ID: 1180722656

View in Genome Browser
Species Human (GRCh38)
Location 22:17920859-17920881
Sequence GGAATCTCGGGGCTTCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180722656_1180722663 3 Left 1180722656 22:17920859-17920881 CCTGGTGGAAGCCCCGAGATTCC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1180722663 22:17920885-17920907 TGTGAAAGGAAAATAAATCTTGG 0: 302
1: 396
2: 294
3: 242
4: 774
1180722656_1180722665 5 Left 1180722656 22:17920859-17920881 CCTGGTGGAAGCCCCGAGATTCC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1180722665 22:17920887-17920909 TGAAAGGAAAATAAATCTTGGGG 0: 171
1: 222
2: 148
3: 136
4: 949
1180722656_1180722667 28 Left 1180722656 22:17920859-17920881 CCTGGTGGAAGCCCCGAGATTCC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1180722667 22:17920910-17920932 CCCCAAACTCACTAAGCCAAAGG 0: 26
1: 217
2: 470
3: 625
4: 640
1180722656_1180722664 4 Left 1180722656 22:17920859-17920881 CCTGGTGGAAGCCCCGAGATTCC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1180722664 22:17920886-17920908 GTGAAAGGAAAATAAATCTTGGG 0: 272
1: 450
2: 384
3: 371
4: 859
1180722656_1180722669 29 Left 1180722656 22:17920859-17920881 CCTGGTGGAAGCCCCGAGATTCC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1180722669 22:17920911-17920933 CCCAAACTCACTAAGCCAAAGGG 0: 32
1: 190
2: 473
3: 698
4: 725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180722656 Original CRISPR GGAATCTCGGGGCTTCCACC AGG (reversed) Intronic
915727963 1:158032236-158032258 GGATTCTCATGGCTTCCACAGGG + Intronic
915930037 1:160054707-160054729 GGAATCTCGGGGCCTAGGCCAGG - Intronic
916735076 1:167600407-167600429 GGACTCTCGGGGCTGCAACCTGG + Intergenic
919869062 1:201806824-201806846 TGCATCTTGGGGTTTCCACCAGG - Intronic
920011900 1:202874027-202874049 GGAATCTTGTGGCATCCACCAGG + Intergenic
1063029148 10:2214499-2214521 GGAGCCTCAGGGCTTCCACAGGG - Intergenic
1073073533 10:100809424-100809446 GGCATCTGTGGGCTTCAACCTGG + Intronic
1076944800 10:133638310-133638332 CGAATCTCCGGGCTCCCACGGGG + Intergenic
1077023756 11:430823-430845 GGTATCTGGGGGCTTCCGCGGGG + Intronic
1077023853 11:431063-431085 GGTATCTGGGGGCTTCCGCGGGG + Intronic
1077023886 11:431143-431165 GGTATCTGGGGGCTTCCGCGGGG + Intronic
1077023901 11:431183-431205 GGTATCTGGGGGCTTCCGCAGGG + Intronic
1077023935 11:431263-431285 GGTATCTGGGGGCTTCCGCGGGG + Intronic
1077024029 11:431504-431526 GGTATCTGGGGGCTTCCGCGGGG + Intronic
1077024062 11:431584-431606 GGTATCTGGGGGCTTCCGCGGGG + Intronic
1080267200 11:30413947-30413969 GGAATCTCAGGGCTTTAACGAGG - Intronic
1081770922 11:45650248-45650270 TTAATCGCGGGTCTTCCACCAGG + Exonic
1082938049 11:58674894-58674916 GGAATCACCGGGTTACCACCCGG - Intronic
1089557270 11:119321298-119321320 GGCGTCTCGGGGCTGCCTCCTGG + Intronic
1091769143 12:3140074-3140096 GGTATCTCAGGGCAGCCACCAGG + Intronic
1098066523 12:66623594-66623616 GGAAACTTGGGGCTTCCAGGAGG - Intronic
1102024104 12:109703700-109703722 GGAATCTCCGGCCTGGCACCTGG + Intergenic
1106095188 13:26637255-26637277 GGACTCTCTGGGCTTGCACTTGG - Intronic
1107032334 13:35866071-35866093 GGCAACTCGGGGCTGGCACCGGG - Intronic
1120782579 14:88499031-88499053 GGAAACTTGAGGCTTCTACCTGG - Intronic
1122129533 14:99597097-99597119 GGAAGCTGAGGGCTTCCATCGGG - Intronic
1133016334 16:2943308-2943330 GGACTCTGGGGGCTTGTACCTGG + Intronic
1137000219 16:35222443-35222465 TGAATCTCTGGGCTCCCACAAGG + Intergenic
1137522372 16:49205402-49205424 GGCCTCTCTGGGCTTCCACGTGG + Intergenic
1140876766 16:79159942-79159964 TGAATCCCGGTGCTTTCACCTGG - Intronic
1142228785 16:88889743-88889765 GGAATCGCGGGGCGTCGTCCAGG - Intronic
1142228804 16:88889822-88889844 GGAATCGCGGGGCATCGTCCAGG - Intronic
1142228816 16:88889870-88889892 GGAATCGCGGGGCGTCGTCCAGG - Intronic
1142228853 16:88890012-88890034 GGAATCGCGGGGCATCGTCCAGG - Intronic
1142228866 16:88890061-88890083 GGAATCGCGGGGCATCGTCCAGG - Intronic
1151662439 17:75525860-75525882 GCCCCCTCGGGGCTTCCACCTGG + Intronic
1152753688 17:82078143-82078165 GGAAGCCCGGGGCTGCCACGCGG + Intergenic
1155588747 18:27400208-27400230 GCAGGCTAGGGGCTTCCACCTGG + Intergenic
1161013007 19:1969158-1969180 GGATCCTCAGGGCTTCTACCCGG + Intronic
1166985961 19:46660268-46660290 GGAATCTCAGGGCCTCCAGAGGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
925565210 2:5244952-5244974 GGTAGCTCTGTGCTTCCACCTGG - Intergenic
932447928 2:71791978-71792000 AGAATCTCTGGGCTGTCACCAGG - Intergenic
934924969 2:98375841-98375863 GGAATCTCGGCTGTACCACCTGG + Intronic
937535289 2:122879056-122879078 GAAATCTCCAGGCTTCCAACTGG - Intergenic
938040301 2:128070219-128070241 GCAATTTCAGGGCTTCCACTTGG - Intergenic
938776452 2:134545464-134545486 GGAAGCTGGGGGCAGCCACCAGG - Intronic
948526174 2:238572085-238572107 GGAGTCTCTGGGCTCCCTCCTGG + Intergenic
1171014171 20:21524581-21524603 GTAATCTCAGCGCTTCCACTTGG - Intergenic
1172614766 20:36275764-36275786 GGAATCTCCCAGCCTCCACCTGG - Intergenic
1176014873 20:62925987-62926009 GGGACCTCGGCGCTTCCTCCCGG - Intronic
1179292551 21:40031275-40031297 GGAATCTGGGAGCTTCCTTCTGG - Intronic
1180722656 22:17920859-17920881 GGAATCTCGGGGCTTCCACCAGG - Intronic
1181609786 22:24004671-24004693 GGACTCCCTGGGCTCCCACCAGG - Intergenic
1183295103 22:37024734-37024756 GGAATCCCGGCGCTTCCAGGTGG + Exonic
1184534389 22:45076815-45076837 GGAATTTAGGGGATTCCAGCCGG - Intergenic
955104694 3:55885896-55885918 GGAATCCTGTTGCTTCCACCTGG - Intronic
961369862 3:126422701-126422723 GGACTCTCAGGGCTGCCTCCAGG - Intronic
970398515 4:15695659-15695681 GGACTCTCTGGGCCTCCAGCCGG + Intronic
984310853 4:178056211-178056233 GGACTTCTGGGGCTTCCACCAGG - Intergenic
985448185 4:190038819-190038841 CGAATCTCCGGGCTCCCACGGGG + Intergenic
985527325 5:413412-413434 GGACTATCTGGGCTTCCATCAGG + Exonic
986457094 5:7930625-7930647 GGAAGCTCAGGAATTCCACCTGG + Intergenic
997326566 5:133026584-133026606 GGAAGGGCGGGGCTTCCAACCGG + Exonic
1002081457 5:176739978-176740000 GGAAGCTCGGGCCTCCCACGCGG - Intergenic
1006450906 6:34105264-34105286 GGGCTCTGGGGGCTTCCACTGGG + Intronic
1007510998 6:42374292-42374314 GGGCTCTCTGGGCTTCCAGCTGG + Intronic
1008342396 6:50383277-50383299 GAAGTCTTGGGTCTTCCACCAGG + Intergenic
1017021293 6:150142689-150142711 CGCCTCTCGGGGCCTCCACCTGG - Intergenic
1027385777 7:77658618-77658640 GAAATCTCGAGGATTCCACTGGG + Intergenic
1037953409 8:23034384-23034406 CAAATCTGGTGGCTTCCACCTGG - Intronic
1038136678 8:24793509-24793531 GGACTCTCGGGCCTCACACCAGG - Intergenic
1038754409 8:30327357-30327379 GGTATCTTGTGGTTTCCACCAGG - Intergenic
1052345705 9:27407614-27407636 GGAAGTCCTGGGCTTCCACCAGG + Intronic
1053131336 9:35617415-35617437 GGACTCTCTCGGCTTCCTCCTGG + Intronic
1057192763 9:93096526-93096548 GGTGTCCCGGGGCTTCTACCCGG + Intronic
1057880260 9:98787848-98787870 CGAACCTCGGGTCTTCCAGCAGG - Intronic
1057880657 9:98790494-98790516 GGCTTCTCGGGGCGGCCACCTGG - Exonic
1061238940 9:129358085-129358107 GGAAGCTTGGTGCTCCCACCTGG - Intergenic
1061675282 9:132212153-132212175 GGCCTCTCTGGGCTACCACCTGG + Intronic
1062122645 9:134841952-134841974 GGACTCTTGGGACATCCACCGGG + Intronic
1062495546 9:136829930-136829952 GGACTCTGGGGGCTTGCGCCTGG - Intronic
1186432015 X:9513079-9513101 AGACTCTGGGGGCTTCCTCCGGG - Intronic