ID: 1180721755

View in Genome Browser
Species Human (GRCh38)
Location 22:17914571-17914593
Sequence GCAGGCAAGTTCCTGCTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180721755_1180721760 6 Left 1180721755 22:17914571-17914593 CCCGAGAGCAGGAACTTGCCTGC 0: 1
1: 0
2: 3
3: 26
4: 194
Right 1180721760 22:17914600-17914622 GATAGCTGCCCAGCTAGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180721755 Original CRISPR GCAGGCAAGTTCCTGCTCTC GGG (reversed) Intronic
900250393 1:1665764-1665786 GCTGGCAGCTTCCTGCTCTCAGG + Exonic
901014629 1:6221416-6221438 GCTGGGAAGTGCCTACTCTCTGG - Exonic
902704853 1:18197557-18197579 CCAGGCAAGTTTCTGCTGCCTGG - Intronic
903349147 1:22707673-22707695 CCAGACAAGGCCCTGCTCTCTGG - Intergenic
904171185 1:28592947-28592969 CCAGGGATGTTCCTGGTCTCTGG - Intronic
904360422 1:29967660-29967682 CCAGGCAAGTTCCTGCTGTCTGG - Intergenic
905789101 1:40781010-40781032 TCAAGCAAGCTGCTGCTCTCTGG + Intergenic
905859610 1:41341592-41341614 TAAGACAAGTCCCTGCTCTCAGG + Intergenic
911339708 1:96621659-96621681 GCATGGAACTTCCTGCTCCCAGG - Intergenic
915040867 1:152967383-152967405 ACAGGCACGCACCTGCTCTCAGG + Intergenic
917241853 1:172957005-172957027 GCAGGCAGTTTCCTGCCCTAAGG - Intergenic
918116938 1:181505934-181505956 GCAGGCAAGGTCCTGCCCTGGGG + Intronic
919757244 1:201073794-201073816 TCAGGCAAGTCCCTTCTCTGTGG + Intronic
920211784 1:204333724-204333746 GCAGCCCAGGTCCTGCTCTCTGG + Intronic
922742435 1:228021602-228021624 GCGTCCAAGTTCCTGCTCTCAGG + Intronic
922945472 1:229510147-229510169 CCAGGCAAGTTCTTGCTCAAAGG - Intergenic
923240892 1:232084475-232084497 GCAGGTGAGTTCCTGCTTTGTGG - Intergenic
924382105 1:243474619-243474641 GCACGCCAGCACCTGCTCTCGGG - Intronic
1063478951 10:6354271-6354293 GCAGCCTAGTTCTGGCTCTCTGG + Intergenic
1064867457 10:19897060-19897082 GCACGTAAGTTTCTGCCCTCAGG + Intronic
1069006302 10:63321122-63321144 GGATGAAAGTTCCTGTTCTCTGG + Intronic
1069636350 10:69927199-69927221 GCAGCCCAGTACCTGCTTTCTGG - Intronic
1072687769 10:97548969-97548991 GCAGGCCTTTTTCTGCTCTCTGG - Intronic
1074708552 10:116158013-116158035 GAAGGAAGGTTCCTGGTCTCTGG + Intronic
1075838224 10:125474591-125474613 GCAGGCCAGACCCTTCTCTCTGG + Intergenic
1076543297 10:131227918-131227940 TCAGGCATCTTCCTGCTCCCTGG + Intronic
1078363026 11:10684658-10684680 GCTGGCAAGTTCCTGCTGCTGGG + Intronic
1078387001 11:10901156-10901178 CCAGGCAAATCCCTTCTCTCTGG + Intergenic
1078450227 11:11435574-11435596 AAAGCAAAGTTCCTGCTCTCAGG - Intronic
1078883100 11:15472546-15472568 GCAGGCATGTGCCTGCCCTGAGG - Intergenic
1079348529 11:19673719-19673741 GCTTGCAACTTTCTGCTCTCGGG + Intronic
1080867209 11:36205900-36205922 GCCTGGAAGTTCCTGCTCCCTGG + Intronic
1084178994 11:67437342-67437364 GAATGCAAGTTCCCGCTCACAGG + Intronic
1084430996 11:69111147-69111169 GGATCCTAGTTCCTGCTCTCAGG + Intergenic
1084654077 11:70505233-70505255 GCATCCAAGGCCCTGCTCTCAGG - Intronic
1085386024 11:76158826-76158848 GCAGGGAAGATGCTGCTGTCGGG - Intergenic
1088016769 11:105070496-105070518 GCAGAAAACTTCCTTCTCTCTGG - Intronic
1088019318 11:105100405-105100427 GCAGAAAACTTCCTTCTCTCTGG - Intronic
1089606944 11:119646955-119646977 GCAGGCATGTCCCTGCCCTCAGG - Intronic
1089892348 11:121894134-121894156 ACAGGCAATTTCCTGCCCACAGG - Intergenic
1091678620 12:2510232-2510254 CCAGCCATGTTCCTGCTCTGGGG - Intronic
1095492535 12:42749507-42749529 GCAGGAAAGTTTGTGTTCTCTGG + Intergenic
1096688298 12:53303683-53303705 GCAAGCAGCTTCCTGCTCTTAGG + Intronic
1099719441 12:86342035-86342057 CCTGTCAAGTTCCTTCTCTCTGG + Intronic
1101891897 12:108724406-108724428 GCAGTTAAGTTCCTGATCTTGGG + Intronic
1102198427 12:111040894-111040916 GCAGGCAAACTACAGCTCTCAGG - Intronic
1103996858 12:124835780-124835802 GCAGGTAAATTCCTGCCTTCTGG + Intronic
1106436228 13:29725247-29725269 TATAGCAAGTTCCTGCTCTCAGG + Intergenic
1108061366 13:46536711-46536733 CCAGGCAAGATCCTGCTGTAGGG + Intergenic
1108576589 13:51796490-51796512 GCAAGCATGTTCCTGCACTGGGG - Intronic
1108985957 13:56587808-56587830 GCAAGCAAGTTCCTGCTTCAGGG - Intergenic
1111752170 13:92346380-92346402 GCTGGCAAGATTCTGCTGTCAGG - Intronic
1111913712 13:94339290-94339312 GCAGGCAAGTTGCTGAGCTCAGG - Intronic
1112615080 13:100996473-100996495 GCAGTCATGTTCCTGGCCTCTGG + Intergenic
1117097310 14:52312154-52312176 GCAGGAAATTTCATGATCTCAGG - Intergenic
1117986063 14:61387244-61387266 GCAGGCACATTCCTTCTCTCTGG - Intronic
1119160676 14:72449876-72449898 CCTGGCCATTTCCTGCTCTCTGG - Intronic
1119401962 14:74368838-74368860 TCAGACGAGTTCCTGTTCTCTGG - Intergenic
1121743365 14:96269189-96269211 ACAGGCAGGCTCTTGCTCTCCGG + Intergenic
1121780011 14:96616246-96616268 GCTTGCAAATTCCTGCTCTCCGG - Intergenic
1122807365 14:104266708-104266730 GCTGGGAAGGGCCTGCTCTCTGG + Intergenic
1123942387 15:25222859-25222881 GCAGGCAGGTCACTGGTCTCAGG - Intergenic
1125252294 15:37718855-37718877 GCAGACAAATACCTGCTCTGTGG - Intergenic
1127463856 15:59225190-59225212 CCATGCAGCTTCCTGCTCTCTGG + Intronic
1127656414 15:61060427-61060449 CATGGCAAGTGCCTGCTCTCAGG - Intronic
1128205537 15:65848519-65848541 GCAGGCAAGGCCCTCCTCTCTGG - Intronic
1129169599 15:73799540-73799562 GCAGGCAAGTCCCTCCTCCCTGG - Intergenic
1130374019 15:83312152-83312174 ACACGTAAGTTCCTGCCCTCAGG + Intergenic
1132271130 15:100526749-100526771 GCAGACAAGTCCCTGCCCTCAGG - Intronic
1133175331 16:4010173-4010195 GCAGCCCAGTTCATGCTCCCAGG - Intronic
1135802173 16:25507643-25507665 GCTGTCAAGATCCAGCTCTCTGG - Intergenic
1136059863 16:27718989-27719011 GCAGGCACGTTCCTGGTGACGGG + Intronic
1136583887 16:31171157-31171179 GCAGGCAAGGCCCTCCCCTCAGG - Intergenic
1137697611 16:50472440-50472462 GGACAGAAGTTCCTGCTCTCAGG + Intergenic
1139292286 16:65869888-65869910 GAAGCCAGGTTCCTGCTCTTGGG + Intergenic
1139588546 16:67919906-67919928 ACAGGGAAGTTGCTGCTTTCTGG - Intronic
1139639374 16:68279943-68279965 ACAAGCAAGTTCTTGCCCTCAGG - Intronic
1140616838 16:76675321-76675343 GCACAGAAGCTCCTGCTCTCAGG - Intergenic
1141238312 16:82241488-82241510 GCAGGCAGGTCCTTGCTTTCAGG + Intergenic
1142433764 16:90044426-90044448 GCAGGCCAGGTCCTGCTGGCCGG - Exonic
1142613725 17:1123478-1123500 GCTGGCAGGTGCCTTCTCTCGGG - Intronic
1144230549 17:13198940-13198962 GGACACAAGTTCCTGCACTCAGG - Intergenic
1145009446 17:19359376-19359398 CCAGGCAAGCTCCTGCTCCAGGG + Intronic
1147546774 17:41408055-41408077 GCAGGCCATGTCCTGCTCTGAGG - Intergenic
1147552492 17:41454003-41454025 GCAGGGATGTTCCTGGTCCCTGG + Intergenic
1147687369 17:42294678-42294700 ACAGGCATGTTCCTGCCCTGGGG - Intronic
1151731759 17:75915402-75915424 GCAGGGATGTTGCTGCTCTTTGG - Intronic
1151993253 17:77592020-77592042 GCAGGCAAGTTCCTGATGGGTGG + Intergenic
1152020638 17:77778630-77778652 ACAGGCCAGTTCCTGCTGTGGGG + Intergenic
1152552550 17:81036923-81036945 CCACGAAAGTTCCTGCTTTCTGG - Intronic
1153170399 18:2309932-2309954 GCTGGTAAGTTCCTGCCCTTGGG + Intergenic
1154452092 18:14486780-14486802 CCGACCAAGTTCCTGCTCTCTGG - Intergenic
1158405019 18:57153157-57153179 GCAGGCAGCCTCCTGCTCTCTGG + Intergenic
1159100196 18:63949577-63949599 GCAGCCAAGTCCCTGCCCTTAGG - Intronic
1159357281 18:67353021-67353043 TGAGACAAGTTCCTGCTCTCAGG + Intergenic
1159740103 18:72156895-72156917 GCAGATAAATTCCTGCTCTGTGG + Intergenic
1159792001 18:72793101-72793123 GCAGGCCAGGCCCTGTTCTCAGG - Intronic
1160439345 18:78877069-78877091 GCAGGCACGTCCCTGCTCGTGGG - Intergenic
1161286436 19:3470942-3470964 GCAGGCATGGTCCCGCCCTCGGG - Intergenic
1165304448 19:34995037-34995059 CCAGGCCAGTTTCTGCTCTGTGG - Intronic
1165479061 19:36051213-36051235 GCAGGCATGTTGCTGCCCTGGGG - Intronic
1166141052 19:40805510-40805532 GCAGGTGACTTCCTGGTCTCAGG - Intronic
1166553185 19:43680516-43680538 TCTGGCAAGATCCTGCTCTCTGG - Intergenic
1166984483 19:46651426-46651448 ACAGGCAAATCCCTGCCCTCAGG - Intronic
1168340041 19:55617467-55617489 ACAGGTAAGTGTCTGCTCTCAGG + Exonic
927651596 2:24916841-24916863 GAAGCAAAGCTCCTGCTCTCAGG + Intronic
932416850 2:71578755-71578777 GCAGGCAAGGCCCAGCTCGCTGG - Intronic
932567870 2:72920850-72920872 CCCGGAAAGTTCCTGATCTCGGG - Intronic
933473054 2:82751791-82751813 GCAGGCAAATACCTGGTCTGGGG + Intergenic
933612013 2:84446001-84446023 GCAGGCATGTGCCTGCTGTGTGG - Intronic
933675404 2:85051878-85051900 GCAGGGGAGATCCTGCTCTCTGG + Intronic
936058889 2:109281750-109281772 GCAGGCTTGCTCTTGCTCTCTGG - Intronic
936611387 2:114005261-114005283 GAAAGGAAGTTGCTGCTCTCAGG + Intergenic
938240280 2:129737998-129738020 GCATGCACGTTCCAGCCCTCAGG + Intergenic
944701779 2:202252391-202252413 CCAGGGAAGTTCCTTCTTTCTGG - Intergenic
945908043 2:215615991-215616013 TCAGCCAAGTTCCTTCTTTCTGG - Intergenic
947648920 2:231767856-231767878 CCAGACAAGTTCTTGCTCTGTGG + Intronic
947963010 2:234255562-234255584 GCATGCCAATTTCTGCTCTCTGG + Intergenic
948100642 2:235370103-235370125 GCAGGAAGGTCCCTGGTCTCTGG - Intergenic
948191394 2:236062070-236062092 GCAGCCAAATTCCTGCCCTGCGG + Intronic
948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG + Intronic
948764862 2:240214236-240214258 CCAGGCAGGCTCCTGCTCTCAGG - Intergenic
1171050143 20:21850310-21850332 GCAGGCAAGTCTCAGGTCTCAGG - Intergenic
1172283870 20:33727414-33727436 GCAGGCAATTGCCTGAGCTCAGG + Intergenic
1174049895 20:47760267-47760289 GTCGGCACGTCCCTGCTCTCTGG + Intronic
1174356915 20:50004845-50004867 ACAGACAAGTCCCTGTTCTCAGG + Intergenic
1174412781 20:50346703-50346725 TCTGGCAACTTCCTGCCCTCTGG - Intergenic
1175522449 20:59610729-59610751 ACAGGCAAGGCCCTGCCCTCAGG - Intronic
1175762228 20:61569051-61569073 GCAAGCCAGTTTGTGCTCTCTGG + Intronic
1177881338 21:26698588-26698610 GCAGGCTTCTTGCTGCTCTCTGG + Intergenic
1179300270 21:40102040-40102062 TAAGGCAAGTTCCTGCCCCCGGG + Intronic
1180721755 22:17914571-17914593 GCAGGCAAGTTCCTGCTCTCGGG - Intronic
1181340945 22:22179395-22179417 GCAGGCAATTTGCTCATCTCTGG + Intergenic
1183109960 22:35641718-35641740 GCAGGAAAGTTCCTCCACTGTGG - Intergenic
1183241045 22:36658683-36658705 GCAGGAATGTTCCTGCCCTCAGG + Intronic
1183711032 22:39503234-39503256 GCGGGCAAGTTACTTCCCTCTGG + Intronic
1184112294 22:42402423-42402445 GCAGCAAAGTTTCTGCTCTGCGG - Intronic
949634798 3:5970800-5970822 GCAGGCAGTGTCCTGCTCTTTGG - Intergenic
950653375 3:14421866-14421888 GCAGGCAGGTGCCTCCTCTCTGG + Intronic
952389975 3:32871740-32871762 GGAGGCAAGTTGCTGCTACCTGG + Intronic
952829971 3:37556487-37556509 GCTGGCACGTTCTTTCTCTCTGG + Intronic
954154817 3:48679531-48679553 GGAGGGAACTTCCTGCTATCTGG - Intronic
954746290 3:52789380-52789402 GCAGGCTAGGTCCTGTTCTCGGG + Intronic
960615471 3:119592045-119592067 TCAGGCAAGTGACTCCTCTCAGG + Intergenic
961437114 3:126926930-126926952 GCAGGAGGCTTCCTGCTCTCAGG + Intronic
963311663 3:143716549-143716571 TCAGGCAAGTTTCTCCTTTCAGG + Intronic
966574921 3:181489942-181489964 CCAGGCATGCTCCTGCTCTGGGG + Intergenic
968003739 3:195225317-195225339 GCAGGCAAGTTCCAGCACTCTGG - Intronic
968966168 4:3770064-3770086 TCAGACAAATCCCTGCTCTCTGG + Intergenic
972822722 4:42720724-42720746 ACAGGCAATTTTCTGTTCTCTGG + Intergenic
974326993 4:60426154-60426176 GGAAGCAAATTCCTGCTTTCAGG - Intergenic
976281033 4:83327101-83327123 TCAGTCAGGTCCCTGCTCTCAGG - Intronic
977445083 4:97121369-97121391 ACAGGCAAGATCCTGGTCTCAGG + Intergenic
978111336 4:104967367-104967389 GCAGACTAGTTCCTGGTCCCTGG + Intergenic
978681704 4:111388861-111388883 GAAGGGAAGTTCTTGCTCTGGGG - Intergenic
981410628 4:144426175-144426197 GCAGGCAATTGCCTGAGCTCAGG + Intergenic
982388543 4:154838884-154838906 GCAGGCCAGCTCCTGCACTCTGG + Intergenic
982593664 4:157349877-157349899 GCAGATAAGTTCCTTCTCTGTGG + Intronic
985013880 4:185613103-185613125 GCAGGCAAGTTGATGCTACCGGG + Intronic
985429214 4:189862176-189862198 GCAGGCATCTACCTGCTCACTGG + Intergenic
985776622 5:1847663-1847685 GCAGGCTTCTTTCTGCTCTCAGG - Intergenic
986432561 5:7695785-7695807 GCTGGCAAGTGACTGCTCCCCGG + Exonic
992169024 5:74084076-74084098 GCAGCCAAGGTCCTGATCTCTGG + Intergenic
993953092 5:94199755-94199777 GCAGGCAAGTGCATGCTGGCGGG + Intronic
994570847 5:101511857-101511879 ACAGGCATGTGCCTGCTCTCAGG - Intergenic
996793774 5:127321785-127321807 ACAGGCAAGGTCCCTCTCTCGGG - Intronic
997783050 5:136679108-136679130 GCAGTTAAATTCCTGCTCTTTGG - Intergenic
997796531 5:136816564-136816586 TCAGGCATGTGCCTTCTCTCAGG + Intergenic
998587300 5:143440365-143440387 TCAGGCAAGTTCCATCTTTCTGG + Intergenic
999609054 5:153349882-153349904 TCAGGCAATTTTCTGTTCTCGGG + Intergenic
999673288 5:153975875-153975897 GCAGCCAAGTTCCTCAGCTCTGG + Intergenic
999702222 5:154238627-154238649 GAAGGCAAGTCCCTGCTCTCTGG + Intronic
999802476 5:155050815-155050837 GCAGGCAGATTCCTACCCTCAGG - Intergenic
999890320 5:155971593-155971615 GCAGGCAGGTTTGTGGTCTCTGG - Intronic
1002719819 5:181251600-181251622 GCAGCAAGGTTCCTGCTATCAGG - Intergenic
1003314148 6:4996755-4996777 GCAGATAAGCTCCTTCTCTCTGG - Intronic
1005187351 6:23177787-23177809 GCTGGCAAGTTCCAGATCTAGGG - Intergenic
1005633230 6:27728644-27728666 GCAGGATAGTTCCTTCTCTTAGG - Intergenic
1007405728 6:41635162-41635184 ACAAGCCAGTCCCTGCTCTCAGG + Intergenic
1011017523 6:82773602-82773624 AAAGGCAAGTTCCTACTATCTGG - Intergenic
1012766544 6:103374182-103374204 TCAGGCAAATTCCTGACCTCTGG + Intergenic
1014004611 6:116403881-116403903 ACAGGCATGGTCCCGCTCTCAGG - Intronic
1015560144 6:134505668-134505690 GCAGGAAAGATCCTGCCTTCAGG - Intergenic
1016824014 6:148371729-148371751 GCAGGGAACCTCCTGCACTCAGG + Intronic
1019277420 7:183151-183173 GGAGGGAAAATCCTGCTCTCAGG - Intergenic
1021804456 7:24341371-24341393 ACAGCCATGTTCCTTCTCTCTGG + Intergenic
1022375538 7:29807511-29807533 GCAGGCAGGCACCGGCTCTCAGG + Intronic
1027193302 7:76010634-76010656 GTGGGAAAGTGCCTGCTCTCTGG - Intronic
1027316732 7:76990366-76990388 GCAGGTAGGTGCCTGCCCTCGGG + Intergenic
1029858322 7:103541262-103541284 GCAGGCAAGCTGCTGCTTTCTGG + Intronic
1031036021 7:116788792-116788814 GCAGGCAAGTTTTTGGTCGCAGG - Intronic
1034943336 7:155246176-155246198 GCAGGCAGTTTCCTGATTTCAGG + Intergenic
1036163165 8:6407128-6407150 GCAGGCAGAGTCCTGCCCTCCGG + Intronic
1037768657 8:21786672-21786694 GGGGGCAAGTCCCTGCTCTAGGG - Intronic
1037778031 8:21848612-21848634 AGGGGCATGTTCCTGCTCTCAGG - Intergenic
1038039091 8:23709266-23709288 GCAGGCGAGTGCCTGGTCTACGG + Intergenic
1038401718 8:27288992-27289014 GCAGGCAGGTTCCTGTACCCTGG - Intronic
1039198713 8:35061905-35061927 GGAGCCAAGTTCCTGGGCTCTGG - Intergenic
1041030730 8:53733254-53733276 GCAGACAATTTCTGGCTCTCAGG - Intronic
1042679625 8:71368407-71368429 GCAGGGAAGATCCTCCTCTCAGG - Intergenic
1044913081 8:97082556-97082578 TCAGGGAAGTTCTTGCTCTTGGG - Intronic
1045569017 8:103350741-103350763 GCAGGCAACTGCCTTCTCCCTGG + Intergenic
1049615501 8:143574107-143574129 ACCAGCAAGTTCCTGATCTCAGG - Intergenic
1049798226 8:144506077-144506099 GGAGGCAAGCTCCTGCTGCCCGG - Exonic
1050670966 9:7996722-7996744 GCAGGCAAGATGCTGCCATCTGG - Intergenic
1051731311 9:20146167-20146189 TCAGGCAAGTCCCAGTTCTCTGG - Intergenic
1052834517 9:33240592-33240614 GCAGGTAGGTCCCAGCTCTCAGG + Intronic
1053208253 9:36206194-36206216 GTGGGGAAGTTCCTTCTCTCTGG - Intronic
1056920799 9:90787147-90787169 ACAGGCAAGCTCCTGGTGTCAGG - Intergenic
1058687275 9:107489734-107489756 GCAGACACGTTCGTTCTCTCTGG + Intronic
1059958913 9:119546207-119546229 GCAGAAAAGTTCCTACTTTCAGG + Intergenic
1062004856 9:134233994-134234016 GCAGGGCAGCCCCTGCTCTCAGG - Intergenic
1062507270 9:136884328-136884350 GCAGGCAATTGCCTGAGCTCAGG + Intronic
1186461022 X:9748728-9748750 CCAGGCCAGCTCCTGCGCTCTGG + Intronic
1188365783 X:29313193-29313215 AAAGGCCTGTTCCTGCTCTCAGG - Intronic
1190112893 X:47606379-47606401 GCATGCCAGATGCTGCTCTCAGG - Intronic
1190366087 X:49695935-49695957 GCAGTCGCGTTCCTGCTGTCCGG - Exonic
1194730455 X:97447351-97447373 GCAGGGAAGTTCCAGCTTTAAGG + Intronic
1196342799 X:114615538-114615560 GCAGGTAAGTTTCTACTCTCAGG + Intronic
1196475956 X:116086462-116086484 GCAGAAAAGTTCTTGCTCACTGG + Intergenic
1196767437 X:119260349-119260371 GCAGGCAAATACCTACTCACGGG - Intergenic
1199675555 X:150186360-150186382 ACATGCAAGTACCTGCTCTGAGG + Intergenic
1200152702 X:153959059-153959081 GCTGGCTAGATCCTCCTCTCAGG + Intronic
1200259009 X:154602202-154602224 GTAGGCAAGAACCTGCTTTCTGG - Intergenic