ID: 1180733872

View in Genome Browser
Species Human (GRCh38)
Location 22:18001415-18001437
Sequence CCACAGCGACGCCGGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180733872_1180733881 16 Left 1180733872 22:18001415-18001437 CCTCGGCGCCGGCGTCGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1180733881 22:18001454-18001476 TGTTCCGCAGCCCGAGCGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 37
1180733872_1180733883 21 Left 1180733872 22:18001415-18001437 CCTCGGCGCCGGCGTCGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1180733883 22:18001459-18001481 CGCAGCCCGAGCGTCCGGCGCGG 0: 1
1: 0
2: 2
3: 8
4: 102
1180733872_1180733884 25 Left 1180733872 22:18001415-18001437 CCTCGGCGCCGGCGTCGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1180733884 22:18001463-18001485 GCCCGAGCGTCCGGCGCGGTAGG 0: 1
1: 0
2: 1
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180733872 Original CRISPR CCACAGCGACGCCGGCGCCG AGG (reversed) Intronic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900305287 1:2003789-2003811 CCTCCGCGGCGCCGGCGGCGTGG + Exonic
901058446 1:6460529-6460551 CGCCAGCGACGCCGGTTCCGGGG - Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
903034439 1:20485316-20485338 CTACGGCGACGGCGGCGACGTGG - Exonic
903468478 1:23568481-23568503 CCGCAGGGACGCTGGGGCCGCGG - Intergenic
906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG + Exonic
906627132 1:47334239-47334261 CCACTGCCACGCGGGCGGCGCGG - Intronic
918064220 1:181088869-181088891 GCACAGGGCCGTCGGCGCCGGGG - Exonic
921850471 1:219928206-219928228 CTACGGCTACGCCCGCGCCGAGG - Exonic
922505228 1:226122151-226122173 CCGCGGCCACGCCAGCGCCGGGG - Intergenic
923035134 1:230280288-230280310 CAACAGGGATGCCGGGGCCGAGG - Exonic
1062802365 10:389600-389622 ACACAGCCACGCCGGGGCCTGGG - Intronic
1065343221 10:24724599-24724621 TCACAGCGGCTCCGGAGCCGCGG + Intergenic
1065528108 10:26642982-26643004 CCACAGCGACCCCGCCCCCACGG - Intergenic
1070305028 10:75234778-75234800 CCTCAGGGCCGCCGGGGCCGCGG - Intronic
1075699763 10:124461804-124461826 CGACGCCGGCGCCGGCGCCGCGG - Intergenic
1081620892 11:44618690-44618712 CCACACCCACGCCCACGCCGAGG - Exonic
1084177071 11:67428527-67428549 CCATGGCGGCGCCGGCCCCGCGG - Exonic
1084539096 11:69775425-69775447 CCACAGCGCCCCGGGCGCCCAGG - Intergenic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1103362420 12:120361894-120361916 CCATGGCAACGCCGGCCCCGGGG + Intronic
1105011901 12:132761790-132761812 CCACAGCATCGCCGCCGCCCGGG + Exonic
1105943424 13:25170731-25170753 CCCCGGCGACACCGGCGCCCGGG - Exonic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1108727984 13:53201963-53201985 CGACAGCGACGGCGGCCCCGGGG + Intergenic
1109024644 13:57142539-57142561 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109025631 13:57149109-57149131 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109026621 13:57155682-57155704 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109027613 13:57162253-57162275 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109028599 13:57168818-57168840 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1110573012 13:77026777-77026799 CCGCTGCGACGGCGGAGCCGGGG - Intronic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1114280296 14:21187981-21188003 TCAAAGGGACGCCGGCGCTGAGG + Intergenic
1116492883 14:45526893-45526915 CCACAGCGAGGCAGGAGCCCTGG - Intergenic
1121168762 14:91836078-91836100 CCTCAGCGACGCCTGTGTCGCGG - Intronic
1122582026 14:102777245-102777267 CCTTAGCAACGGCGGCGCCGCGG - Intergenic
1122648014 14:103207687-103207709 GCACCGCGAAGCCGTCGCCGTGG - Intergenic
1122904582 14:104795832-104795854 CCACCGCGCGGCCGGCGGCGAGG + Intergenic
1123154810 14:106213836-106213858 CCACAGGGATGAAGGCGCCGCGG - Intergenic
1124496641 15:30191519-30191541 CCTCAGCGAAGCAGGCGCGGCGG + Intergenic
1124584379 15:30991683-30991705 CCAGGCCGACGCGGGCGCCGGGG + Intergenic
1124746935 15:32347129-32347151 CCTCAGCGAAGCAGGCGCGGCGG - Intergenic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1128605420 15:69033208-69033230 CCACCATGACGCTGGCGCCGAGG - Exonic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1134681589 16:16129823-16129845 TCACAGCGTTGCCGGCGCAGTGG - Intronic
1141682617 16:85553365-85553387 ACAAAGGGCCGCCGGCGCCGAGG + Intergenic
1142186899 16:88698933-88698955 CCCAAGCGACGCCTGCGCCAGGG - Intronic
1142218511 16:88841590-88841612 CCACAGGGAGGCCGGGGCTGTGG - Intronic
1142225782 16:88877035-88877057 CCCCAGCGAAGCCGGCTCTGCGG - Exonic
1144109998 17:12021459-12021481 CCACTGCGGCGGCGGGGCCGAGG - Intronic
1144682765 17:17206306-17206328 CCACAGCCACGCCGCCGCAGCGG + Exonic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146716248 17:35089202-35089224 CCCCAGAGACGCCGCCGCGGCGG - Exonic
1150283166 17:63940995-63941017 CCACAGCCACGACGGCAGCGGGG - Exonic
1160696744 19:488725-488747 CCGCAGCGAGCCCAGCGCCGGGG + Intergenic
1161115577 19:2494910-2494932 CCACTGGGGCCCCGGCGCCGGGG + Intergenic
1161494654 19:4580685-4580707 CCACTGCGACCCCTGCCCCGCGG + Intergenic
1166723620 19:45012071-45012093 CCCCAGCCACGCCGCCGCCTTGG + Exonic
1166792275 19:45405301-45405323 CCACAGCGAGGCAGGCGTCTCGG - Intronic
926205201 2:10830753-10830775 GCACAGCCACGCCCGCGCAGGGG - Intronic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
934577272 2:95410881-95410903 CCACAGTGAAGCCGGCCACGTGG - Exonic
934639569 2:96019555-96019577 CCACAGTGAAGCCGGCCACGTGG - Intergenic
934794081 2:97085822-97085844 CCACAGTGAAGCCGGCCACGTGG + Exonic
937997085 2:127702140-127702162 CCTTGGCGAGGCCGGCGCCGCGG - Exonic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
947800853 2:232927957-232927979 CTTCAGCGCCGCCTGCGCCGTGG - Intronic
948407965 2:237736985-237737007 CCAGAGCGGCCCCGGCGCCCAGG + Intronic
948835223 2:240623116-240623138 CCACAGCGACTCCGGCCGCGGGG - Intronic
1168802629 20:653180-653202 CCCCATCGTCGCCGCCGCCGCGG + Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1171035428 20:21709371-21709393 GCACAGCTACGCCGGCCCCGGGG - Exonic
1171504659 20:25623756-25623778 CCACTTCCACCCCGGCGCCGCGG - Intronic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1173243437 20:41317620-41317642 CGGCGGCGACGCCGGAGCCGCGG + Intronic
1174611663 20:51802286-51802308 CCCCAGCGGCGCCCGCGGCGGGG - Exonic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1176193944 20:63828296-63828318 TCACAGCTACGCCGCAGCCGCGG + Intronic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1179906344 21:44425104-44425126 ACCCACCGACGCTGGCGCCGAGG + Intronic
1180109780 21:45642603-45642625 GCACAGCGAGGCGGGCTCCGCGG + Intergenic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1184140794 22:42576461-42576483 CCACAGCCACACGGGCGACGCGG + Intergenic
966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG + Intergenic
968230784 3:197003435-197003457 CCCCAGCGGCCCCGGCGCCCGGG - Exonic
968733905 4:2285400-2285422 CCACAGTGGGGCCGGCGCCATGG - Intronic
973339167 4:48986422-48986444 CCACAGCGAGGGCATCGCCGCGG - Exonic
976297210 4:83484700-83484722 CCACAGCTACAGGGGCGCCGAGG + Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
982712204 4:158768942-158768964 CCACGGCGGCGGCGGCGGCGCGG - Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
984778587 4:183504909-183504931 CCTCGGCGGGGCCGGCGCCGGGG - Intergenic
990955102 5:61332653-61332675 CAACACCGGCGGCGGCGCCGCGG + Exonic
996948193 5:129094802-129094824 CAACAGCGGCGCCGGGGGCGCGG + Exonic
1001443317 5:171763017-171763039 CCACAGGGAAGCCAGCGCCCTGG + Intergenic
1002401659 5:178994566-178994588 CCACCTCGTCGCCGTCGCCGCGG + Exonic
1002541234 5:179907724-179907746 CTGCAGCGACGCCGGGGCCACGG - Exonic
1003569469 6:7246746-7246768 CGACGGCGAGGCAGGCGCCGGGG + Exonic
1007406085 6:41637202-41637224 CGAGAGCGCTGCCGGCGCCGTGG + Intronic
1016657934 6:146543352-146543374 CCACGCCGACCCCGGCCCCGGGG + Intergenic
1016738863 6:147508165-147508187 CCGCAGCGTCCCCAGCGCCGTGG + Intergenic
1019636028 7:2076164-2076186 CCACAGCCACGCCCGGGCCCAGG + Intronic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1020288817 7:6706743-6706765 CCCCAGCGCCGTCGGCTCCGGGG + Exonic
1026727260 7:72879554-72879576 CCCCAGCGCCGCTGGCTCCGGGG - Exonic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1031531777 7:122885723-122885745 CGACAGCGCCGGCCGCGCCGCGG - Intronic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1048981713 8:139705995-139706017 CCGCAGCGAGGCCGGCTGCGCGG - Intergenic
1049574485 8:143384026-143384048 TCCCAGAGACGCAGGCGCCGCGG + Exonic
1049726225 8:144147743-144147765 CGACAGCTACGCCAGCCCCGGGG - Intergenic
1049761473 8:144333775-144333797 CGACGGCGACGCCGGAGGCGGGG - Exonic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1061897295 9:133655108-133655130 CCACGGGGACGCTGGCACCGAGG - Intronic
1062565964 9:137164100-137164122 CCACTGCAAAGCCGGGGCCGAGG + Intronic
1062699996 9:137894269-137894291 CCACAGCCTCGCCGGCACGGGGG + Intronic
1189396063 X:40623877-40623899 CTACGGCGGCGGCGGCGCCGAGG + Intergenic