ID: 1180733872 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:18001415-18001437 |
Sequence | CCACAGCGACGCCGGCGCCG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 124 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 113} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180733872_1180733883 | 21 | Left | 1180733872 | 22:18001415-18001437 | CCTCGGCGCCGGCGTCGCTGTGG | 0: 1 1: 0 2: 0 3: 10 4: 113 |
||
Right | 1180733883 | 22:18001459-18001481 | CGCAGCCCGAGCGTCCGGCGCGG | 0: 1 1: 0 2: 2 3: 8 4: 102 |
||||
1180733872_1180733881 | 16 | Left | 1180733872 | 22:18001415-18001437 | CCTCGGCGCCGGCGTCGCTGTGG | 0: 1 1: 0 2: 0 3: 10 4: 113 |
||
Right | 1180733881 | 22:18001454-18001476 | TGTTCCGCAGCCCGAGCGTCCGG | 0: 1 1: 0 2: 0 3: 3 4: 37 |
||||
1180733872_1180733884 | 25 | Left | 1180733872 | 22:18001415-18001437 | CCTCGGCGCCGGCGTCGCTGTGG | 0: 1 1: 0 2: 0 3: 10 4: 113 |
||
Right | 1180733884 | 22:18001463-18001485 | GCCCGAGCGTCCGGCGCGGTAGG | 0: 1 1: 0 2: 1 3: 4 4: 45 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180733872 | Original CRISPR | CCACAGCGACGCCGGCGCCG AGG (reversed) | Intronic | ||