ID: 1180733782

View in Genome Browser
Species Human (GRCh38)
Location 22:18001093-18001115
Sequence ACCTCCCGCCGGAGGATGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180733782_1180733794 26 Left 1180733782 22:18001093-18001115 CCACGCATCCTCCGGCGGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1180733794 22:18001142-18001164 CTTCCTCGCGCCCCGCCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 123
1180733782_1180733793 22 Left 1180733782 22:18001093-18001115 CCACGCATCCTCCGGCGGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1180733793 22:18001138-18001160 GGGGCTTCCTCGCGCCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 154
1180733782_1180733792 3 Left 1180733782 22:18001093-18001115 CCACGCATCCTCCGGCGGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1180733792 22:18001119-18001141 CACACGGGAACGCGAGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 53
1180733782_1180733787 -3 Left 1180733782 22:18001093-18001115 CCACGCATCCTCCGGCGGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1180733787 22:18001113-18001135 GGTGACCACACGGGAACGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 30
1180733782_1180733791 2 Left 1180733782 22:18001093-18001115 CCACGCATCCTCCGGCGGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1180733791 22:18001118-18001140 CCACACGGGAACGCGAGGCGGGG 0: 1
1: 0
2: 1
3: 3
4: 43
1180733782_1180733788 0 Left 1180733782 22:18001093-18001115 CCACGCATCCTCCGGCGGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1180733788 22:18001116-18001138 GACCACACGGGAACGCGAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1180733782_1180733789 1 Left 1180733782 22:18001093-18001115 CCACGCATCCTCCGGCGGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1180733789 22:18001117-18001139 ACCACACGGGAACGCGAGGCGGG 0: 1
1: 0
2: 1
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180733782 Original CRISPR ACCTCCCGCCGGAGGATGCG TGG (reversed) Intronic