ID: 1180733779

View in Genome Browser
Species Human (GRCh38)
Location 22:18001088-18001110
Sequence CCTGGCCACGCATCCTCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 4, 3: 2, 4: 124}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180733762_1180733779 27 Left 1180733762 22:18001038-18001060 CCCGCGCTTCCCCGCGCCTGCTG 0: 1
1: 0
2: 0
3: 19
4: 255
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733772_1180733779 3 Left 1180733772 22:18001062-18001084 CCCGGAACTCAGGACCAGCCGGC No data
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733770_1180733779 4 Left 1180733770 22:18001061-18001083 CCCCGGAACTCAGGACCAGCCGG 0: 1
1: 0
2: 2
3: 81
4: 1977
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733765_1180733779 18 Left 1180733765 22:18001047-18001069 CCCCGCGCCTGCTGCCCCGGAAC 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733767_1180733779 16 Left 1180733767 22:18001049-18001071 CCGCGCCTGCTGCCCCGGAACTC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733763_1180733779 26 Left 1180733763 22:18001039-18001061 CCGCGCTTCCCCGCGCCTGCTGC 0: 1
1: 0
2: 2
3: 31
4: 354
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733773_1180733779 2 Left 1180733773 22:18001063-18001085 CCGGAACTCAGGACCAGCCGGCG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733761_1180733779 28 Left 1180733761 22:18001037-18001059 CCCCGCGCTTCCCCGCGCCTGCT 0: 1
1: 0
2: 2
3: 21
4: 240
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733769_1180733779 11 Left 1180733769 22:18001054-18001076 CCTGCTGCCCCGGAACTCAGGAC 0: 1
1: 0
2: 3
3: 14
4: 174
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124
1180733766_1180733779 17 Left 1180733766 22:18001048-18001070 CCCGCGCCTGCTGCCCCGGAACT 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG 0: 1
1: 0
2: 4
3: 2
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180733779 Original CRISPR CCTGGCCACGCATCCTCCGG CGG Intronic
900197403 1:1383602-1383624 GCTGGCCACGGATCATCTGGTGG + Intergenic
900270042 1:1782346-1782368 CCTCCCCACGCATCCTGCTGAGG + Intergenic
901068561 1:6506195-6506217 CCAGGCCACCCAGCCTCCGAGGG - Intronic
902300827 1:15501613-15501635 CCAGGTCACGCAGCCTGCGGAGG + Intronic
902511974 1:16971617-16971639 CCAGCCCACGCACCCTCTGGCGG - Exonic
903808582 1:26022175-26022197 CCTGGCCAAGCCGCCTCCTGTGG + Exonic
907437713 1:54460028-54460050 CCTGCCCAGCCATCCTCCTGGGG - Intergenic
914323088 1:146584247-146584269 CAGGGCCACCCATCCTCAGGAGG + Intergenic
919754238 1:201056721-201056743 CCTGGCAAGGCAGCCTCTGGAGG + Intronic
920367764 1:205457055-205457077 CTTGGCCGCGCGGCCTCCGGCGG - Intergenic
923631199 1:235650192-235650214 CCCGGCCACGCGGGCTCCGGGGG - Intronic
923684351 1:236143290-236143312 CCTGGCTCCGCATCGTGCGGTGG + Intronic
1063343983 10:5294418-5294440 CCTGGCCCCGCATCCTCAACGGG + Intergenic
1067001769 10:42621221-42621243 CCTCCCCACTCATCCTCCTGAGG - Intronic
1075264016 10:120985489-120985511 CCTGGCCACAGAACCTCAGGTGG + Intergenic
1076060891 10:127413212-127413234 ACTGGCCGCGCACCCTCCAGTGG - Intronic
1076935411 10:133565473-133565495 CCTGTCCACGGCTCCTGCGGTGG + Exonic
1077029961 11:460996-461018 CCTGGCCCCACTTGCTCCGGCGG + Intronic
1077476570 11:2793113-2793135 CCTGGCCACCCATCCTCGCTGGG + Intronic
1080898793 11:36467865-36467887 CCTGGCCACACAGCCTCAGTTGG - Intergenic
1083175999 11:60950956-60950978 CCTGCCCCGGCATACTCCGGCGG - Intronic
1084681387 11:70668468-70668490 CAGGGCCACGCTCCCTCCGGGGG - Intronic
1085026601 11:73240110-73240132 CCTGGCCACTCCTCCTCCAATGG + Intergenic
1085388534 11:76170730-76170752 CCTTGACAAGCAGCCTCCGGGGG + Intergenic
1086070186 11:82791189-82791211 TGTAGCCAGGCATCCTCCGGAGG + Intergenic
1087094824 11:94308095-94308117 CCTGGCCTCCCATCCTCCGACGG + Intergenic
1096077645 12:48815151-48815173 GCCGGCCGCCCATCCTCCGGCGG - Intronic
1098893645 12:76033084-76033106 GCTGGCCAAGCATAATCCGGTGG - Exonic
1102579793 12:113879103-113879125 CCTGGCCACCCATCCTGCCCTGG + Intronic
1104981979 12:132577266-132577288 CCTGGCCACCCCTCCTCCCTGGG + Intronic
1105462896 13:20608310-20608332 GCAGGCAACGCATCCTCCTGTGG - Intronic
1119808650 14:77498854-77498876 CCCCGCCTCGCCTCCTCCGGGGG + Intergenic
1129771235 15:78204692-78204714 CCTGTCCCCGCAGCCTCCGATGG - Intronic
1131292537 15:91119049-91119071 ACTGGCCAAGCATCCTGCAGAGG - Intronic
1133105479 16:3505640-3505662 CCTGGCCCAGCATCCTACTGAGG - Intronic
1136040028 16:27571532-27571554 GCTGGCCACACAGCCTCCTGGGG - Intronic
1136560175 16:31034300-31034322 CCTGGCCACGCCCCTTCCCGAGG + Exonic
1140010471 16:71126603-71126625 CAGGGCCACCCATCCTCAGGAGG - Intronic
1141628071 16:85271927-85271949 CCTGGCCACGTAGCCCCCGAAGG - Intergenic
1142764166 17:2056438-2056460 CCTGGCCTCCCCTCCACCGGCGG + Intronic
1143169534 17:4919887-4919909 CATGGCCACACTTCCCCCGGAGG - Intergenic
1143403599 17:6661245-6661267 CCTGCCCACGGATCCCCCAGTGG + Intergenic
1144673044 17:17143676-17143698 CCAGGCGCCGCGTCCTCCGGAGG + Intronic
1144778727 17:17797463-17797485 CCTGGCCTCCCAGCCCCCGGAGG + Exonic
1146654223 17:34625976-34625998 CCTGGCTGTCCATCCTCCGGTGG - Intronic
1148139334 17:45317108-45317130 CGGGGCCACGCCTCCCCCGGAGG + Intergenic
1149032291 17:52097965-52097987 CCTGGCCACTCTTCCAGCGGAGG + Intronic
1151575886 17:74952398-74952420 GCTTGCCCCGCAGCCTCCGGGGG - Intronic
1152087875 17:78231576-78231598 CCTGGCCGGCCATCCTCCTGGGG + Exonic
1152231087 17:79114508-79114530 CCTGCCCACACATGCACCGGGGG + Intronic
1152918187 17:83052511-83052533 CCTGGGCACCCCTCCTCCTGGGG - Intergenic
1152918266 17:83052715-83052737 CCTGGGCACCCCTCCTCCTGGGG - Intergenic
1152918308 17:83052817-83052839 CCTGGGCACCCCTCCTCCTGGGG - Intergenic
1153581646 18:6579949-6579971 CATGGCCACGCATTCACCGTTGG + Intronic
1154295553 18:13143868-13143890 CCTGGCCACTCATCCTCCAGAGG + Intergenic
1160284718 18:77530915-77530937 CCAGGCCAGGCCTCCTCCAGGGG + Intergenic
1160706324 19:531839-531861 CCGGGCCGCGCACCGTCCGGGGG - Exonic
1160820357 19:1054939-1054961 CCTGGCCAGGGAGCCTCAGGGGG + Intronic
1161722147 19:5909035-5909057 CCCGGCCACCCACCCCCCGGTGG + Exonic
1163317794 19:16553503-16553525 GCAGGCAACGCATCCTCCTGCGG + Exonic
1164974246 19:32559969-32559991 CCTGGCCGCTCATCCTCAGTGGG - Intergenic
1166998980 19:46733968-46733990 CCTGGCCAGGAAGCCTCCTGAGG - Intronic
1167138420 19:47632539-47632561 CCTGGTCACGCTCCCTGCGGTGG - Intronic
1167648141 19:50716790-50716812 CCTGGCCCCGGGTCCCCCGGGGG + Exonic
927893317 2:26765760-26765782 CCAGGCCCTGCATCCTCCTGAGG + Intronic
930872832 2:56184950-56184972 CCTGGCCCCGCCTCCTCCTCGGG - Intronic
932621448 2:73266723-73266745 CCTGCCCACCCACCCTCTGGAGG + Intronic
934555150 2:95283167-95283189 CCTGGCCAGGCTTCCTCCACAGG - Intronic
937378142 2:121352008-121352030 CCGGGCCACCCATGCTCTGGTGG + Intronic
937869531 2:126777294-126777316 CCCGACCATGCCTCCTCCGGTGG + Intergenic
948053347 2:234994355-234994377 CATGGCCACTCATCCTCTGCAGG - Intronic
948102374 2:235385104-235385126 CCTGGCCAGGCATCCGCCGCAGG + Intergenic
948896186 2:240928861-240928883 CCTGGCCATACACCCTCCAGAGG - Intronic
948896203 2:240928951-240928973 CCTGGCCATACACCCTCCGAGGG - Intronic
948896213 2:240928995-240929017 CCTGGCCATGCACCCGCTGGAGG - Intronic
1168914320 20:1473944-1473966 CAGGGCCACACTTCCTCCGGAGG + Intronic
1170568160 20:17618195-17618217 CCTGGCCACCCATCGCCCTGGGG - Intronic
1174216852 20:48922153-48922175 CCGGGCAACACTTCCTCCGGGGG - Intronic
1175980723 20:62737378-62737400 TCTGGACACGCATCCTAGGGTGG - Intronic
1178537180 21:33420107-33420129 CCTGGCCACGCATCTTGAAGTGG + Intronic
1179571837 21:42283074-42283096 CCTGGCCACCCATCCTGCCTGGG - Intronic
1180184629 21:46133365-46133387 CCGGGCCATGCTTCCTCTGGAGG + Intergenic
1180193616 21:46181113-46181135 CCGGGGCACGCAGCCTGCGGCGG + Intronic
1180733779 22:18001088-18001110 CCTGGCCACGCATCCTCCGGCGG + Intronic
1181036011 22:20169970-20169992 CCTGCCCACGCCTCATCTGGTGG + Intergenic
1181177350 22:21045272-21045294 TCTGGCCTCACTTCCTCCGGTGG + Intergenic
1181522695 22:23458697-23458719 CCAGCCCAGGCATGCTCCGGTGG + Intergenic
950008016 3:9703954-9703976 CCTGGTCTCGCAGCCTCCTGCGG + Exonic
951208431 3:19947693-19947715 CCTGGTGACTCATCCTCCAGGGG + Intronic
953494922 3:43377685-43377707 CCTGGCCACGCCTCCTCTTCTGG - Intronic
954238871 3:49277686-49277708 CCTGGCCCCTCAACCTCCTGTGG - Exonic
961911115 3:130317587-130317609 CCTGGACTCCCATCCTCGGGAGG + Intergenic
967331892 3:188298351-188298373 ACTGGCCACTGATCCTCCTGGGG + Intronic
968979897 4:3841592-3841614 CCCTGCCTCGCATCCTCCAGAGG - Intergenic
969353282 4:6610640-6610662 CCTGGCCACGCATCATCTCATGG - Intronic
969451732 4:7277709-7277731 CCTGGCCAGTCAGCCTCTGGAGG + Intronic
969471132 4:7389927-7389949 CCTGGCAAGGCATCCCCAGGAGG - Intronic
969535508 4:7754337-7754359 CCTGGCAATGCATCCCCCGAGGG + Intergenic
972458680 4:39279126-39279148 CGTGGCCACACATACTGCGGAGG + Intronic
973945345 4:55949168-55949190 CCTGGCCTCACTTCCTCCCGCGG - Intronic
980530561 4:134047117-134047139 CATGGCCATGCATCCTCTTGAGG + Intergenic
985577304 5:679350-679372 CCTGCCCCTGCATCCTCCGCTGG - Intronic
985592218 5:771401-771423 CCTGCCCCTGCATCCTCCGCTGG - Intergenic
988540976 5:32109407-32109429 TCTGGCCACTCCTCCTCTGGTGG + Exonic
1002328382 5:178424927-178424949 CCTGGCCTCGCCTCCTCCTCAGG + Intronic
1002921313 6:1575290-1575312 CCTGGCCAGGCCTCCTCTGTAGG + Intergenic
1003476745 6:6490622-6490644 CAGGGCCACGCTTCCTCCAGTGG - Intergenic
1006296765 6:33173313-33173335 CCTGGCTACCCATTCTCAGGGGG - Intronic
1007177789 6:39908612-39908634 TCTGGCCACACATCCACCCGTGG + Intronic
1014001077 6:116367144-116367166 CCTGGCCAGGCATCCTCCAGAGG - Intronic
1019588630 7:1817840-1817862 CCAGCCCAGGCATGCTCCGGTGG - Intronic
1025035131 7:55589061-55589083 CCTGGCCACCAATTCTCAGGAGG + Intergenic
1025899410 7:65731844-65731866 CCTGCCCCCTCCTCCTCCGGGGG + Intergenic
1028965423 7:96796530-96796552 CCAGGCCACGCATCCCCTAGTGG + Intergenic
1035065767 7:156104209-156104231 CCTGGCCAAGCTTCCTGCTGCGG - Intergenic
1035527973 8:328733-328755 CCGGGCCACGCAGCCTCCCTTGG - Intergenic
1038841784 8:31190995-31191017 CCAGGCCACCCATCCCCAGGTGG + Intergenic
1044598462 8:93980845-93980867 CCTGGCCAGGCATCTGCCTGGGG - Intergenic
1049246407 8:141565148-141565170 CCTGGCCACGCAAACTCTTGAGG - Intergenic
1055848811 9:80599922-80599944 CCTGGCCACGAATCATCATGAGG + Intergenic
1057047548 9:91897879-91897901 CCTCACCACACATCCTCAGGTGG - Intronic
1061008926 9:127943919-127943941 CCTGGCCACGCCTCTTCCCTGGG + Intronic
1061488764 9:130933889-130933911 CCTGGCCTGGCCTCCCCCGGAGG - Intronic
1062684445 9:137803032-137803054 CCCCGCCACGCAGTCTCCGGGGG - Intronic
1185832697 X:3317138-3317160 CCTGGCCGCGCATCCTCTGGAGG - Exonic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1187239590 X:17500531-17500553 TCTGGCCACGTTTCCTCCTGCGG + Intronic
1190063829 X:47226999-47227021 CCTGGCCACGTCTCCTCAGTTGG - Exonic
1196723761 X:118878066-118878088 CTTGGCCACCCACCCTCTGGTGG - Intergenic
1201243391 Y:11979798-11979820 CCTGGCCGCGCATCCTCTGGAGG + Intergenic
1201693328 Y:16793992-16794014 CCTGGCTATGCATTCTCAGGTGG - Intergenic