ID: 1180719486

View in Genome Browser
Species Human (GRCh38)
Location 22:17896777-17896799
Sequence CGAGAACGCCGCCTTGGTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180719486_1180719492 17 Left 1180719486 22:17896777-17896799 CCCGCACCAAGGCGGCGTTCTCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1180719492 22:17896817-17896839 GAAGTCAAACATGGCCACATCGG 0: 1
1: 0
2: 0
3: 10
4: 152
1180719486_1180719493 18 Left 1180719486 22:17896777-17896799 CCCGCACCAAGGCGGCGTTCTCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1180719493 22:17896818-17896840 AAGTCAAACATGGCCACATCGGG 0: 2
1: 0
2: 0
3: 10
4: 131
1180719486_1180719491 8 Left 1180719486 22:17896777-17896799 CCCGCACCAAGGCGGCGTTCTCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1180719491 22:17896808-17896830 CATACAAGTGAAGTCAAACATGG 0: 1
1: 0
2: 0
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180719486 Original CRISPR CGAGAACGCCGCCTTGGTGC GGG (reversed) Exonic
909793470 1:79702892-79702914 GGAGAAAGCCGCCTTAGGGCTGG + Intergenic
914941150 1:152023895-152023917 GGAGAAAGCAGCCTTGTTGCAGG + Intergenic
916103552 1:161413218-161413240 GGAGAAAACCGCCTTGGGGCTGG + Intergenic
1066682653 10:37949044-37949066 CGAGAATGCCGTCTTGATGGAGG - Intergenic
1076935536 10:133566063-133566085 CGGGAACGCGGCCTAGGGGCAGG - Intronic
1077043906 11:535993-536015 CGAGCATCCCGCCTTGGTCCCGG - Intronic
1077333869 11:1994787-1994809 TCAGAATGACGCCTTGGTGCTGG - Intergenic
1078542000 11:12220383-12220405 AGAGAACGCGGCCCTGGTGCGGG + Exonic
1084088491 11:66865641-66865663 CGAGATGGCAGCCTTGGTGGGGG - Intronic
1085429364 11:76433773-76433795 CAAGCACACCGCTTTGGTGCAGG - Intergenic
1202816852 11_KI270721v1_random:49969-49991 TCAGAATGACGCCTTGGTGCTGG - Intergenic
1126890263 15:53197497-53197519 CGAGAGCGCCCCCTAGGCGCTGG + Intergenic
1127453093 15:59135388-59135410 TGAGAACGCAGCCTGAGTGCTGG + Exonic
1132523492 16:402061-402083 AGCGAGCGCAGCCTTGGTGCGGG + Intronic
1137009820 16:35311202-35311224 GGAGAGAGCCTCCTTGGTGCAGG + Intergenic
1143527398 17:7480350-7480372 CAAGAACTCCTCCCTGGTGCTGG + Intronic
1143777613 17:9209694-9209716 CGAGGACCCCAGCTTGGTGCAGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159560114 18:69984567-69984589 CGAGAACTCTGCCTTGTTGCTGG + Intergenic
1159563125 18:70016992-70017014 AGAGAAGGCCCCCTGGGTGCGGG + Intronic
1161290751 19:3492268-3492290 CGAGGAGGCCGCCCTGGCGCTGG - Exonic
1162106736 19:8374252-8374274 CGAGAGCGCCCTCATGGTGCTGG + Exonic
1162794586 19:13079924-13079946 TGAGAACACCGCCTAGGTGGCGG + Intronic
925901397 2:8511745-8511767 CTAGAACACCGACTAGGTGCTGG - Intergenic
940259673 2:151766775-151766797 GGAGACCTCAGCCTTGGTGCAGG - Intergenic
940945744 2:159615821-159615843 CGAGTCCGCCGCCTTTGTGCCGG - Intronic
1180719486 22:17896777-17896799 CGAGAACGCCGCCTTGGTGCGGG - Exonic
1183506950 22:38214668-38214690 CGAGAACGCCGCCATGCGCCTGG + Exonic
961389187 3:126542365-126542387 GGAGGACGCGGCCTTCGTGCTGG + Exonic
968940117 4:3633351-3633373 AGAGAACCCCGGCTTGGAGCAGG + Intergenic
969015330 4:4100027-4100049 GGAGAACCCAGCCTTGGTGGAGG - Intergenic
969525763 4:7703309-7703331 CGATCACGCCGCCGTGGTCCAGG - Exonic
972727400 4:41757110-41757132 CAAGAAAGCTGCCTTGGTCCTGG + Intergenic
997302381 5:132814812-132814834 CGAGGACGCTGCCGTGCTGCTGG + Exonic
1002512700 5:179733126-179733148 CGCGAACTCCGCCATGGGGCAGG - Exonic
1017788044 6:157772588-157772610 CCACAACGCCGCCTTGGTTTTGG + Intronic
1018871532 6:167787496-167787518 CGGGAAGCCGGCCTTGGTGCTGG - Exonic
1034489812 7:151387226-151387248 CCAGGAAGCCTCCTTGGTGCAGG - Intronic
1039755671 8:40519335-40519357 GGAGAACACCCACTTGGTGCTGG - Intergenic
1049786366 8:144452800-144452822 AGAGAACCACGCCATGGTGCGGG - Intronic
1062372162 9:136245605-136245627 CGAGGACGCCGTGTGGGTGCTGG - Exonic
1203793642 EBV:164534-164556 CAAGAGCGCCGCCTTCGTGCTGG - Intergenic