ID: 1180726059

View in Genome Browser
Species Human (GRCh38)
Location 22:17947316-17947338
Sequence CCCAGTTACCTCTTCATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180726059_1180726064 3 Left 1180726059 22:17947316-17947338 CCCTTCATGAAGAGGTAACTGGG 0: 1
1: 0
2: 3
3: 23
4: 144
Right 1180726064 22:17947342-17947364 AGGAAATCCCTTAAGGAAAGAGG 0: 1
1: 0
2: 6
3: 165
4: 459
1180726059_1180726063 -4 Left 1180726059 22:17947316-17947338 CCCTTCATGAAGAGGTAACTGGG 0: 1
1: 0
2: 3
3: 23
4: 144
Right 1180726063 22:17947335-17947357 TGGGACAAGGAAATCCCTTAAGG No data
1180726059_1180726067 15 Left 1180726059 22:17947316-17947338 CCCTTCATGAAGAGGTAACTGGG 0: 1
1: 0
2: 3
3: 23
4: 144
Right 1180726067 22:17947354-17947376 AAGGAAAGAGGAAAAGACCTCGG 0: 1
1: 0
2: 9
3: 84
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180726059 Original CRISPR CCCAGTTACCTCTTCATGAA GGG (reversed) Intronic
900977467 1:6026432-6026454 CCCAGGTACCTGCTCCTGAACGG - Intronic
905108202 1:35576517-35576539 CCCAGTTCCCTATTCATGCTTGG + Intronic
906558645 1:46736326-46736348 GCCTGTTACCTCTTCCTGAAAGG + Intergenic
910061216 1:83094963-83094985 CTCAGTTTCTTCTTTATGAAAGG + Intergenic
911662191 1:100513691-100513713 CCCAGTTACCTAATCATGGCAGG - Intronic
915382494 1:155454357-155454379 CCCACTTACCTCTTCAGTCATGG + Intronic
917067290 1:171110711-171110733 CCCAGATCCCTCTTGAGGAATGG - Intronic
920616978 1:207503195-207503217 CTCAGTTTCATCTTCATAAAGGG - Intronic
923509226 1:234635148-234635170 GTCAGTTACGTCTTCATGGAAGG - Intergenic
924150804 1:241127160-241127182 CTCAGTTACCTCCTCAGGTAAGG - Intronic
1063548236 10:7002621-7002643 CCCAGATCCCTCTTCAAGGAGGG + Intergenic
1065148191 10:22794335-22794357 CCCAATTATCCCATCATGAATGG + Intergenic
1066641309 10:37556999-37557021 CCCAGTTACCTCCTTACCAACGG + Intergenic
1068112215 10:52692993-52693015 CCCAGTTAGATTTTAATGAATGG - Intergenic
1068606523 10:59011213-59011235 CCCATTCTCCTCTTCATGATAGG - Intergenic
1069305313 10:66962173-66962195 CCCCATTTCCTCATCATGAAAGG + Intronic
1069909068 10:71748880-71748902 CCCAGTTCCATCTTCATCCATGG - Exonic
1074239614 10:111624293-111624315 CTCAGTTCAGTCTTCATGAATGG + Intergenic
1074909726 10:117896928-117896950 CCCACTCAACTCTTCATGACTGG - Intergenic
1075508366 10:123047338-123047360 CCCAGCTTCCTGTTAATGAAGGG + Intronic
1076485822 10:130816358-130816380 TCCAGCACCCTCTTCATGAAAGG + Intergenic
1077476428 11:2792521-2792543 CCCTGCAACCTCTTCTTGAAAGG - Intronic
1078370690 11:10742218-10742240 CCCAGTTCCTTCCTCATGCAGGG - Intergenic
1089272723 11:117313293-117313315 CCCACTTTCCTCTTCTAGAAAGG + Intronic
1090886266 11:130879615-130879637 CCCACTTACCTGTTGATGAGGGG + Exonic
1091342554 11:134828517-134828539 CACATTTACCTCTTCAGGACTGG + Intergenic
1095468859 12:42515571-42515593 CCCATGTACCTTTTCATGGAAGG + Intronic
1100445596 12:94656916-94656938 CCCAGTGACGTCTCCATAAAAGG + Intergenic
1101176244 12:102154833-102154855 CTCAGTTATCTCTTCAGGACTGG - Intronic
1101328875 12:103741203-103741225 CTCTGTTACCTCATCAGGAAAGG + Intronic
1102676653 12:114664080-114664102 CCCAATAATCTCTCCATGAAGGG + Intergenic
1102910352 12:116708884-116708906 CCCAGTTCCCTCTTCTGCAAGGG + Intergenic
1105032671 12:132895060-132895082 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032681 12:132895140-132895162 CGCAGTTACCTCATGATGAAAGG + Intronic
1105032689 12:132895221-132895243 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032700 12:132895302-132895324 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032711 12:132895383-132895405 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032721 12:132895464-132895486 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032731 12:132895544-132895566 CGCAGTTACCTCATGATGAAAGG + Intronic
1105032739 12:132895625-132895647 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032748 12:132895706-132895728 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032760 12:132895787-132895809 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032770 12:132895867-132895889 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032786 12:132896029-132896051 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032795 12:132896110-132896132 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032807 12:132896191-132896213 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032817 12:132896271-132896293 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032823 12:132896352-132896374 CGCAGTTACCTCATCATGAAAGG + Intronic
1105032830 12:132896433-132896455 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032837 12:132896513-132896535 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032848 12:132896594-132896616 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032857 12:132896675-132896697 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032867 12:132896756-132896778 CGCAGTTACCCCATCATGAAAGG + Intronic
1105032876 12:132896836-132896858 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032885 12:132896916-132896938 TGCAGTTACCCCATCATGAAAGG + Intronic
1109365493 13:61350792-61350814 CTCAATTACCTCTACCTGAATGG - Intergenic
1111327050 13:86712224-86712246 CCAATTTAACTCTTCATGAATGG + Intergenic
1112125604 13:96464103-96464125 CTGAGTTACCTCCTCAGGAAAGG + Intronic
1115055211 14:29117382-29117404 CCCAGTAACCTTATCAGGAAAGG + Intergenic
1118639643 14:67780390-67780412 CCCAGTGACTTGTTCATGGAGGG - Intronic
1119755158 14:77112481-77112503 CTCAGTTCCCTGTTTATGAAGGG + Intronic
1124987988 15:34641485-34641507 CCAAATTACCTTTTCATGACAGG + Intergenic
1127847197 15:62881149-62881171 GCCAGTAACCTCTTCCTAAAGGG - Intergenic
1128662415 15:69512100-69512122 CCCTGTCTTCTCTTCATGAAAGG + Intergenic
1129077430 15:73009029-73009051 TCCAGTTTCCTCTTCGTGTATGG - Intergenic
1137502780 16:49024275-49024297 CCCAGTTTCCTCTTCTTACATGG + Intergenic
1137916019 16:52431055-52431077 CCCTGATAGCACTTCATGAAGGG - Intergenic
1140272092 16:73474975-73474997 CCCAGTGACCTCATCATACAGGG - Intergenic
1140285383 16:73598018-73598040 CCCAAATATCTCTTCATGAGGGG + Intergenic
1145099609 17:20063587-20063609 CCCACCTTCCTCTACATGAACGG - Intronic
1146282635 17:31554894-31554916 CCATGTTACCCCTTCAAGAAAGG - Intergenic
1148053846 17:44781962-44781984 CCCTGTTTCCTCACCATGAATGG - Intergenic
1149060616 17:52417161-52417183 ACCACTTACCTCTTCACTAATGG + Intergenic
1153112141 18:1604341-1604363 CCCAATTATCTCTTACTGAAAGG - Intergenic
1156049119 18:32910460-32910482 CTCTGTTTCCTCTACATGAAGGG - Intergenic
1157567064 18:48686459-48686481 CCCTGGTACCTTTTAATGAATGG + Intronic
1158906947 18:62022256-62022278 CCAAGTTACCTCTCCTTGACAGG - Intergenic
1159165921 18:64699958-64699980 ACCAGCTACCTATTCTTGAAAGG - Intergenic
1161552285 19:4920529-4920551 CCCACTTACCTCTACCTGACTGG + Intronic
1164484868 19:28646637-28646659 CGTAGTTACCTCTTTATTAAAGG - Intergenic
1167477239 19:49708111-49708133 CCCAGTTACCAACTCATCAAAGG - Intronic
1168713596 19:58514852-58514874 CCCAGGTCCCTCCTTATGAAAGG - Intronic
925499938 2:4491216-4491238 CCCACTGGCCTCTTCATGGAGGG + Intergenic
925552037 2:5086838-5086860 CCCATTGTCCTCCTCATGAAGGG - Intergenic
926779772 2:16459541-16459563 ACTAGTTATCTCTTCATGCATGG - Intergenic
927209277 2:20628869-20628891 CCCAGATTCCTCTTGGTGAAAGG + Intronic
929599921 2:43198560-43198582 CTCAGTCTCCTCTTCAGGAAAGG + Intergenic
931803229 2:65778874-65778896 CCCAGTTTCCTCATCTTTAAAGG + Intergenic
932655848 2:73610617-73610639 CCCAGTGTCCTCTTCATGGCAGG - Intronic
932953319 2:76319195-76319217 ACCAGTTTCCTATTCATAAAAGG + Intergenic
934619285 2:95794160-95794182 CCCAGTTACCTGACCAGGAAGGG - Intergenic
934641607 2:96030397-96030419 CCCAGTTACCTGACCAGGAAGGG + Exonic
937483012 2:122282265-122282287 CCCAATTACCTTCTCAAGAAAGG - Intergenic
937749127 2:125453481-125453503 CCCAGGTACCTGTGAATGAAGGG - Intergenic
938981613 2:136532333-136532355 CCAAGTTACCTCATACTGAAGGG + Intergenic
941899228 2:170662406-170662428 CTTAGTTACCTCTTCTGGAATGG + Intergenic
942811871 2:180009315-180009337 CTCAGATACCTCTTCAAGAAAGG - Intergenic
947821244 2:233072142-233072164 CCTAGTTACCACTTGATAAAAGG + Intronic
948494669 2:238339655-238339677 CACAGTTTCCTCGTCATAAATGG + Intronic
948662252 2:239514879-239514901 CCCAGTGACCTGCTCTTGAAGGG + Intergenic
948731733 2:239968499-239968521 CCCTGTTACTGCCTCATGAAAGG - Intronic
1169920693 20:10731503-10731525 CCCAGATTCCTTTTCAGGAAAGG - Intergenic
1171272438 20:23827245-23827267 CCCAGTGACCTTTTCAAAAAAGG - Intergenic
1176696474 21:9983581-9983603 CCCATTTAACTCTTCCTAAAGGG + Intergenic
1180726059 22:17947316-17947338 CCCAGTTACCTCTTCATGAAGGG - Intronic
951688003 3:25365924-25365946 CCCTGTTTCCTCTCCATGAATGG - Intronic
952013852 3:28933617-28933639 CACAGTTCCCTCTTAATGCAGGG - Intergenic
954802506 3:53195305-53195327 CCCAGGTAGCTCTGCCTGAAAGG - Intergenic
954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
959936605 3:112036129-112036151 CCTAGTTACAGCTTCATGACTGG - Intronic
966409679 3:179635244-179635266 GTCTGTTACCTCTTCATAAAAGG - Intergenic
969997351 4:11326558-11326580 CGAAGTTACCTCTTCATGGAGGG + Intergenic
971679756 4:29681819-29681841 CCAAATTACATCTTCATAAAGGG + Intergenic
973289430 4:48455604-48455626 CCAAGTTTCCTCTTCTTGAGTGG - Intergenic
973824746 4:54693737-54693759 CCCAGTCACCTCTTGCAGAATGG - Intronic
973905620 4:55527125-55527147 CCCAGTTACTTCAACATGGAGGG + Intronic
976473577 4:85456995-85457017 CCAAGTTACTTCTACATTAATGG - Intergenic
977259611 4:94783057-94783079 CACAGTTACCTTTGGATGAAAGG + Intronic
985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG + Intergenic
986308331 5:6532121-6532143 CCCAGTTAAATCTCCAGGAAAGG + Intergenic
993763331 5:91823990-91824012 CCCAGTCTCCTCTCCAGGAAGGG - Intergenic
995868322 5:116716864-116716886 CCCATTTACCCCTTCATCAGAGG - Intergenic
997515668 5:134487613-134487635 CCCAGATCCCTCTTCAAGGAAGG - Intergenic
1000393349 5:160747952-160747974 CCCAGATACCTCTTCATCCTGGG - Intronic
1000415234 5:160977290-160977312 CCCAGATTTCCCTTCATGAAAGG - Intergenic
1004613780 6:17270333-17270355 CCCAGATTCCCCTTCAGGAATGG + Intergenic
1004721151 6:18268330-18268352 CCCAGATGCCTCTTCAAGGAAGG - Intergenic
1008370940 6:50729702-50729724 CCCTGTGAACTCTTCATAAAGGG - Intronic
1010068992 6:71720984-71721006 CCTAATTTCCTCTTCTTGAAAGG + Intergenic
1010926215 6:81749932-81749954 CTCATTTACCACTCCATGAAGGG + Exonic
1013168028 6:107611141-107611163 CCCAGTTCCCTCTTCACTAAAGG + Intronic
1016893993 6:149034713-149034735 CTAAGTTGCCTCCTCATGAAAGG + Intronic
1018065589 6:160123241-160123263 CCCAGTTACCTCTTATTTCAGGG - Intronic
1021294055 7:18881888-18881910 ACCAGGTACCACTTCATGAAGGG + Intronic
1022245828 7:28558402-28558424 GTCAGGTAGCTCTTCATGAATGG - Intronic
1024120217 7:46229262-46229284 CCCAGTTACCTTCTCATCTACGG - Intergenic
1024350241 7:48356030-48356052 CTCATTTACCTCTTCATGGGAGG - Intronic
1026137284 7:67674518-67674540 CCAAGTTAACACTTCAGGAAGGG - Intergenic
1027477423 7:78650575-78650597 CCCTGTAACCACTTCATTAAAGG - Intronic
1032428836 7:131844075-131844097 TCCAGTGACGTCTTCATGATTGG + Intergenic
1034956792 7:155339894-155339916 TCCAGCTACCTTTTCATCAAAGG + Intergenic
1035070730 7:156143476-156143498 CCCAGTTCCCTCTCCATGGCGGG + Intergenic
1038409653 8:27348324-27348346 CCCTGTTTCCTCTGCATGACAGG + Intronic
1041465725 8:58155822-58155844 CCCAGTTGCCTCTTGTAGAACGG - Intronic
1045500087 8:102738370-102738392 CCCAGCCACCTCTTCCTGGATGG - Intergenic
1047183788 8:122614057-122614079 CCAAGTTTCCTCTTCTTGAAAGG + Intergenic
1048643054 8:136386031-136386053 CCCAGTTTCCTCTTTATTATTGG - Intergenic
1048833838 8:138499898-138499920 CCCATTGTCCTCTTAATGAATGG + Intergenic
1050801530 9:9621305-9621327 CCCATTTTTCTCTTCCTGAAGGG + Intronic
1051072689 9:13191642-13191664 CACAGTTACCACTTAGTGAATGG - Intronic
1052472295 9:28915280-28915302 CACAGTCACTTCTTCAAGAAAGG + Intergenic
1055561614 9:77527096-77527118 CCCAGTCACCTCACCATGACTGG + Intronic
1058216363 9:102238552-102238574 ACCAGCTGCCTCTTCATGGAAGG - Intergenic
1061446091 9:130638959-130638981 CCCATTTGTTTCTTCATGAAAGG - Intergenic
1061616974 9:131786783-131786805 TCCAGGCACCTGTTCATGAATGG - Intergenic
1061728571 9:132595640-132595662 GCCAGATAGCTCTTTATGAACGG + Intronic
1188859433 X:35239289-35239311 CCAAGTTTCCTCTTCATGTAAGG - Intergenic
1192249041 X:69396096-69396118 CCCATGTACCACCTCATGAATGG + Intergenic
1193983970 X:88218167-88218189 CCCAGTCTCCTCTTCATTCAAGG - Intergenic
1195506615 X:105665465-105665487 ACCTGTTACCTCTTTATGGATGG + Intronic
1195649135 X:107266286-107266308 CCCAAATAGCTCTTCATTAAAGG + Intergenic
1197178856 X:123512690-123512712 CTCAGATCCCTCTTCAAGAAAGG + Intergenic
1197984702 X:132255333-132255355 TCCAGTACCCTCTTCTTGAAGGG - Intergenic
1198703155 X:139418521-139418543 CCCAGATACCTCTCCAAGGAAGG + Intergenic
1199518220 X:148703368-148703390 ACCTGTTACCAGTTCATGAATGG - Intronic
1199594491 X:149495860-149495882 CCCAGTTCCCTCTGCACCAAGGG + Intronic
1199938902 X:152605098-152605120 CCCAGTCACCTCTGCAAAAATGG - Intergenic
1202253412 Y:22895778-22895800 CCCAGTGTCCTCATTATGAAGGG + Intergenic
1202406402 Y:24529527-24529549 CCCAGTGTCCTCATTATGAAGGG + Intergenic
1202464380 Y:25140554-25140576 CCCAGTGTCCTCATTATGAAGGG - Intergenic