ID: 1180733872

View in Genome Browser
Species Human (GRCh38)
Location 22:18001415-18001437
Sequence CCACAGCGACGCCGGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180733872_1180733883 21 Left 1180733872 22:18001415-18001437 CCTCGGCGCCGGCGTCGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1180733883 22:18001459-18001481 CGCAGCCCGAGCGTCCGGCGCGG 0: 1
1: 0
2: 2
3: 8
4: 102
1180733872_1180733881 16 Left 1180733872 22:18001415-18001437 CCTCGGCGCCGGCGTCGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1180733881 22:18001454-18001476 TGTTCCGCAGCCCGAGCGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 37
1180733872_1180733884 25 Left 1180733872 22:18001415-18001437 CCTCGGCGCCGGCGTCGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1180733884 22:18001463-18001485 GCCCGAGCGTCCGGCGCGGTAGG 0: 1
1: 0
2: 1
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180733872 Original CRISPR CCACAGCGACGCCGGCGCCG AGG (reversed) Intronic