCAAGG - Intronic
1173991969 20:47310505-47310527 CAGATTAGGAGGGCCAGGCACGG + Intronic
1175336095 20:58197203-58197225 GAGAGGCGGAGGGCCAGGAGAGG - Intergenic
1175576560 20:60064951-60064973 GAGATGCATAGGGCCAGGCCTGG - Intronic
1175821927 20:61914650-61914672 GAGATGCGGGGTACCAGGCAGGG - Intronic
1177669729 21:24209177-24209199 GAGACGCGGAGAGCCAGCGAGGG + Intergenic
1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG + Intronic
1182024594 22:27108138-27108160 GAGATGCTGAGGCCCAGAGAGGG - Intergenic
1182270051 22:29147724-29147746 GAGATGCTGAGGGCATGCCTGGG + Intronic
1183544129 22:38446662-38446684 CAGATGCAAAGGGCCAGGCACGG + Intronic
1184649222 22:45912058-45912080 GAGATCCGGAGCGCCAGACCAGG - Intergenic
1184894241 22:47397819-47397841 GAGCAGCTGAGGCCCAGCCAGGG - Intergenic
949292681 3:2484765-2484787 GAGGTGCGGAGAGCGAGCAAGGG - Intronic
950510534 3:13423215-13423237 GAGATGCAGGGAGCCAGCCATGG + Intergenic
951734726 3:25851616-25851638 GAGACGCCGAGAGCCAGCGACGG - Intergenic
951779595 3:26347484-26347506 CAGATTCGCGGGGCCAGCCAGGG + Intergenic
953020786 3:39111891-39111913 CAGATGGGGAGGGCCAGGCCTGG - Intronic
953705812 3:45229344-45229366 GGGACCTGGAGGGCCAGCCAGGG + Intergenic
953930545 3:47003681-47003703 GAGATGGGGAGGGGCTGCCTAGG - Intronic
954621875 3:52001081-52001103 GGGATGGAGGGGGCCAGCCATGG + Intergenic
954703595 3:52466273-52466295 GAGACGAGGAGGGCCGGGCATGG + Intronic
956523727 3:70133400-70133422 GAGATGCTTAGGGCAAGACATGG - Intergenic
957058450 3:75462191-75462213 CAGATGCTGATGGCCAGTCATGG + Intergenic
957446060 3:80314354-80314376 GAGGTGCCGAGAGCAAGCCAGGG - Intergenic
957919694 3:86731799-86731821 GAGATGTGGAGGGAGAGGCATGG - Intergenic
961294998 3:125877511-125877533 CAGATGCTGATGGCCAGGCATGG - Intergenic
962809596 3:138949216-138949238 GAGACGCAGAGAGCCAGCCTGGG - Intronic
963651899 3:147989889-147989911 GAGGTGCTGAGAGCCAGCGAGGG + Intergenic
964802966 3:160574453-160574475 GAGGTGCGGAGAGCAAGCGAGGG + Intergenic
966500232 3:180630939-180630961 GAAATGCTAAGGTCCAGCCAGGG + Intronic
967234141 3:187367940-187367962 GAGATGTGGAGGGAGAGGCACGG - Intergenic
968547905 4:1207979-1208001 GAGAGGCCCAGGGCCAGCCTGGG + Intronic
968938162 4:3624399-3624421 GGGATGGGGAGGGGCAGCCTGGG + Intergenic
968938181 4:3624452-3624474 GGGATGGGGAGGGGCAGCCTGGG + Intergenic
968969445 4:3785951-3785973 GGGCTGAGGAGGGGCAGCCAGGG + Intergenic
969461849 4:7333197-7333219 GAGTTTCGGAGGAGCAGCCAAGG + Intronic
970509588 4:16768010-16768032 AAGATGCCGAGGGGCAGCCCTGG - Intronic
970628881 4:17920014-17920036 GAGATGCACAGGGCAAGGCATGG - Intronic
970801682 4:19979482-19979504 GAGATGTGGAGGGCCAGGCATGG + Intergenic
973144332 4:46805299-46805321 GAGGTGCCGAGAGCCAGCCAGGG + Intronic
974792843 4:66712922-66712944 GAGGTGCTGAGAGCAAGCCAGGG + Intergenic
975460845 4:74651254-74651276 GAGAGGGGGAGGGCCAGGGATGG + Intergenic
976897378 4:90128137-90128159 GCGATGCGGAGCGCTGGCCAAGG + Intronic
979865138 4:125744842-125744864 GAGGTGCGGAGAGCAAGCAAGGG - Intergenic
980567280 4:134560013-134560035 GAGAAGAGGAGTGCCAGCAAAGG - Intergenic
981145373 4:141317731-141317753 TAGGTTGGGAGGGCCAGCCATGG - Intergenic
982313280 4:154007029-154007051 GAGATGCATAGGGCCGGCGATGG - Intergenic
982768861 4:159377950-159377972 GAGGTGCTGAGAGCCAGCGAGGG - Intergenic
983064165 4:163190214-163190236 GAGGCGCGGAGAGCCAGCGAGGG + Intergenic
984238902 4:177193703-177193725 GAGGTGCGGAGAGCGAGCGAGGG + Intergenic
985926940 5:3026308-3026330 AAGATGCAGAGGGCCAGGCCAGG - Intergenic
986018024 5:3775031-3775053 GGCATGCAGAGGGCCTGCCATGG - Intergenic
986963558 5:13244194-13244216 GAGATGTGGAGGGAGAGGCACGG + Intergenic
987696522 5:21341249-21341271 GAGGCGCGGAGAGCCAGCGAGGG - Intergenic
988915979 5:35893377-35893399 GAGGTGCGGAGAGCAAGCGAGGG + Intergenic
991753780 5:69844150-69844172 GAGGTGCCGAGAGCCAGCGAGGG - Intergenic
991803397 5:70400877-70400899 GAGGTGCCGAGAGCCAGCGAGGG - Intergenic
991823299 5:70586360-70586382 GAGGTGCCGAGAGCCAGCGAGGG + Intergenic
993202273 5:84830788-84830810 GAGGTGCTGAGCGCCAGCGAGGG + Intergenic
993886987 5:93426336-93426358 GAGATGAGGTGGGCCGGGCATGG - Intergenic
995526618 5:113055306-113055328 GAGATGAGGAGGGCAGGCCTGGG - Intronic
995707330 5:114999187-114999209 GAGATGCTGAGAGCAAGCGAGGG - Intergenic
995875301 5:116783252-116783274 GGGGTGAGGAGGGCCAGGCACGG - Intergenic
997300523 5:132800317-132800339 CAGAAGAGGAGGGCCAGGCACGG - Intronic
997646359 5:135484735-135484757 GAGAGGCGTAAGGCCAGCCACGG - Intergenic
999068280 5:148715632-148715654 GGGAAGCAGAGGGCCAGGCATGG + Intergenic
999355241 5:150922847-150922869 GAGGTGAAGAGGGCCAGGCATGG + Intergenic
1001438686 5:171721061-171721083 GGGAGGTGGAGGGCCAGCGAAGG - Intergenic
1001593891 5:172885611-172885633 GAGAAGCTGAGGCCCAGCAAGGG + Intronic
1001648479 5:173299026-173299048 GAGATGCCAGGAGCCAGCCAGGG - Intergenic
1002570628 5:180137567-180137589 GTGAGGCGGAGGGCAGGCCAGGG - Intronic
1003366343 6:5478528-5478550 CAGATGGGGAGCTCCAGCCAGGG - Intronic
1003591587 6:7441264-7441286 GAGGTGTGGAGGGACAGGCACGG + Intergenic
1003848421 6:10197674-10197696 GAGATGCATACGGCCAGGCATGG - Intronic
1004294132 6:14394810-14394832 GAGATGCATAGGGCAAGGCATGG - Intergenic
1005973213 6:30777694-30777716 GAGGTACAGAGGGCCAGGCAGGG + Intergenic
1005975563 6:30795824-30795846 AAGATGCTGAGGGACAGCCCAGG - Intergenic
1006227145 6:32548431-32548453 GAGGTGCGGAGAGCAAGCGAGGG + Intergenic
1006375582 6:33670022-33670044 GAGATGAGAAGAGCCAGCCTTGG - Intronic
1006482879 6:34312874-34312896 GACATGGAGAGGGCCAGGCATGG + Intronic
1006589201 6:35141652-35141674 GAGAAGCGGAGGAGCCGCCAGGG + Intronic
1007203371 6:40130030-40130052 TAGATGTGGATGGCCAGCCCAGG - Intergenic
1008597975 6:53061892-53061914 GGGACGCGCAGGGCCAGCGAGGG - Intronic
1011259457 6:85456247-85456269 GAGATGCACAGGGCAAGGCATGG - Intronic
1011545676 6:88479346-88479368 GAGATGCTGAGTGACAGCCGTGG + Intergenic
1011601537 6:89064876-89064898 GAGGTGCGGAGAGCAAGCGAGGG - Intergenic
1012881615 6:104797776-104797798 GAAATGCCCAGGGCCAGGCATGG + Intronic
1013171576 6:107640960-107640982 GAGTTGCTGAAGGCCATCCAGGG - Intronic
1013582588 6:111551058-111551080 GACATGTGAAGGGGCAGCCAAGG + Intergenic
1013663609 6:112323778-112323800 GAGATGAGCTGGGCCAGGCATGG - Intergenic
1017801114 6:157897358-157897380 GAGATGCATAGGGCGAGGCATGG + Intronic
1018195575 6:161353591-161353613 GAGATGCAGAGGGCGAGGTATGG - Intronic
1018734761 6:166679605-166679627 GAGGTGCCGAGAGCGAGCCAGGG - Intronic
1018768815 6:166955422-166955444 CACACGCGGAGGGCGAGCCAAGG + Intronic
1019600671 7:1882127-1882149 GAGATGAGGAGGGGCAGCCTTGG + Intronic
1020163861 7:5793433-5793455 GAGGTGCCAAGAGCCAGCCAGGG - Intergenic
1021976593 7:26017383-26017405 GAGGTGGAGAGGGCCAGGCACGG + Intergenic
1023989427 7:45119274-45119296 GAGATGGGGAGGGGCAGGCCTGG + Intergenic
1023995697 7:45157810-45157832 CAGCTGCGGCCGGCCAGCCATGG + Exonic
1024826862 7:53400484-53400506 AAGCTGGGGAGGGCCAGGCACGG - Intergenic
1024982634 7:55170493-55170515 CAGATGCAGAAGGCCAGGCATGG - Intronic
1026058812 7:67008164-67008186 GAGCTGCACAGGGCCAGCTATGG + Intronic
1026188241 7:68100931-68100953 AAGATGAGGAAGGCCTGCCACGG + Intergenic
1026237072 7:68535609-68535631 GAGACGCGGAGAGCAAGCGAGGG + Intergenic
1026719275 7:72816870-72816892 GAGCTGCACAGGGCCAGCTATGG - Intronic
1026732670 7:72925199-72925221 GGGCTGCGGCGGGCCGGCCAGGG + Intronic
1028115866 7:86996792-86996814 GAGATGAGGAGTGATAGCCATGG - Intronic
1030238632 7:107294296-107294318 GATATGTAGAGGGCAAGCCATGG - Intronic
1032188346 7:129747041-129747063 GAGGGGAGGAGGGCCAGCTATGG + Intronic
1033237125 7:139646911-139646933 GAGGTGCGGAGGGGAAGCCTGGG - Intronic
1036854621 8:12231278-12231300 GAGATGCTGATGTCCAGGCATGG + Intergenic
1038281748 8:26171435-26171457 GAGATGCAGTGCGCCAGCCTGGG + Intergenic
1038480561 8:27898968-27898990 GAGATGCAGAGGGCCAGGTATGG - Intronic
1040510389 8:48088130-48088152 GAGATGCATAGGGCCAGGTATGG - Intergenic
1040968993 8:53113649-53113671 GAGATGCATAGGACCAGCTATGG - Intergenic
1041636752 8:60153464-60153486 GAGGTGCCGAGAGCCAGCCAGGG + Intergenic
1041724183 8:61003016-61003038 GAGCTGCAGAGAGCCAGCAAGGG - Intergenic
1043621107 8:82192759-82192781 GAGGTGCCGAGAGCCAGCGAGGG + Intergenic
1045509037 8:102799219-102799241 GAGATGCAGAGGGCAAGGAATGG - Intergenic
1046627795 8:116593653-116593675 GACATGTGAAGAGCCAGCCAGGG + Intergenic
1048676932 8:136793895-136793917 GAGAGGCGGAGGCTCAGGCATGG + Intergenic
1048987185 8:139740947-139740969 GAGATGCAGAGGCCCAGCCCTGG + Intronic
1049035640 8:140074002-140074024 GAGACGTGGAGAACCAGCCAAGG + Intronic
1049277263 8:141726098-141726120 AGGATGCGGAGGGACAGGCAGGG + Intergenic
1049443026 8:142617791-142617813 GAGATCAGCAGGGCCAGCCTGGG - Intergenic
1049741545 8:144243316-144243338 AAGAAGCGGGGGGCCACCCAGGG - Intronic
1049861959 8:144904852-144904874 GAGATGTGTAGGGCAAGGCATGG + Intergenic
1049944551 9:581145-581167 GAGATGTGGAGGGAAAGCCGTGG - Intronic
1049990910 9:990644-990666 GGGCTGCAGAGGCCCAGCCAAGG - Exonic
1050000460 9:1072012-1072034 GAGATGCAGGTGGCCAGCCACGG + Intergenic
1050371748 9:4929105-4929127 CAGATATGGAGGGCCAGCTAAGG - Intergenic
1051314264 9:15810911-15810933 GAGGTGCTGAGAGCGAGCCAGGG + Intronic
1051463720 9:17353787-17353809 GAGGTGCGGAGAGCAAGCGAGGG - Intronic
1051929126 9:22363981-22364003 GAGGTGCTGAGAGCGAGCCAGGG + Intergenic
1052816981 9:33109332-33109354 GAGATGCATAGGGCAAGGCATGG - Intronic
1054453009 9:65413306-65413328 GGGATGGGGAGGGGCAGCCTGGG - Intergenic
1055070832 9:72164019-72164041 GAGAAGAAGAGGTCCAGCCAGGG + Intronic
1057317645 9:93979940-93979962 GAGATAGGGAGGCCCTGCCAAGG - Intergenic
1058365145 9:104200584-104200606 GAGATGTGGAGGGAGAGGCACGG + Intergenic
1058644372 9:107116870-107116892 GAGATGCGGAGCGCAGGACAAGG + Intergenic
1060430860 9:123550505-123550527 GACCTGCGGTGGGCCAGACATGG + Intronic
1060662658 9:125413605-125413627 GAGAACAGGAGGGCAAGCCACGG + Intergenic
1061119475 9:128634390-128634412 GGGATGCAGGGGGCCAGGCAAGG + Intronic
1061572096 9:131484232-131484254 GAGATGCCCTGGGCCAGACAGGG - Intronic
1061712724 9:132498961-132498983 CAGATGGGGAGGGCCAAGCAGGG + Intronic
1062340736 9:136092925-136092947 GAGATGCAGAGAGGCAGCCTGGG + Intronic
1062454741 9:136630133-136630155 GAGCTGCTGAGGGGCAGCCTGGG - Intergenic
1062607022 9:137353020-137353042 GAGACCCGGAAGGCCAGCCGGGG - Intronic
1186487198 X:9942613-9942635 GAGATGTGTAGGGCGAGGCATGG + Intronic
1187373251 X:18727866-18727888 GAGATGCATAGGGCGAGGCAAGG + Intronic
1189334674 X:40163731-40163753 GTGATGCAGCGGGCCAGGCACGG + Intronic
1191841438 X:65516064-65516086 GAGATGCAGAAGGCCAGAAATGG - Intronic
1192961676 X:76138033-76138055 GAGATGTGGAGAGCCACTCATGG + Intergenic
1195266003 X:103180540-103180562 GAAATGCATAGGGCCAGGCAGGG + Intergenic
1196197962 X:112855226-112855248 GAGGTGTGGAGGGACAGGCATGG - Intergenic
1196351857 X:114741228-114741250 GAGATTGGGAGGGCCGGGCACGG + Intronic
1196905032 X:120422943-120422965 ATGATGCTGAGGGCCAGGCATGG - Intergenic
1198842778 X:140876670-140876692 GAGATGCCTAGGGCAAGGCATGG - Intergenic
1199190571 X:144965026-144965048 TAGATGAGGAGGGCCACCCCAGG + Intergenic
1200888604 Y:8298471-8298493 GAGGTGCCGAGAGCAAGCCAGGG - Intergenic
1202013842 Y:20379162-20379184 GAGATGTGGAGGGAGAGGCATGG + Intergenic