ID: 1180721270

View in Genome Browser
Species Human (GRCh38)
Location 22:17910552-17910574
Sequence ATGGATGAACAGAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 997
Summary {0: 1, 1: 0, 2: 8, 3: 84, 4: 904}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180721261_1180721270 16 Left 1180721261 22:17910513-17910535 CCGGCCGAAGAGATTTCGACCTG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG 0: 1
1: 0
2: 8
3: 84
4: 904
1180721262_1180721270 12 Left 1180721262 22:17910517-17910539 CCGAAGAGATTTCGACCTGCAGG 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG 0: 1
1: 0
2: 8
3: 84
4: 904
1180721260_1180721270 17 Left 1180721260 22:17910512-17910534 CCCGGCCGAAGAGATTTCGACCT 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG 0: 1
1: 0
2: 8
3: 84
4: 904
1180721259_1180721270 18 Left 1180721259 22:17910511-17910533 CCCCGGCCGAAGAGATTTCGACC 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG 0: 1
1: 0
2: 8
3: 84
4: 904
1180721266_1180721270 -3 Left 1180721266 22:17910532-17910554 CCTGCAGGGCACTGGTGACAATG 0: 1
1: 0
2: 1
3: 14
4: 231
Right 1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG 0: 1
1: 0
2: 8
3: 84
4: 904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180721270 Original CRISPR ATGGATGAACAGAGGCAGGA TGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900509591 1:3052242-3052264 ATGGATGGATAGAGGTTGGAAGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900974438 1:6008300-6008322 GAGGATGAACAGAGGAACGAGGG - Intronic
901174427 1:7288536-7288558 ATGGAAGAGGAGAGGCAGGCAGG + Intronic
901304333 1:8221738-8221760 ATGGCTGAGCAGAGGCATGGAGG + Intergenic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901532743 1:9863760-9863782 GTGAAAGAACAGAGGCTGGAAGG + Intronic
901700445 1:11042436-11042458 ATGGATGAACGGACGAAGGATGG + Intronic
901760439 1:11467732-11467754 AAAGGTGAACAGATGCAGGAAGG + Intergenic
901922187 1:12545264-12545286 ATGAATGAAGGGAGGAAGGAAGG - Intergenic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
902232029 1:15034302-15034324 ACGGAAGAAATGAGGCAGGAGGG + Intronic
902441880 1:16435775-16435797 ATAAATGGACAGAGGCAGGCTGG - Intronic
902531542 1:17093876-17093898 ATAGAGGCACAGAGACAGGAAGG + Intronic
902738606 1:18418371-18418393 ATGGAAGAAGAAAGGAAGGAAGG + Intergenic
902800021 1:18823580-18823602 ATGGCTGAGCAGAGGCCTGAAGG + Intergenic
903238050 1:21963580-21963602 GTGGAAGCACAAAGGCAGGAAGG + Intergenic
903565977 1:24266178-24266200 ATGGATGGATAGAGGGAGGGTGG + Intergenic
903776168 1:25795209-25795231 GGGGATGGACAGAGGAAGGAGGG - Intergenic
903930345 1:26858359-26858381 ATTGAAGCCCAGAGGCAGGAAGG + Intergenic
904293705 1:29504191-29504213 TTGGCTGCCCAGAGGCAGGAGGG - Intergenic
904709474 1:32417989-32418011 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
905253058 1:36662107-36662129 ATGGACAAACAGAGGCTGGGAGG - Intergenic
906107367 1:43302835-43302857 AGGGCTGAACAAAGGCAGGCTGG + Intronic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906679033 1:47712464-47712486 ATGGAGAAACCAAGGCAGGAAGG - Intergenic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906784882 1:48606548-48606570 ACTGAGGAACAGAGGCAAGAAGG - Intronic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
906912074 1:49964141-49964163 ATGGAGGATCACAGGCTGGAAGG - Intronic
907835379 1:58103789-58103811 AAGGAAGAACAGAGACAGGGTGG - Intronic
908136359 1:61137503-61137525 AAGGATGAAAAGAGCCAGAAGGG - Intronic
908147214 1:61259358-61259380 ATGGAAGAACAGAGAGGGGAAGG - Intronic
908209536 1:61886220-61886242 AGGCATGAACAGAGGAAGAAAGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909061801 1:70887281-70887303 ATGCATGAAAAGTGCCAGGAAGG - Intronic
909375777 1:74940060-74940082 TTTGAAGAACAGAGGCAAGAAGG + Intergenic
909611723 1:77557900-77557922 ATCGATGAACAGAGGGCGGTGGG - Intronic
910258126 1:85269717-85269739 AGTGAGGAACAGAGGCAGGAGGG + Intronic
910701941 1:90084960-90084982 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910701947 1:90084987-90085009 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
912499973 1:110115167-110115189 AGGGAGGAACAGGGGCAGGAGGG - Intergenic
913329412 1:117654659-117654681 AAGGCTGAAAACAGGCAGGAAGG + Intergenic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
913428148 1:118757863-118757885 ATGGATGAAGGAAGGGAGGATGG + Intergenic
913481313 1:119291971-119291993 AAGGAAGAACAAAGGAAGGAAGG - Intergenic
913717912 1:121557203-121557225 ATTGAGGAATAGAAGCAGGAAGG - Intergenic
913964410 1:143363506-143363528 ATGGATGAACACAGGAAGAAAGG + Intergenic
914058779 1:144189112-144189134 ATGGATGAACACAGGAAGAAAGG + Intergenic
914120370 1:144777259-144777281 ATGGATGAACACAGGAAGAAAGG - Intergenic
916072886 1:161181712-161181734 ATGGAGGAACAGAGGCTCAAAGG - Intergenic
916822773 1:168415951-168415973 AAGGAAGAGCAGAGGCATGATGG - Intergenic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
918178843 1:182068971-182068993 AGGGAGGAACAAAGGAAGGAAGG + Intergenic
918474192 1:184905550-184905572 ATGTATGCACAGGGGCAAGAAGG - Intronic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
919236391 1:194849830-194849852 AAGGAAGAAAAGAGGGAGGAGGG - Intergenic
919472777 1:197999484-197999506 TTGTATGAAAAAAGGCAGGATGG + Intergenic
919588229 1:199465551-199465573 ATGAAGGAAGAGAGACAGGAGGG + Intergenic
919619007 1:199843781-199843803 AGGAAAGAACAGAGGGAGGAAGG - Intergenic
919787173 1:201266416-201266438 AGGGAGGAAGAGAGGAAGGAAGG - Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920691008 1:208146219-208146241 AGGGAAGAACAGAGTCAGAATGG - Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
921032699 1:211347603-211347625 ATGGATGGGGAGAGGAAGGATGG + Intronic
922030951 1:221797648-221797670 ATGAATGAAGACAGGGAGGATGG + Intergenic
922700128 1:227754432-227754454 ACGGATGGACAGATGGAGGAAGG - Intronic
922792793 1:228319321-228319343 ATGGATGAATAGTGGATGGAGGG - Intronic
922844056 1:228668972-228668994 CTGAATGAAAAGGGGCAGGATGG + Intergenic
923084047 1:230688699-230688721 ATTGATGAAGAGAGGGAGGTTGG + Intronic
923842271 1:237686051-237686073 TTGGCTGATCAGTGGCAGGATGG - Intronic
924348900 1:243096192-243096214 ATGGATGCACAGTGCCTGGATGG + Intergenic
1062940201 10:1415107-1415129 ATGGATGGGCAGAGGGATGATGG + Intronic
1063081920 10:2775453-2775475 AGGGTGGAAAAGAGGCAGGAAGG - Intergenic
1063236066 10:4117752-4117774 ATGGAGGGAGAGAGGAAGGAAGG + Intergenic
1063525273 10:6778937-6778959 AAGGAAGAAGAGAGGGAGGAAGG + Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1063894098 10:10661151-10661173 ATGGCTGGAAAGGGGCAGGAAGG - Intergenic
1064121424 10:12623080-12623102 ATGGAGGAAGGGAGGGAGGAAGG - Intronic
1064493514 10:15884715-15884737 ATGGAGGAAGGGAGGAAGGAAGG - Intergenic
1064652108 10:17519680-17519702 ATGGAGGAAGAAAGGAAGGAAGG + Intergenic
1066473423 10:35721727-35721749 AGGGAGGAAGGGAGGCAGGAGGG - Intergenic
1066487024 10:35856065-35856087 AGGGAAGAAGAGAGGTAGGAAGG - Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1068496761 10:57792532-57792554 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
1068597003 10:58913153-58913175 AAGGATGGAAAGAGGAAGGAAGG + Intergenic
1069652683 10:70061275-70061297 GTGGATGAATAGATTCAGGAAGG + Intronic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070395970 10:76011498-76011520 ATGGAGGAACTGAGGATGGAGGG - Intronic
1070739467 10:78893139-78893161 AGGGATGGACAGAGGGAGGGAGG + Intergenic
1070987008 10:80697787-80697809 AAGGATAAAAAGAGGAAGGAAGG - Intergenic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1072945166 10:99803461-99803483 ATGGAAGGAGAGAGGGAGGAAGG - Intronic
1073043622 10:100623537-100623559 ATGGAGAAAGACAGGCAGGAAGG + Intergenic
1073579702 10:104653961-104653983 AATGATTACCAGAGGCAGGAAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073977948 10:109121678-109121700 ATGGAGGAAGGGAGGGAGGAAGG - Intergenic
1074162135 10:110844043-110844065 ACGGATGACCACAGCCAGGAGGG + Intergenic
1074365911 10:112857354-112857376 ATTGATGAACAAATGAAGGAAGG - Intergenic
1074533095 10:114310435-114310457 CTGGATGACCTGAGGCAAGAGGG + Exonic
1075191506 10:120313650-120313672 AGGGAAGAACACAGGAAGGAAGG - Intergenic
1075273739 10:121075654-121075676 AGAGAGGAACAGAGGCGGGAAGG - Intergenic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1075663785 10:124216522-124216544 AGCGAGGCACAGAGGCAGGAAGG + Intergenic
1075678333 10:124313409-124313431 GAGGAGGAAAAGAGGCAGGAAGG + Intergenic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1075994603 10:126867075-126867097 AGGGATGAGCCAAGGCAGGAAGG + Intergenic
1076345557 10:129776534-129776556 AGGGAGGAACAAAGGAAGGAAGG + Intergenic
1076363206 10:129904529-129904551 ATAGATGAACAGAGGATGCATGG + Intronic
1076998305 11:310194-310216 AGAGATGCACAGAGGCTGGAAGG - Intronic
1077000437 11:319564-319586 AGAGATGCACAGAGGCCGGAAGG + Intergenic
1077194009 11:1270355-1270377 AAGGACCCACAGAGGCAGGATGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1077532463 11:3103651-3103673 AGGGGGCAACAGAGGCAGGAAGG - Intronic
1077532518 11:3103867-3103889 ATGGGGCTACAGAGGCAGGAAGG - Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077733845 11:4766720-4766742 AAGGATGAAAAAAGGAAGGAAGG - Intronic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078360256 11:10662468-10662490 ATGGCAGAACAGAAGCATGAAGG - Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078559349 11:12357043-12357065 AAGAAAGAAGAGAGGCAGGAGGG - Intronic
1078675435 11:13408218-13408240 AATGATGAACAGAACCAGGATGG - Intronic
1078734344 11:14006410-14006432 AGATAAGAACAGAGGCAGGAAGG + Intronic
1078779040 11:14419980-14420002 AGGCATGAACAGAGGCAGAGAGG + Intergenic
1079145255 11:17845514-17845536 ATCAGTGAACAGAGCCAGGATGG - Intronic
1079335765 11:19569210-19569232 ATGCATGAACAAGGGCAGGGAGG - Intronic
1080127527 11:28754454-28754476 AGGGAGGAACAGAGGGAAGAAGG + Intergenic
1080583288 11:33660606-33660628 ATGTAGCAACAGAGGCAGGTGGG - Intronic
1080754693 11:35185573-35185595 ATGGATGGAGAGAGGGAGGGAGG - Intronic
1080864181 11:36178800-36178822 ATGGATGTTCAAAGGCAGGAGGG - Intronic
1081413282 11:42784861-42784883 AGGAAGGAAGAGAGGCAGGAAGG + Intergenic
1081451724 11:43177323-43177345 ATGGAAAAAGGGAGGCAGGAGGG - Intergenic
1081517947 11:43851843-43851865 ATGTGTGAAGAGTGGCAGGAGGG - Intronic
1081576733 11:44323346-44323368 ATGAATGAAGAAAGGAAGGAAGG + Intergenic
1082763651 11:57149456-57149478 ATGGAGGAAAAGAGGAAGGGTGG + Intergenic
1082789686 11:57338728-57338750 ATGGTAGCACCGAGGCAGGAGGG - Intronic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1084323104 11:68384461-68384483 AAGGATGCACAGAGCCAAGAAGG - Intronic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084568568 11:69945417-69945439 ATGGATGAACAGATGATGAATGG + Intergenic
1084605288 11:70168597-70168619 ATGGATGAACAAAGGCAGTCAGG + Intronic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1084705126 11:70811653-70811675 ATGGATGAATAGATGATGGATGG - Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084952543 11:72674582-72674604 AGAGATAAACAGAGACAGGAAGG + Intronic
1085406872 11:76268676-76268698 ATGGATGGATAGAGGATGGATGG - Intergenic
1085642947 11:78204618-78204640 ATGAATGAATAGAGGCAAAAAGG - Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1085696066 11:78705699-78705721 ATGAATGAACGAAGGAAGGAAGG + Intronic
1085701998 11:78754018-78754040 ATGGAAGAACTGAGGGAGGGAGG - Intronic
1085845564 11:80060710-80060732 ACATATGAACAGAAGCAGGAGGG + Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086496827 11:87412600-87412622 ATGGCTGAACAGATGCAGCCAGG + Intergenic
1087518821 11:99203036-99203058 AGGGAGGAAGAGAGGGAGGAAGG + Intronic
1087625606 11:100592628-100592650 AGAGATGAACATAGGAAGGAGGG + Intergenic
1088122439 11:106385998-106386020 AGGCATGGACAGAGGGAGGAAGG - Intergenic
1089126705 11:116181290-116181312 ATGGAGTCACACAGGCAGGAAGG + Intergenic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1089255248 11:117190573-117190595 AGGGAGGAAGTGAGGCAGGAAGG - Intronic
1089387432 11:118077480-118077502 ATGGAGGAAGAGAGGAAGGCAGG - Intronic
1089419854 11:118323338-118323360 ATGGATGAATAGATGATGGATGG + Intergenic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1089610779 11:119667333-119667355 ATGGATGAAGAGAGGAAGGCAGG - Intronic
1090253436 11:125266496-125266518 ATGGATGTGTGGAGGCAGGAAGG + Intronic
1090314108 11:125769890-125769912 ATGGATGCTCAGAGGCAAAATGG + Intergenic
1090475086 11:127013044-127013066 AGGGATGGAGAGAGGAAGGAAGG + Intergenic
1090909538 11:131106397-131106419 ATGAAGGAACGGAGGCGGGAGGG + Intergenic
1091198293 11:133750378-133750400 ATTGAAGACCAGAGGCAGGAAGG + Intergenic
1091348403 11:134871983-134872005 AAGGATGAACTGACTCAGGATGG - Intergenic
1091512253 12:1139631-1139653 ATACATGAACACATGCAGGAAGG + Intronic
1091601619 12:1921346-1921368 ATAGATGATGAGAGGCAGGGTGG - Intergenic
1091845123 12:3649822-3649844 AAGGAGGAAGAGAGGAAGGAAGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1093816374 12:23553524-23553546 GTGGAAGAAGGGAGGCAGGAGGG + Intronic
1094083643 12:26565428-26565450 ATGAATGAAAATAGGAAGGAAGG + Intronic
1094390691 12:29947052-29947074 ATGAATGAAATGAGGAAGGAAGG + Intergenic
1094599800 12:31898508-31898530 AAGGAGGAAAGGAGGCAGGAAGG + Intergenic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1097357743 12:58621041-58621063 CTAGAGGAACAGAGGCTGGAAGG - Intronic
1097743703 12:63275283-63275305 ATGGATGAAAAGAGAAAGAAGGG - Intergenic
1098230962 12:68371306-68371328 TTGGATGAATGGAGGAAGGAAGG + Intergenic
1098230964 12:68371314-68371336 ATGGAGGAAGGAAGGCAGGAAGG + Intergenic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100267677 12:92993260-92993282 ATGAATTAACAGACGCTGGAAGG + Intergenic
1100370702 12:93966697-93966719 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
1100729405 12:97447461-97447483 AGGGAAGAAGAGAGGAAGGAAGG - Intergenic
1101081463 12:101189675-101189697 ATGAACGCACAGAGGTAGGAAGG - Intronic
1102248239 12:111368656-111368678 ATGGGTGATCAGCGGCAGAATGG + Intronic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104495890 12:129238173-129238195 ATGGGTGCACACAGGCAAGACGG + Intronic
1104531379 12:129574192-129574214 ATGGATTAATAGATGCAAGAAGG + Intronic
1104629209 12:130386410-130386432 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629216 12:130386443-130386465 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629223 12:130386476-130386498 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629238 12:130386543-130386565 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629246 12:130386576-130386598 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629255 12:130386610-130386632 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629264 12:130386644-130386666 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629273 12:130386678-130386700 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629282 12:130386712-130386734 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629291 12:130386746-130386768 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629300 12:130386780-130386802 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629308 12:130386813-130386835 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629316 12:130386846-130386868 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629324 12:130386879-130386901 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629333 12:130386913-130386935 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629342 12:130386947-130386969 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629351 12:130386981-130387003 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629360 12:130387015-130387037 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629368 12:130387048-130387070 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629376 12:130387081-130387103 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629384 12:130387114-130387136 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629393 12:130387148-130387170 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629402 12:130387182-130387204 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629410 12:130387215-130387237 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629421 12:130387249-130387271 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629429 12:130387282-130387304 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629437 12:130387315-130387337 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629448 12:130387349-130387371 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629457 12:130387383-130387405 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629466 12:130387417-130387439 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629474 12:130387450-130387472 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629485 12:130387484-130387506 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629493 12:130387517-130387539 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629501 12:130387550-130387572 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629509 12:130387584-130387606 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629516 12:130387617-130387639 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629524 12:130387650-130387672 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629533 12:130387684-130387706 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104693580 12:130846382-130846404 ATGAATGAACAGGGCAAGGAAGG + Intergenic
1105234893 13:18541187-18541209 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1105279634 13:18955886-18955908 ATGGATGAACAAATGCATGGAGG - Intergenic
1105641984 13:22275241-22275263 ATGGAGGAAGAAAGGAAGGAAGG - Intergenic
1106793182 13:33177702-33177724 ATGGAGGAAGGGAGGAAGGAGGG + Intronic
1106900583 13:34351269-34351291 ATGGATGAGTAGAGGGATGATGG + Intergenic
1107454855 13:40545787-40545809 AGGGAGGAAGAGAGGAAGGAAGG + Intergenic
1107476035 13:40736196-40736218 ATGAATGAAATGAAGCAGGAAGG + Intronic
1109642862 13:65213098-65213120 AAGGATGGAAAGAGGGAGGAAGG + Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1110367478 13:74703073-74703095 ATGGATGAACGAATGAAGGAAGG + Intergenic
1110610836 13:77485887-77485909 AAGGAGGAACAGAGGAGGGAGGG + Intergenic
1111099253 13:83559991-83560013 ATTGATCAACAGAGGCACCAGGG + Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1113072950 13:106439015-106439037 ATGGATGAAGGGAGGAAGGGAGG + Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113243332 13:108364965-108364987 AAGTATGAAAAGAGACAGGATGG - Intergenic
1113706795 13:112440087-112440109 ATGGAAGAACACAGGTAGCAGGG + Intergenic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114256901 14:21010866-21010888 ATGGATGAACAAATGCCTGAAGG + Intergenic
1114638709 14:24204455-24204477 ATGTAGGGACTGAGGCAGGAGGG + Intronic
1114688581 14:24558880-24558902 GTGGATGAATACAGGCAAGAAGG - Intergenic
1115175609 14:30558817-30558839 AAGCACGAACGGAGGCAGGAGGG - Intergenic
1115327259 14:32153938-32153960 AGAGAGGAACAGAGGAAGGAAGG + Intronic
1116231680 14:42226444-42226466 ATGGACCACCAGTGGCAGGAGGG - Intergenic
1116944712 14:50825856-50825878 ATGGATCAAGGGAGGTAGGAAGG - Intronic
1117010065 14:51462034-51462056 AAGGAGGAAGAGAGGAAGGAAGG + Intergenic
1117212378 14:53513908-53513930 ATGTGTGAACAAAGGCAGTACGG + Intergenic
1119151336 14:72362483-72362505 ATGGCTCAACTGAGGCTGGAGGG + Intronic
1120005692 14:79355268-79355290 TTGGAGGGACAGAGGAAGGAGGG - Intronic
1120287125 14:82518104-82518126 AAGGATGAAGAAAGGAAGGAAGG + Intergenic
1120982306 14:90300922-90300944 AAGGAGGAACACAGGCAGGCAGG + Intronic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121277072 14:92675813-92675835 ATAAAGGAACAGTGGCAGGAAGG - Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121627186 14:95394481-95394503 AGAGATGAACAGAGGATGGATGG + Intergenic
1121726829 14:96158465-96158487 GAGGATGAACAGAGGTAGAAGGG + Intergenic
1122024782 14:98867839-98867861 ATGGAGGAGCACAGGCAGGCTGG - Intergenic
1122233714 14:100320401-100320423 ATGGATGGACAGAGGGATGGAGG - Intergenic
1122369936 14:101224007-101224029 ACCGAAGAACAGAGGCAGGAAGG + Intergenic
1202940873 14_KI270725v1_random:143889-143911 AGGGAAGAATAGAGGCAGGAAGG + Intergenic
1123415703 15:20093490-20093512 AGGCCTGAACACAGGCAGGAAGG + Intergenic
1123525042 15:21100604-21100626 AGGCCTGAACACAGGCAGGAAGG + Intergenic
1124124214 15:26923694-26923716 AGGGAAGAACAGAGACAGGCTGG - Intronic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1124656786 15:31515638-31515660 ATGGATGAAGAGAGAGAGGGAGG - Intronic
1125294302 15:38185595-38185617 ATGGAAGAAAAGAGGGAGGTTGG + Intergenic
1125303454 15:38282613-38282635 ATGGATAAGCAGTGGTAGGATGG + Intronic
1125756961 15:42070915-42070937 ATGGATGACCTGTGGCAGGGTGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126370224 15:47938080-47938102 AGGGAGGAACAGAGGAAGGGAGG + Intergenic
1127457212 15:59165934-59165956 CTGGCTGAACTGTGGCAGGATGG + Intronic
1127905655 15:63374031-63374053 AAGGATGGAGGGAGGCAGGAAGG - Intronic
1128231452 15:66038354-66038376 ATGGAGGCTCAGAGGCAGGCAGG - Intronic
1128677802 15:69624619-69624641 AGGGAGGAAGAAAGGCAGGAAGG - Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1128793740 15:70450336-70450358 ATGGATGAATAGAGGGATGGAGG + Intergenic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130216306 15:81973746-81973768 AGGGAAGAACAGAGGGAGGGAGG + Intergenic
1130533556 15:84766558-84766580 AGGGAGGAAGAGAGGCATGAGGG + Intronic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131460040 15:92611279-92611301 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
1131815026 15:96213177-96213199 AGGGAAGTACAGATGCAGGAAGG - Intergenic
1131856718 15:96605178-96605200 ATGGAAGAGCAGAGGAACGAAGG + Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1132789133 16:1675371-1675393 GGGGATGAAATGAGGCAGGAAGG - Exonic
1132958919 16:2611642-2611664 CTGGAAGGACGGAGGCAGGAGGG - Intergenic
1133326832 16:4947073-4947095 ATGGATGGATGGAGGAAGGAAGG - Intronic
1133530916 16:6653997-6654019 ATGGATGGATAGAGGAAGGGTGG + Intronic
1133711714 16:8408084-8408106 ATGGAGGAATAAAGGAAGGAAGG - Intergenic
1133903567 16:10000089-10000111 AGGGAAGAAAGGAGGCAGGAGGG - Intronic
1133964070 16:10518828-10518850 AGGGAGGAAGAGAGGTAGGAAGG - Intergenic
1133964084 16:10518880-10518902 AGGGATGAAGAGAGGAAGGAAGG - Intergenic
1134093494 16:11403956-11403978 AGGGATGAGGCGAGGCAGGAGGG - Intronic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134288001 16:12879208-12879230 AAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1134632283 16:15765457-15765479 ATGGATGGACAGATGATGGATGG + Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135939525 16:26809449-26809471 AAGGATGAAAAGGGGGAGGAAGG + Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136037856 16:27554056-27554078 ATGGAAGAAGGGAGGGAGGAAGG + Intronic
1136071410 16:27789795-27789817 ATGGATGGACAGATGATGGATGG + Exonic
1137495049 16:48963052-48963074 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1137740115 16:50761459-50761481 AGAGATGAGCAGAGGCTGGAGGG - Intronic
1137782283 16:51107786-51107808 AAGGATCAAGAGAGGCAGGTTGG + Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1137942859 16:52705802-52705824 ATGGATGAACAAAAGAAGGTAGG + Intergenic
1138189819 16:55005368-55005390 AGGGATGAATAGAGGCAGCATGG - Intergenic
1138194090 16:55039967-55039989 ATGGCTGGACAGAGGCAAGAGGG - Intergenic
1138498401 16:57423075-57423097 AGGGATGGAGAGAGGAAGGAAGG + Intergenic
1138784981 16:59835707-59835729 TTTGATGAATAGAGACAGGAAGG - Intergenic
1138795247 16:59960037-59960059 ATGGATGAATAAAGGATGGATGG + Intergenic
1138795252 16:59960076-59960098 ATGGATGAATAAAGGATGGATGG + Intergenic
1138832594 16:60393236-60393258 AGGAATAAACAAAGGCAGGATGG - Intergenic
1139016265 16:62692475-62692497 AGGGAGGGACAGAGGCAGGGAGG + Intergenic
1139380866 16:66529823-66529845 ATGGATGGGCAGAGGATGGATGG - Intronic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139674541 16:68514340-68514362 ATGGATGAAAATGGGCAGGCCGG - Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140638544 16:76944963-76944985 AGGGAAGAAGAGAGGAAGGAAGG + Intergenic
1140833060 16:78769308-78769330 AAGGATGGAGGGAGGCAGGATGG - Intronic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141042919 16:80687578-80687600 ATGGATGGACAGATGTGGGATGG + Intronic
1141279250 16:82615799-82615821 ACAGATGAAGAGAGGCAGTATGG + Intergenic
1141314305 16:82946212-82946234 ATGGATGAATGGAGGGAGGGAGG + Intronic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141355156 16:83338678-83338700 AAGGATGAATAGCGGCAGCAAGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141642278 16:85348281-85348303 ATGGATGAACAGTGGATGGATGG - Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142960575 17:3550024-3550046 ATGGATGAATAGATGACGGATGG + Intronic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1143766312 17:9139821-9139843 ATGGATGAACAGATGATGGAAGG - Intronic
1143888920 17:10087521-10087543 ATGAATGAAGAAAGGAAGGAAGG + Intronic
1144161128 17:12559304-12559326 AGGGAGGAAGAGAGGAAGGAAGG - Intergenic
1144348913 17:14375555-14375577 ATGGAGGGAGAGAGGAAGGAAGG - Intergenic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1145262466 17:21362816-21362838 GTGGATGAACAGAGGATGAATGG + Intergenic
1145398909 17:22515741-22515763 GGGGATGACCAGAGGCAGGGAGG + Intergenic
1145819932 17:27824433-27824455 ATGGATGAAGTGATGGAGGAGGG - Intronic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146807749 17:35878788-35878810 ATGGATAAACAGTGGCAGAGTGG + Intronic
1146820894 17:35982977-35982999 AGGGATGAAGGGAGGGAGGAAGG - Intergenic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1147282153 17:39370842-39370864 ATGGGTGAAAAGAGGTAGAAGGG - Intronic
1147610202 17:41797531-41797553 ATGAATGAAGGGAGGCAGGGGGG - Intergenic
1148099144 17:45077031-45077053 TAGGAAGAACAAAGGCAGGAAGG + Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149584603 17:57777270-57777292 ATGGTGGAACAGAGGCAAAAAGG - Intergenic
1150466857 17:65400942-65400964 AGGGAGGAAGGGAGGCAGGAAGG - Intergenic
1150466861 17:65400954-65400976 ACAGATGAAGAGAGGGAGGAAGG - Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150803046 17:68296681-68296703 ATGGATGAGCAGAGGCCGCTTGG - Intronic
1151050927 17:70978288-70978310 AGGGTTGAAGAGAGGAAGGAAGG + Intergenic
1151192447 17:72408317-72408339 ATGGAAGAACAGTAGCAAGAGGG + Intergenic
1151279933 17:73065882-73065904 AGGGAGGCTCAGAGGCAGGACGG + Intronic
1151447430 17:74176428-74176450 AAGGAGGATGAGAGGCAGGAAGG + Intergenic
1151484093 17:74387715-74387737 ATAGAGGAACTGAGGCAGGAGGG - Intergenic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152314583 17:79572653-79572675 ATTTATTAACAAAGGCAGGAGGG + Intergenic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1152473806 17:80504454-80504476 ATGGATGCACAGAGGGAAAAAGG + Intergenic
1153134107 18:1893983-1894005 ATGAATGAAAAGAAGCAGGGCGG - Intergenic
1153971995 18:10235504-10235526 ATGGAAGTGGAGAGGCAGGAGGG - Intergenic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155535124 18:26809075-26809097 ATGTATGCACAGAGGCTGAAGGG + Intergenic
1155937482 18:31768662-31768684 ATTGATGAAGAAAGGAAGGAAGG - Intergenic
1156448283 18:37252845-37252867 ATGGAGGAACATGGGCAGGGAGG + Intronic
1156632884 18:38991527-38991549 AAGGAGGAAGAGAGGGAGGAGGG + Intergenic
1156635188 18:39019554-39019576 AAGGATCAAGAAAGGCAGGAAGG - Intergenic
1157177584 18:45465557-45465579 ATGGATGAAGGGAGGGAGGGAGG - Intronic
1157220418 18:45825297-45825319 AGGGAGGAAGAGAGGAAGGAAGG + Intergenic
1157469570 18:47978862-47978884 ATGGATTTACTGAGGAAGGAGGG + Intergenic
1157500874 18:48189829-48189851 ATGGCTGGAAAGGGGCAGGAGGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158016311 18:52788731-52788753 TTGGAGGAACAGGGCCAGGAAGG + Intronic
1158219851 18:55139448-55139470 AGGGAGGAAGAGAGGAAGGAAGG - Intergenic
1158429288 18:57369716-57369738 ATGGATGAACAGGTGCACCATGG + Intronic
1158475001 18:57772292-57772314 AGGGATGGAGAGAGACAGGAGGG + Intronic
1158689834 18:59650375-59650397 ATGGAGGAACCTAGGGAGGAAGG - Intronic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1158887669 18:61844168-61844190 AGGGAGGAAGAGAGGAAGGAAGG + Intronic
1159029229 18:63213986-63214008 AGGGATGAACAGAGCTAAGATGG + Intronic
1159418812 18:68188125-68188147 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
1160093062 18:75845291-75845313 ATAGATGGAAAGAGGAAGGAGGG + Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161219410 19:3111358-3111380 ACCGATCCACAGAGGCAGGAAGG - Intronic
1161460605 19:4394719-4394741 ATTGATCAACAGAGGCCGGGAGG - Intronic
1161489390 19:4553609-4553631 ATGGATGGATAGATGAAGGATGG + Intronic
1161638088 19:5401862-5401884 AAGGAGGAAGAGAGGCAGGGAGG + Intergenic
1162085529 19:8246738-8246760 ATGGATGGGCAGAGGCAGATGGG + Intronic
1162203314 19:9036997-9037019 ATGGATGAATAGAAGATGGATGG + Intergenic
1162500740 19:11052113-11052135 ATAGATGATCATAGACAGGAGGG + Intronic
1162658879 19:12154138-12154160 ATGCCTGAACAGAGCCAGGAAGG + Intronic
1162858886 19:13490754-13490776 AAGGAAGAAGAGAGGAAGGAAGG + Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163203752 19:15787433-15787455 AGGGAAGAAGAGAGGAAGGAAGG + Intergenic
1163214794 19:15868476-15868498 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1163238372 19:16043190-16043212 ATGGATGAATGGATGCAGGGAGG + Intergenic
1163238405 19:16043317-16043339 ATGGATGAATGGAGGGAGGGAGG + Intergenic
1163402897 19:17105036-17105058 AGGGATGAACAGGGGGAGCATGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163596143 19:18222070-18222092 ATAGAGGAACAAAGGAAGGAGGG + Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1163814058 19:19453024-19453046 AGGGATGCCCAGTGGCAGGAAGG - Intronic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1165308656 19:35017696-35017718 AAGGAGGAACTGAGGAAGGAAGG - Intronic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166393965 19:42425290-42425312 ATGAATGAACACTGGCAAGAGGG + Intronic
1166816664 19:45550482-45550504 ATGGCTGAGCAGAGGCTGGGAGG - Intronic
1166877717 19:45907788-45907810 ACGGAGGAACAGAGCCAGTAGGG + Intergenic
1167110631 19:47458561-47458583 AGAGATGAACAGAGACAAGAGGG - Intronic
1167153932 19:47726603-47726625 AGAGAGGAACAGAGGAAGGAAGG - Intronic
1167191893 19:47996199-47996221 ATGGATGAACAGTGAAAGAATGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1167277613 19:48548336-48548358 GTGGATGAATAGAGGATGGATGG + Intergenic
1167520560 19:49952039-49952061 ATGGCTTAGCAGAGGCTGGAAGG + Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167909353 19:52689566-52689588 CTGGATGTACAGAGACATGAAGG - Intronic
1168482986 19:56737076-56737098 TTGGATGCTCAGAGGCAGGATGG + Intergenic
1168485696 19:56760169-56760191 TTGGATGCTCAGAGACAGGATGG + Intergenic
1202698182 1_KI270712v1_random:140997-141019 ATGGATGAACATAGGAAGAAAGG + Intergenic
925235021 2:2270468-2270490 ATGGATGAAGAGGGACAGAAGGG + Intronic
925394695 2:3524868-3524890 AGGGAGGAAGAGAGACAGGAGGG - Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926913619 2:17873530-17873552 ATGGATGAACAAAGACAACAGGG - Intergenic
927103267 2:19804204-19804226 ATGGATGATTAAAGGAAGGAGGG + Intergenic
927431713 2:23031826-23031848 ATGGATGGAAGGAGGGAGGAAGG - Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
927573723 2:24182863-24182885 ATGGCTGAACTGAGGGAGGGAGG - Intronic
928058091 2:28078893-28078915 ATGGAAGGACAGAGGAAGGGAGG - Intronic
928312319 2:30221144-30221166 CTGGAAGAACAGAGTCAAGAGGG - Intergenic
928960279 2:36918020-36918042 ATCAATGAACTGAGGCAGAAGGG + Intronic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
931663403 2:64591270-64591292 ATGCACGTACACAGGCAGGACGG - Intronic
931884372 2:66599745-66599767 AAGGAAGAAGAGAGGAAGGAAGG - Intergenic
931939996 2:67241521-67241543 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
932317330 2:70793987-70794009 ATGGAAGAACACAGGTATGAAGG - Intergenic
932476273 2:72008298-72008320 CTGGATGAACACAGGCGAGAGGG + Intergenic
932486822 2:72089226-72089248 AGAGATGAAGAGAGGGAGGAAGG + Intergenic
933403266 2:81825886-81825908 AGGGAAGAAGAGAGGGAGGAAGG - Intergenic
933831919 2:86218174-86218196 ATGGCTGGGCAGTGGCAGGAGGG - Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
934279437 2:91598780-91598802 ATGGATGAACACAGGAAGAAAGG + Intergenic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
935261576 2:101360215-101360237 ATGTAGGAAGAGAGGCAGGTAGG - Intronic
935322721 2:101904756-101904778 TTGGATGCAAAGAGGCAGGAGGG - Intergenic
935634302 2:105238024-105238046 ATGGAGGGAGGGAGGCAGGAAGG + Intergenic
935787145 2:106559572-106559594 ACGGATGAACGAAGGGAGGAAGG - Intergenic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
936233579 2:110724974-110724996 AGGGAGGAAGAGAGGAAGGAAGG + Intergenic
936369928 2:111895326-111895348 ATGGTAGACTAGAGGCAGGAGGG + Intergenic
936930133 2:117779568-117779590 ATGAATGAACTGAAGCAAGAAGG + Intergenic
937088690 2:119190223-119190245 AGGGATGGGCAGAGGCAGGCTGG + Intergenic
937159764 2:119749049-119749071 AGGGATGAACAGGTGCAGCACGG - Intergenic
937214789 2:120305438-120305460 ATGGATGAACAAAGCCAGCGAGG + Intergenic
937555734 2:123152815-123152837 ATGGATGAAGGAAGGAAGGAAGG - Intergenic
938514898 2:131993450-131993472 ATGGATAAAGGGAGGCAGGAGGG + Intergenic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
940473893 2:154135194-154135216 AAGGATGAAGGTAGGCAGGAAGG - Intronic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
940716390 2:157229792-157229814 ATTTATGAACAGAGAAAGGAAGG + Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
942022494 2:171880712-171880734 ATGGATGACTAGAGGGAGAAAGG - Intronic
942134838 2:172914548-172914570 ATGGAGGAAGAGAGGGAGGGAGG + Intronic
942371729 2:175293090-175293112 ATGGATCATCCGAGGGAGGAAGG + Intergenic
942384175 2:175423925-175423947 ATGGATGTGCAGAGGCAGGGTGG + Intergenic
942422325 2:175820929-175820951 TGGGATGAACAGAGGAGGGAGGG - Intergenic
942812233 2:180013051-180013073 ATGGATGAACAGGGGGCTGAGGG - Intergenic
942875931 2:180797534-180797556 AGGGGTGGAGAGAGGCAGGAGGG + Intergenic
943009962 2:182435346-182435368 ATGGCTGAACAGGGGTTGGAAGG + Intronic
943340173 2:186671300-186671322 ATGCAAGCAGAGAGGCAGGAAGG - Intronic
943533626 2:189119252-189119274 GAGGATGAAGAGAGGAAGGAGGG + Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944015153 2:195026952-195026974 GTGGATGGATTGAGGCAGGAAGG + Intergenic
945940223 2:215941894-215941916 ATGGAAGAACAGAGGCCCAATGG - Intergenic
946178475 2:217936321-217936343 ATGGATGAACTGCAGCAGGCAGG - Intronic
946202160 2:218076707-218076729 AGGGATGCACAGAGGAGGGAGGG - Intronic
947029932 2:225782570-225782592 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947077710 2:226363900-226363922 AGGGAGGAACGGAGGGAGGAAGG + Intergenic
1168894948 20:1317971-1317993 ATGGATAAACAGAGCCGAGAGGG - Intronic
1168955083 20:1828973-1828995 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1169547514 20:6665695-6665717 AGGGAGGAAGAGAGGCAGGAAGG - Intergenic
1169707592 20:8523168-8523190 GTGGATGAATAAAGGCAGCAGGG - Intronic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170485174 20:16808182-16808204 ATCCAAGAACAGAAGCAGGATGG - Intergenic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170662755 20:18358890-18358912 ACGGATGAGCAGAGAAAGGATGG + Intergenic
1170910443 20:20561399-20561421 ATGTATGAAAGGAGGCAGGAAGG - Intronic
1170940684 20:20845654-20845676 AAGGAGGAACAGAAGCAGAAAGG + Intergenic
1170947257 20:20902410-20902432 AAGGAGGAAGGGAGGCAGGAAGG - Intergenic
1171413690 20:24963340-24963362 ATGGAAGAGCAGAGGGAGCATGG - Exonic
1171536781 20:25899237-25899259 AGGGAAGACTAGAGGCAGGAAGG + Intergenic
1171816585 20:29790815-29790837 AGGGATGAAGAAAGGAAGGAAGG - Intergenic
1171839723 20:30194502-30194524 AGGGAAGACTAGAGGCAGGAAGG + Intergenic
1171901801 20:30865390-30865412 ATGAAGGAAGAGAGGAAGGAAGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172473111 20:35215594-35215616 ATGAATGAACAAAGGCACCAAGG + Intergenic
1172785977 20:37469278-37469300 AAGGAAGGAGAGAGGCAGGAAGG - Intergenic
1173096050 20:40029574-40029596 ATGGAAGAACAGAGAAAGGGAGG + Intergenic
1173201664 20:40959514-40959536 AGGGAGGAAGAGAGGAAGGAAGG + Intergenic
1173624460 20:44462084-44462106 AAGGCTGAAGACAGGCAGGAGGG + Exonic
1173653306 20:44681515-44681537 ATGTGTGAACAAATGCAGGATGG + Intergenic
1173946494 20:46955040-46955062 ATGGGTGAGCAGAGGAAGGCAGG + Intronic
1173968319 20:47130736-47130758 ATGGAAGAACAGAGATGGGATGG + Intronic
1174038592 20:47683325-47683347 AGGGGTGACAAGAGGCAGGAAGG - Intronic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1174125630 20:48303057-48303079 ATGGATGAAGAAAGGATGGATGG - Intergenic
1174160417 20:48546536-48546558 ACAGATGAACAGAGCCAGGCTGG + Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174454346 20:50638814-50638836 AAGGATGAGGACAGGCAGGAGGG + Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175059618 20:56230333-56230355 ATAGATAAAGAGAGGAAGGAAGG + Intergenic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175743175 20:61435208-61435230 AAGGATGGACAGAGACAGCATGG - Intronic
1175749482 20:61485408-61485430 TTGGATCCACAGAGGAAGGAGGG - Intronic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175798956 20:61790121-61790143 ATGGGTGGACAGAGGATGGATGG - Intronic
1175884781 20:62283525-62283547 ATTGATGAAAAAAGGCAGGCGGG + Intronic
1175984022 20:62755320-62755342 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1175984136 20:62755659-62755681 ATGGATGGAGGGAGGGAGGATGG - Intronic
1175984188 20:62755810-62755832 ATGGATGGAGGGAGGGAGGATGG - Intronic
1176130046 20:63492942-63492964 ATGGATGGACAGAGGATGGATGG + Intronic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1176582283 21:8543052-8543074 AGGGAAGACTAGAGGCAGGAAGG - Intergenic
1176778885 21:13169465-13169487 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1177302367 21:19264801-19264823 ATGGATAAACTGTGGCAGAATGG - Intergenic
1177976530 21:27858616-27858638 ATGGATAAAGGGAGGCAGGAGGG - Intergenic
1178061535 21:28858530-28858552 ATAGATGAAAACAGGAAGGAGGG + Intergenic
1178155354 21:29847229-29847251 ATGGCAGGAGAGAGGCAGGAAGG - Intronic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178661444 21:34510691-34510713 ACAGCTGAACACAGGCAGGAGGG + Intergenic
1179192639 21:39136585-39136607 GTGGATGAGAAGTGGCAGGAAGG - Intergenic
1179271453 21:39854207-39854229 ATGGATAAATAGCTGCAGGAAGG - Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1179715331 21:43283631-43283653 ATGGATGAATAGATGATGGATGG - Intergenic
1179715348 21:43283755-43283777 ATGGATGAATAGATGATGGATGG - Intergenic
1179715408 21:43284296-43284318 ATGGATGAATAGATGATGGATGG - Intergenic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180265118 22:10520100-10520122 AGGGAAGACTAGAGGCAGGAAGG - Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181446465 22:22979061-22979083 TTGGAGGAACAGTGCCAGGAAGG - Intergenic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1181803545 22:25361962-25361984 AAGGATGCACAGAGCCAAGAAGG + Exonic
1181897147 22:26120396-26120418 AGGGATGAAGAGAGGGAGGGAGG + Intergenic
1182544383 22:31065989-31066011 AGGCCTGAACACAGGCAGGAAGG - Intronic
1182962417 22:34488213-34488235 AGGGAGGAACAGAGGAAGAAAGG - Intergenic
1183106491 22:35618796-35618818 ATGGATGAATGGAGGGATGATGG - Intronic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183303969 22:37072163-37072185 ATGGATGAACGGATGATGGATGG + Intronic
1183415159 22:37677424-37677446 ATGAATGACCAGACGCAGGAAGG - Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1183794801 22:40107789-40107811 ATGGATAAACAGAGAAAGGGGGG - Intronic
1183946998 22:41332245-41332267 ATGGATAAACTGAGACAGGTTGG - Intronic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184457645 22:44620721-44620743 ATGGATGAACAGGAGCAGAATGG + Intergenic
1184788485 22:46684169-46684191 AGCCATGGACAGAGGCAGGAAGG + Intergenic
1185018867 22:48361823-48361845 ATGGATGAATGCATGCAGGAAGG + Intergenic
1185019353 22:48365288-48365310 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1185178091 22:49342080-49342102 ATGGAAGAACAAAGCCAGAATGG + Intergenic
1185196791 22:49476767-49476789 ATGGATGAATGGATGCTGGATGG + Intronic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
949986490 3:9545253-9545275 AGGGAGGAACAGAGGAAAGAGGG + Intronic
950165155 3:10791727-10791749 ACAGATGGACAAAGGCAGGAAGG + Intergenic
950526851 3:13529284-13529306 AGAGATGAATAGAGGAAGGAAGG - Intergenic
950579720 3:13854199-13854221 AAGGAGGGAGAGAGGCAGGAAGG + Intronic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951962886 3:28348823-28348845 AGGGACGAGCCGAGGCAGGAGGG + Exonic
952014056 3:28936146-28936168 AGGGAGGAAAAGAGGAAGGAAGG - Intergenic
953227586 3:41034589-41034611 ATGGAGGAAGAAAGGAAGGAAGG + Intergenic
953412737 3:42699383-42699405 AAGGAAGTACCGAGGCAGGAGGG + Intronic
954581910 3:51707517-51707539 ACGGAAGCTCAGAGGCAGGAAGG - Intronic
954718200 3:52537580-52537602 ATGGATGAACAGAAGGACTAAGG - Intronic
954759369 3:52862873-52862895 ATGGAGGAATAGAGACAGAAGGG + Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955098728 3:55826020-55826042 AAGGAGGAAGAGAGGAAGGAAGG + Intronic
955385355 3:58474920-58474942 ATGGATGAAGGAATGCAGGAAGG - Intergenic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
955962764 3:64357897-64357919 AGGGAAGAACAGAGGAAGGAAGG - Intronic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
959564988 3:107825088-107825110 GGGGATGAACTGTGGCAGGATGG + Intergenic
960633339 3:119755509-119755531 ATGGAGGAAGAGAGGGAGAAAGG - Intronic
961153738 3:124661569-124661591 ATTGATGAACAAAAACAGGAAGG + Intronic
961550713 3:127669245-127669267 TTTGAGGAACAGAGACAGGAGGG - Intronic
961554099 3:127685782-127685804 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
962693622 3:137926318-137926340 TTAGATGAAGAGAGGAAGGAAGG - Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964225016 3:154388636-154388658 AGGCAGGAACAGAGGCAGGCAGG + Intronic
964374927 3:156040830-156040852 AGGGAGGGAGAGAGGCAGGAAGG - Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965039051 3:163482723-163482745 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
965547117 3:169927262-169927284 AAAGATAAAAAGAGGCAGGATGG - Intronic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
966071494 3:175884722-175884744 ATGGATGAATTGAGGGAGGTAGG - Intergenic
966126655 3:176585226-176585248 TTGGATGAGGACAGGCAGGAAGG - Intergenic
966630135 3:182063506-182063528 AAGAAGGAACAGAGGAAGGAGGG + Intergenic
969031317 4:4217138-4217160 ATGGATGAACACAGGAAGAAAGG - Intronic
969183277 4:5457906-5457928 ATGGAGGGAGAGAGGAAGGAAGG + Intronic
969240860 4:5896388-5896410 AGGGACCAACAGAGGCAGCAGGG + Intergenic
969388349 4:6871988-6872010 TTGCCTGCACAGAGGCAGGAGGG + Intronic
969423196 4:7109004-7109026 AGGGATGGACAGAGGCAGATTGG - Intergenic
969481408 4:7448863-7448885 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481466 4:7449024-7449046 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481535 4:7449202-7449224 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969528208 4:7714907-7714929 AAGGATGGACAGAGACAGGTAGG - Intronic
970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG + Intergenic
972628302 4:40821820-40821842 AGAGATGAGCAGAGGCGGGAGGG + Intronic
972785889 4:42326599-42326621 AAGGAAGGACAGAGGAAGGAAGG + Intergenic
973953753 4:56042479-56042501 ATGGAAGAAGAAAGGAAGGAAGG - Intergenic
973968920 4:56191396-56191418 AGGGAGGAACAGAGGGAGGGAGG - Intronic
974467237 4:62272924-62272946 ATGGATGAGAAGTGGGAGGAAGG - Intergenic
974475561 4:62374768-62374790 ATGGAAGGACAGAGGAAGAAAGG - Intergenic
974947246 4:68542983-68543005 GTGGATCTACAGAGGCAGGCAGG - Intronic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
975787974 4:77913961-77913983 GTGGGTGAAGAGGGGCAGGAAGG + Intronic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976027227 4:80703788-80703810 ATAGAAGAGCAAAGGCAGGATGG - Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976486153 4:85607369-85607391 AGGGAGGAACGGAGGGAGGAAGG + Intronic
976697027 4:87927716-87927738 ATGGAGGAAGGGAGGAAGGAAGG - Intergenic
976810241 4:89092400-89092422 AGGGAGGGACAGAGGAAGGAAGG + Intronic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
977064691 4:92299849-92299871 AGAGATGAAGAGAGGAAGGAAGG + Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
977899423 4:102402275-102402297 ATGGATGAAGAAAGGAAGGAAGG + Intronic
977960415 4:103078650-103078672 ATAAATGAACAAAGGTAGGAAGG - Intronic
978071628 4:104479778-104479800 ACGGAGGAACAGAGGGAGGGAGG - Intronic
978577238 4:110199248-110199270 ATTAATGAACAGAGGCAGAGTGG + Intergenic
978818973 4:112943340-112943362 AGGGATGGAGAGAGGCAGGGAGG - Intronic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
979887467 4:126047001-126047023 ATGCATGAAAAGAAACAGGAAGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980013029 4:127617609-127617631 AGGGAAGAATAGAGGAAGGAAGG + Intergenic
980166423 4:129233610-129233632 ATGGGTAGACAGAGGCAGGTGGG + Intergenic
981676636 4:147350366-147350388 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
983432444 4:167668781-167668803 AGGAAGGATCAGAGGCAGGATGG + Intergenic
984154069 4:176172802-176172824 AGGGATGAAGAGAGAGAGGAAGG + Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984947722 4:184983064-184983086 ATGGAGGAAGACAGGGAGGAGGG - Intergenic
985541259 5:488738-488760 TTGGGTGAACGGAGGCAGGTGGG + Intronic
985666412 5:1183664-1183686 AGGGCTGGGCAGAGGCAGGAAGG + Intergenic
985703779 5:1389056-1389078 ATGGATGGACAGAAGAAGGGAGG - Intergenic
985786762 5:1899630-1899652 ACTGATGAAAAGAGACAGGAAGG + Intergenic
986015235 5:3751789-3751811 ATAGAGGAAGAGAGGAAGGAAGG + Intergenic
986210461 5:5666893-5666915 ATGTAAGAAGAGAGGCAGGTAGG + Intergenic
987171980 5:15268832-15268854 ATGTTTGACCAGAAGCAGGAGGG + Intergenic
987255160 5:16143119-16143141 ATGAAGGAACAGAGAAAGGAGGG - Intronic
988463598 5:31465759-31465781 AGGGAGGAAGAGAGGGAGGAGGG - Intronic
988495681 5:31743682-31743704 ATGGATGAACTGAAGGATGAAGG - Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
989960655 5:50410671-50410693 ATTGAGGAATAGAAGCAGGAAGG + Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
991172306 5:63642628-63642650 AGGGAGGAACAGAGGGAGGGAGG - Intergenic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
991646783 5:68808276-68808298 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
991646788 5:68808300-68808322 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
992489127 5:77223969-77223991 ATGGATGAACAAAGGGAAGATGG - Intronic
992538515 5:77738058-77738080 TTGGATGAGCAGAGGCATGAAGG + Intronic
993979895 5:94532470-94532492 ATGGAGGAAGGGAGGAAGGAAGG - Intronic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994538367 5:101060487-101060509 ATGAATGAAATGAAGCAGGAAGG - Intergenic
995008358 5:107229214-107229236 ATGCAGGGACAGAGACAGGAGGG - Intergenic
995409252 5:111836065-111836087 ATGAATGAACGAAGGGAGGAAGG - Intronic
995743851 5:115383151-115383173 ATGGCAGGCCAGAGGCAGGAAGG + Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997569388 5:134914541-134914563 ATGGAGGAACAGAGGGACAAGGG + Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998466891 5:142353793-142353815 ATGGCTGGGCAGAGGCATGAGGG - Intergenic
998498633 5:142613007-142613029 ATAGAAGAAGACAGGCAGGAAGG - Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
998733847 5:145112128-145112150 AGGTATGAAAAGAGGCTGGAGGG + Intergenic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
999247175 5:150161341-150161363 ATGGACGAAAGGGGGCAGGAGGG + Intergenic
999829247 5:155303428-155303450 ATGGAGGAACTGAGACTGGAGGG - Intergenic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001923244 5:175617190-175617212 CTGGATGCACAGAGCCAGAAAGG + Intergenic
1002067620 5:176660057-176660079 ATGGATGAAGAGTGGGTGGATGG - Intergenic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002506203 5:179680843-179680865 ATAGGTGGACAGAGGCTGGATGG + Intronic
1003140293 6:3465747-3465769 ATGAACGAACAAAGGAAGGATGG + Intergenic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1004751416 6:18565937-18565959 ATGGAAGAAGGGAGGAAGGAAGG - Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1004842867 6:19606680-19606702 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
1005101750 6:22179584-22179606 ATGAATGAACTGAAGCAAGAAGG - Intergenic
1005822016 6:29606341-29606363 AGGGATGCACAAAGGCAGGAGGG - Intronic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1006395447 6:33784079-33784101 AAGGAAGAACAGCTGCAGGAAGG + Intronic
1006557877 6:34884430-34884452 AAGGATGAAGGGTGGCAGGAGGG + Intronic
1008784617 6:55152032-55152054 ATGGAACAACAGAGCCTGGATGG - Intronic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009671177 6:66753099-66753121 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1010724518 6:79318104-79318126 ATGGAGCAACAGAGCCTGGATGG - Intergenic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1014103867 6:117541510-117541532 AAGGAGGAACAGAGGTAGGAGGG + Intronic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1015458056 6:133451710-133451732 GTGGATGAACAGTGGAGGGAGGG + Intronic
1015731968 6:136358171-136358193 AAGAATGAACAAAGGCAAGAGGG - Intronic
1016317682 6:142808410-142808432 ATGGGTGGACAGAGGCAAGGAGG + Intronic
1016845988 6:148569089-148569111 ATGGAAGCAGGGAGGCAGGAGGG + Intergenic
1016925761 6:149346104-149346126 ATAGATGAAGAGAGGGAGGAAGG + Intronic
1016931627 6:149416563-149416585 ATGGAACAACAGAGCCTGGATGG + Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017041049 6:150308967-150308989 AGGGAGGAAAAGAGGAAGGAAGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017212716 6:151875165-151875187 ATAGATGAAGAGGGCCAGGAAGG - Intronic
1017577130 6:155817553-155817575 ATGCATGCAGTGAGGCAGGAGGG - Intergenic
1017615995 6:156246988-156247010 ATGGATGGTCTGAGACAGGAAGG + Intergenic
1017705367 6:157117856-157117878 TGGGAAGAACAGAGGCAGGGGGG - Intronic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1018689617 6:166334145-166334167 ATGAGTGTACAGAGGCTGGAAGG - Intronic
1019000651 6:168747341-168747363 ATGGAAGAACACAGGCCTGAAGG - Intergenic
1019095375 6:169575285-169575307 ATGGATGGAGAGAGGGAGGGAGG - Intronic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019345588 7:528663-528685 ATGGATGGACAGACACATGATGG + Intergenic
1019435777 7:1021425-1021447 ATGGATGAAGACAGGAAGGCTGG - Intronic
1019467111 7:1196035-1196057 ATGGATGAAGAGGGGCGGGTGGG + Intergenic
1019704665 7:2491773-2491795 ATGGATGGACAGAGGACTGATGG - Intergenic
1019704730 7:2492072-2492094 ATGGATGGACAGAGGATTGATGG - Intergenic
1020618061 7:10484622-10484644 AAGGATGACCACAGGTAGGAGGG - Intergenic
1021128605 7:16883334-16883356 ATGGAGGAAGAGAGGAAGGGAGG - Intergenic
1021256035 7:18393529-18393551 ATGGATGAGGTGAGGCAGGGAGG + Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021493752 7:21249198-21249220 AGGAGTGAACAGGGGCAGGAGGG + Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1021893996 7:25216154-25216176 ATGGAGGAACGGAGCCAGCAGGG - Intergenic
1021930504 7:25576819-25576841 GAGGAAGAAGAGAGGCAGGAAGG + Intergenic
1022309855 7:29186597-29186619 AGGAAGGAAGAGAGGCAGGAAGG + Intronic
1022337322 7:29433916-29433938 AGGGAGGGAGAGAGGCAGGAAGG + Intronic
1023127175 7:36965925-36965947 AAATATGAACACAGGCAGGATGG - Intronic
1023498575 7:40824377-40824399 AGGCAAGAACAGAGGGAGGAGGG + Intronic
1023519527 7:41036566-41036588 AGGGATGAACAGAGAAAAGAGGG - Intergenic
1024250282 7:47501163-47501185 AGGGAGGAAGAGAGGAAGGAAGG + Intronic
1025288249 7:57685944-57685966 AGGGAAGACTAGAGGCAGGAAGG + Intergenic
1026207222 7:68268395-68268417 ATGAATGAGCTGAGGCATGAAGG - Intergenic
1026231166 7:68485349-68485371 AGGGAAGAAGAGAGGAAGGAAGG + Intergenic
1026895136 7:74006025-74006047 AGGGAGGAAGAGAGGAAGGAAGG + Intergenic
1026956575 7:74380060-74380082 ATGTATGAACAGAAGTATGAGGG + Intronic
1027353651 7:77336381-77336403 ATTGAGGAACAGACCCAGGATGG - Intronic
1028970970 7:96858586-96858608 ATGGATGAACATGGGCAGTGAGG + Intergenic
1029607870 7:101609800-101609822 ATGGAGGAAGGGAGGCAGGGAGG - Intergenic
1029931921 7:104381512-104381534 ATGGAAGAAAGGAGGAAGGAAGG - Intronic
1030085749 7:105813995-105814017 ATGGAGGAAGAGAGGAAGAAAGG - Intronic
1030166769 7:106563010-106563032 AGGGAGGAAAAGAGGAAGGAAGG + Intergenic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1030835565 7:114279841-114279863 AAGGAAGATCAGAGGCAGGAGGG + Intronic
1031871257 7:127091727-127091749 AGGGATGACCAGTGGGAGGAGGG - Intronic
1031922589 7:127612755-127612777 ATGGATGAATGGAGGATGGATGG + Intronic
1031995197 7:128226196-128226218 ATGGATGAACATAGACAGATGGG - Intergenic
1032152262 7:129439375-129439397 ATGTATGAACATATACAGGAAGG + Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032403021 7:131637021-131637043 ATGGGAGAAAAGAGGCAGAAGGG + Intergenic
1032416448 7:131738763-131738785 AGGGATGACCAGAGGAAGAAGGG + Intergenic
1032685757 7:134231875-134231897 AGGGAGGAAGAGAGGAAGGAAGG - Intronic
1033385244 7:140867660-140867682 ATACATGAACAGAGATAGGAAGG + Intronic
1033530521 7:142258233-142258255 ATGGATAAACAGTGACATGAAGG - Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033778512 7:144641572-144641594 ATGAATGAGGAGAGGCAGGCAGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034369118 7:150579202-150579224 ATGAATGAAATGAAGCAGGAAGG - Intergenic
1034794297 7:153999052-153999074 ATAGCTGAACAGGGGCATGATGG - Intronic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034995143 7:155572200-155572222 AGGGAGGAAGAGAGGAAGGAGGG + Intergenic
1035279133 7:157766243-157766265 ATGGATGGATGGAGGAAGGATGG - Intronic
1035279180 7:157766473-157766495 ATGGATGGATGGAGGAAGGATGG - Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035992803 8:4510886-4510908 AGGGAGGAAGAGAGGAAGGAAGG - Intronic
1036154139 8:6326106-6326128 AGGGAGGAAGAGAGGAAGGAAGG + Intergenic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1037269978 8:17115878-17115900 ATGAATGAACCAAGGCAGGCGGG - Intronic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038285587 8:26203806-26203828 AGGGAAGAAAAGAGGAAGGAAGG + Intergenic
1038730760 8:30125528-30125550 TTGGATGAATAGAGGCAGATTGG + Intronic
1039259691 8:35757788-35757810 ATGGAAGAAAAGAGGCACTATGG - Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039544615 8:38400349-38400371 AAGGAGGAACAGAGCCAAGATGG + Exonic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1041155775 8:54985368-54985390 ATGGAGGGAGAGAGGAAGGAAGG + Intergenic
1041326082 8:56666111-56666133 AGGGAGGAAGACAGGCAGGAAGG - Intergenic
1041387273 8:57318001-57318023 AAGGGAGAAGAGAGGCAGGAAGG - Intergenic
1041866565 8:62581728-62581750 ATGGATGGAGGGAGGGAGGAAGG - Intronic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1041982104 8:63873767-63873789 ATGGACGAACAGAAGAAAGAAGG + Intergenic
1042958811 8:74280543-74280565 AAGGAAGAAGGGAGGCAGGAAGG + Intronic
1043212284 8:77537269-77537291 ATGGAAGAAAAGTGGAAGGAAGG + Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044744866 8:95362225-95362247 AGGGGTGAACAAAGGCATGAAGG + Intergenic
1045245949 8:100441872-100441894 AGGGAGGAAGAGAGGAAGGAAGG - Intergenic
1045755330 8:105534410-105534432 AAGGAGGAAGAGAGGAAGGAAGG - Intronic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046389401 8:113549350-113549372 AGGAAGGAAGAGAGGCAGGAAGG - Intergenic
1046476104 8:114745897-114745919 ATAGAAAAACAGAGGAAGGAAGG + Intergenic
1046483248 8:114851144-114851166 AAGGATGAAAGGAGGAAGGAAGG + Intergenic
1046494743 8:114998883-114998905 AGGGAGGAAGAGAGGAAGGAAGG - Intergenic
1046561435 8:115842744-115842766 AGGAAGGAACAGAGGAAGGAAGG + Intergenic
1046644435 8:116769370-116769392 ATGGGTGAAGAAGGGCAGGAAGG + Intronic
1047306935 8:123659973-123659995 ATGGATGAATAGATGATGGATGG - Intergenic
1047930751 8:129726369-129726391 ATGGAAGAGGGGAGGCAGGAGGG + Intergenic
1048407136 8:134135310-134135332 TTGGAGGAAGAAAGGCAGGAGGG - Intergenic
1048478073 8:134760979-134761001 ATGGATGAGCAGACACCGGAAGG + Intergenic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1048759224 8:137773313-137773335 AAAGATGAACACAGCCAGGAAGG + Intergenic
1049350580 8:142162386-142162408 ATGGATGGACAGAGGATAGATGG + Intergenic
1049350597 8:142162469-142162491 ATGGATGGACAGAGGATGGATGG + Intergenic
1049350636 8:142162657-142162679 ATGGATGGGCAGAGGATGGATGG + Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049364269 8:142229156-142229178 ATGGATGAATGGAGGGTGGATGG + Intronic
1049464643 8:142745194-142745216 ATGGATGAATGGGGGCAAGATGG + Intergenic
1049466411 8:142752964-142752986 ACAGATGACCTGAGGCAGGAGGG - Intergenic
1049474786 8:142791815-142791837 ATGGATGGATGGAGGCTGGATGG - Intergenic
1049475936 8:142797012-142797034 ATGGATGGAGGGAGGGAGGAAGG + Intergenic
1049833131 8:144714586-144714608 ATGGATGAACAGATACAGAATGG - Intergenic
1049874398 8:145006743-145006765 ATGGAAGGGCAGAGGCAGAAGGG + Intergenic
1050074094 9:1845916-1845938 ATGGCTGTTCACAGGCAGGAAGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051683123 9:19628386-19628408 ATGGAGAAAGAGAGGCAAGAAGG + Intronic
1051756337 9:20404931-20404953 ATGGAGGATCTGAGGAAGGAAGG - Intronic
1052193080 9:25680062-25680084 AGGGATGAAGAGAGGGAGAAAGG + Intergenic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1052968447 9:34361154-34361176 AGGGAAGAAAAGAGGCAGGAGGG + Intergenic
1055606767 9:77978427-77978449 AGGCAGGAAAAGAGGCAGGAGGG - Intronic
1055914524 9:81387313-81387335 AGGGATGGACAGAGAGAGGAAGG + Intergenic
1056032449 9:82567222-82567244 AGGGATGAAGGGAGGGAGGAGGG + Intergenic
1056106623 9:83353449-83353471 ATGGATGACAAGATGCATGAGGG + Intronic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1056724728 9:89104730-89104752 ATAGATAAACTGAGGAAGGATGG - Intronic
1058053638 9:100428914-100428936 AAGAAGGAAGAGAGGCAGGAAGG + Intronic
1058352627 9:104043966-104043988 ATGGGAAAAGAGAGGCAGGAGGG + Intergenic
1058388029 9:104461470-104461492 AGGAAGGAAGAGAGGCAGGAAGG + Intergenic
1058390070 9:104486296-104486318 CTGGAAGAACTGAGGCATGAAGG + Intergenic
1059279946 9:113124397-113124419 TTGGATGCACAGAGGCAGTGGGG + Intergenic
1059450918 9:114371002-114371024 ATGGAGGAACAGGGGCTGGGGGG + Intronic
1059613573 9:115924694-115924716 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059613578 9:115924710-115924732 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059669665 9:116480103-116480125 ATGGGTGAAGAAAGGAAGGAAGG + Intronic
1059700992 9:116775496-116775518 AGGGAGGAAAAGAGGAAGGAAGG + Intronic
1059835352 9:118146178-118146200 ATGGATGGAGAGAGGAAGGGAGG - Intergenic
1059862563 9:118481220-118481242 GTGGAAGAAGAGAGGAAGGAAGG + Intergenic
1060072111 9:120559071-120559093 ATGGAGGAACTGAGGCATGTAGG - Intronic
1060907908 9:127324431-127324453 ATGGAGGCACGGAGGCTGGAGGG - Intronic
1061244930 9:129396683-129396705 ATGGATGAAAAGATGAAGGGTGG + Intergenic
1061417487 9:130454972-130454994 ATGGATGAATGGACGGAGGATGG - Intronic
1061868663 9:133508359-133508381 ATGGATGAAGAAAGTAAGGAAGG - Intergenic
1062016308 9:134292964-134292986 ATGAATGAACGAAGGAAGGAAGG + Intergenic
1062024705 9:134334957-134334979 ATGGCAGAGCAGAGGCAGTAGGG + Intronic
1062671840 9:137715518-137715540 CAGGAAGAACAGAGCCAGGAAGG + Intronic
1203612301 Un_KI270749v1:21066-21088 AGGGAAGATTAGAGGCAGGAAGG - Intergenic
1185535149 X:855191-855213 AGGGAGGGACAGAGGAAGGAAGG - Intergenic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1185636733 X:1557611-1557633 ATGGATGAATAGAAGATGGATGG - Intergenic
1185638903 X:1575471-1575493 ATGAATGAACAGATGATGGATGG + Intergenic
1185683861 X:1910922-1910944 AGAGAGGAAGAGAGGCAGGAAGG - Intergenic
1185683888 X:1911093-1911115 AGAGAGGAAGAGAGGCAGGAAGG - Intergenic
1185683928 X:1911350-1911372 AGAGAGGAAGAGAGGCAGGAAGG - Intergenic
1185683942 X:1911475-1911497 AGGGAGGAAGAGAGACAGGAAGG - Intergenic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186019147 X:5234883-5234905 AGGGAGGAAGAGAGGAAGGAAGG - Intergenic
1186107134 X:6219604-6219626 ATGGAGGAACGAAGGGAGGAAGG - Intronic
1186133844 X:6497771-6497793 ATGGAGGAAGAGGGGCAGGTAGG - Intergenic
1186156597 X:6732621-6732643 AGGGAGGAAGAGAGGAAGGAGGG + Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1187575210 X:20546573-20546595 ATGGATGTAAGGTGGCAGGAAGG + Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1187944464 X:24412693-24412715 GTGGATGACAGGAGGCAGGAGGG - Intergenic
1187948737 X:24451592-24451614 ATGAATGAACGAGGGCAGGATGG - Intergenic
1188439893 X:30205883-30205905 TTGGATGAAGAAAAGCAGGAAGG + Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1189865920 X:45326942-45326964 TTGGAAGAACAGTGGCAGGGTGG + Intergenic
1190300590 X:49054774-49054796 ATGGAGGTCAAGAGGCAGGATGG - Intronic
1192017196 X:67344015-67344037 ATGCATGAACAGAGGCATGGAGG - Intergenic
1192592429 X:72371432-72371454 TTGGATGGGCAGAGCCAGGAAGG + Intronic
1193092909 X:77513362-77513384 ATGGATGACTAGATGCAGCAAGG + Intronic
1193988618 X:88277461-88277483 ATGGTTGAATGGAGACAGGATGG + Intergenic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1195349515 X:103983508-103983530 ATGGTTGACCACAGGCGGGAGGG + Intergenic
1195357928 X:104055331-104055353 ATGGTTGACCACAGGCGGGAGGG - Intergenic
1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG + Intergenic
1196036149 X:111147443-111147465 ATGGATGAGCAGAGTCAATATGG + Intronic
1196109388 X:111929995-111930017 ATGTTTGAGCAGAGGCAGAATGG - Intronic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1197145463 X:123167345-123167367 ATGTATTAACTGAGACAGGAAGG - Intergenic
1198421400 X:136473184-136473206 AGGGAGGAAAAGAGGAAGGAAGG + Intergenic
1198440119 X:136654980-136655002 ATGTTTGATCAGAGGCTGGACGG - Intronic
1198518748 X:137431762-137431784 AAGGAAGAACAAAGGAAGGAAGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1200254892 X:154575394-154575416 ACCGAGGAAGAGAGGCAGGAAGG - Intergenic
1200262877 X:154629014-154629036 ACCGAGGAAGAGAGGCAGGAAGG + Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201617158 Y:15913406-15913428 ATGGAGGAAGAGGGGCAGGTAGG - Intergenic
1201696201 Y:16829142-16829164 ATTGAGGGACAGAGGAAGGAAGG + Intergenic