ID: 1180736942

View in Genome Browser
Species Human (GRCh38)
Location 22:18024389-18024411
Sequence CTGGGCGGGATCGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180736942_1180736953 18 Left 1180736942 22:18024389-18024411 CCTGCAGCTGCGATCCCGCCCAG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1180736953 22:18024430-18024452 CAGCCCAGCCCCCTCGCCCAGGG 0: 1
1: 0
2: 2
3: 56
4: 469
1180736942_1180736952 17 Left 1180736942 22:18024389-18024411 CCTGCAGCTGCGATCCCGCCCAG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1180736952 22:18024429-18024451 ACAGCCCAGCCCCCTCGCCCAGG 0: 1
1: 0
2: 8
3: 37
4: 429
1180736942_1180736957 25 Left 1180736942 22:18024389-18024411 CCTGCAGCTGCGATCCCGCCCAG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1180736957 22:18024437-18024459 GCCCCCTCGCCCAGGGCCCAGGG 0: 1
1: 0
2: 4
3: 45
4: 382
1180736942_1180736946 -10 Left 1180736942 22:18024389-18024411 CCTGCAGCTGCGATCCCGCCCAG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1180736946 22:18024402-18024424 TCCCGCCCAGTTAGCCTCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1180736942_1180736956 24 Left 1180736942 22:18024389-18024411 CCTGCAGCTGCGATCCCGCCCAG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1180736956 22:18024436-18024458 AGCCCCCTCGCCCAGGGCCCAGG 0: 1
1: 0
2: 3
3: 43
4: 479
1180736942_1180736959 26 Left 1180736942 22:18024389-18024411 CCTGCAGCTGCGATCCCGCCCAG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1180736959 22:18024438-18024460 CCCCCTCGCCCAGGGCCCAGGGG 0: 1
1: 0
2: 3
3: 44
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180736942 Original CRISPR CTGGGCGGGATCGCAGCTGC AGG (reversed) Exonic
900335215 1:2159468-2159490 CTGGGCGGCCTCACAGCTCCCGG + Intronic
901008989 1:6187945-6187967 CTGGGCGTGAGCGCAGTGGCAGG - Intronic
901615851 1:10538858-10538880 CTGGGAGGGCTCTCAGCTCCTGG + Intronic
904625688 1:31800602-31800624 CTGGCCCGGAACCCAGCTGCGGG + Exonic
907406280 1:54255392-54255414 CTGGGTGGGAAGGCTGCTGCTGG + Intronic
913216786 1:116627592-116627614 CAGGCCGGGAGCGCATCTGCAGG + Intronic
914879953 1:151539561-151539583 CTGGGCGGGGACGAAGCTCCAGG + Intergenic
916111185 1:161459491-161459513 GTGGGAGGGATCCCAGCTGGTGG - Intergenic
917790340 1:178495341-178495363 CTGGGCAGGCTCTCAGCTCCAGG + Intergenic
918294381 1:183142426-183142448 CTGTGCAGAATGGCAGCTGCTGG + Intronic
919724564 1:200873406-200873428 CTGCGCGGGCGCGCTGCTGCTGG + Exonic
920364066 1:205438862-205438884 TTGGCAGGGATTGCAGCTGCAGG - Intronic
922757128 1:228102790-228102812 CTGGGCGGGAGCGGGGCTGCGGG - Intronic
923243676 1:232110553-232110575 CAGGGAGAGATCACAGCTGCAGG - Intergenic
924823630 1:247518190-247518212 CAGGGCGGAATGGCAGCTCCCGG - Intronic
1067319546 10:45205218-45205240 CTGGATGGGTTCCCAGCTGCAGG - Intergenic
1068553460 10:58431933-58431955 CTGGGTGGGAAGGCAGGTGCGGG + Intergenic
1069667078 10:70170163-70170185 CTCGGGGGTCTCGCAGCTGCTGG - Intronic
1073267940 10:102239842-102239864 CAGGGCTGTATCCCAGCTGCAGG + Intronic
1074814509 10:117134342-117134364 CTGGGCGCGGGCGCCGCTGCAGG - Exonic
1076245280 10:128942522-128942544 CTGTCCAGGATGGCAGCTGCAGG + Intergenic
1076633965 10:131870636-131870658 CTGGGCAGGATGACACCTGCCGG + Intergenic
1084020162 11:66412428-66412450 CTGGCCTGGATCAAAGCTGCCGG + Intergenic
1084773386 11:71358559-71358581 CTGGGCAGGGCAGCAGCTGCAGG + Intergenic
1084949117 11:72654951-72654973 CAGGGCGGGATGGTAGCAGCAGG + Intronic
1085037328 11:73308336-73308358 CTGGGCGGGATCCCAGCGCTTGG - Exonic
1085454248 11:76656787-76656809 CTGTGTGGGATCACAGCTGTGGG + Intergenic
1087263090 11:96032442-96032464 CCGGGCGTGATGGCAGGTGCCGG + Intronic
1087634447 11:100687152-100687174 CTGGGTGGGAGCGCGGCGGCGGG + Intergenic
1087836623 11:102881663-102881685 CTGGGTGTGGTGGCAGCTGCGGG - Intergenic
1089559722 11:119337777-119337799 CTGGGCTGGAGTGCGGCTGCGGG + Intergenic
1090401595 11:126452827-126452849 CTGGGCGAGATGTGAGCTGCGGG - Intronic
1091200713 11:133778360-133778382 CGGGGCTGGGGCGCAGCTGCGGG + Intergenic
1092768874 12:11878481-11878503 GCGGGCTGGATCTCAGCTGCAGG + Intronic
1095050336 12:37548432-37548454 CAGGGCGGGATCCCAGCCTCAGG + Intergenic
1095949361 12:47773464-47773486 CGGGGCGGGTGCGCGGCTGCGGG + Intronic
1096121487 12:49091944-49091966 CTGTGCGGGATCAAGGCTGCTGG + Intronic
1096553967 12:52391832-52391854 CTGGGCAGGATGCCAGCAGCAGG - Intergenic
1102347408 12:112168791-112168813 CTGGGCAGGTTCGCTGCTGTGGG + Intronic
1102481312 12:113225695-113225717 CTGGGCGGGGTGGCACGTGCCGG - Intronic
1102689019 12:114745899-114745921 CTGGGCGTGGTGGCAGGTGCTGG + Intergenic
1103727961 12:123008226-123008248 TTGGCCAGGATCTCAGCTGCTGG + Intronic
1104945841 12:132414595-132414617 CAGGGCGGGACCCCAGCTACTGG - Intergenic
1110655517 13:77994119-77994141 CTAGGCTGGATAGCAGCTGCTGG + Intergenic
1113464752 13:110505485-110505507 CTGGGCGGGCTCCCATTTGCTGG - Intronic
1114483494 14:23049240-23049262 CAGGGCGGGAGGGCAGCAGCAGG + Exonic
1118448425 14:65873636-65873658 CTGGGCGTGGTGGCAGGTGCTGG - Intergenic
1118797285 14:69154073-69154095 CTGGCCTGGAGCGCAGCTGCTGG - Intergenic
1122651036 14:103227235-103227257 CTGGGCAGCCTCTCAGCTGCTGG + Intergenic
1124830416 15:33143635-33143657 CTGGGTGGCATGTCAGCTGCAGG + Intronic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1130657311 15:85800725-85800747 CTGGCAGGGACAGCAGCTGCAGG + Intergenic
1131598995 15:93828006-93828028 CTGGGCAGGGTGGCAGGTGCCGG + Intergenic
1131927503 15:97401672-97401694 CTGGGAGCAAGCGCAGCTGCTGG - Intergenic
1132206035 15:99986874-99986896 CCGGGTGGGAAGGCAGCTGCAGG + Intronic
1133737408 16:8626589-8626611 CTGGGCGTGGTGGCAGGTGCCGG - Intronic
1134295094 16:12938638-12938660 CTGGGCGTGGTGGCAGGTGCCGG - Intronic
1134880906 16:17744994-17745016 CTGGGTGGGCCCGCAGCAGCGGG + Intergenic
1138501460 16:57447556-57447578 CGGGCAGGCATCGCAGCTGCAGG - Exonic
1139826586 16:69762260-69762282 CTGGCCAGGCTCGCAGGTGCGGG - Intergenic
1139838907 16:69862404-69862426 CTAGGCTGGAGCGCAGCAGCAGG + Intronic
1142066307 16:88065002-88065024 CAGGGCGGGCTGGCAGCTGCAGG - Intronic
1142756215 17:2018048-2018070 CCAGGCAGGATGGCAGCTGCAGG - Intronic
1143756847 17:9073579-9073601 CTCGGCGGGAGGGCAGATGCTGG - Intronic
1144021026 17:11240607-11240629 CGAGGCGGGAACGCAGCTGCCGG - Intergenic
1147597698 17:41727426-41727448 GTGGGTGGGTTCCCAGCTGCAGG - Intronic
1150076037 17:62192911-62192933 CTGGGCGAGGTGGCAGGTGCTGG - Intergenic
1151968530 17:77445033-77445055 CTGTGAGGCAGCGCAGCTGCTGG - Intronic
1151999675 17:77637458-77637480 GTGGGCGGGAGCGCTGTTGCTGG + Intergenic
1152609850 17:81310149-81310171 TTGGGGGGGTGCGCAGCTGCTGG - Intergenic
1152796673 17:82310967-82310989 CCGGGCGGGCACGCAGCTGCTGG + Intergenic
1156483186 18:37448857-37448879 GTGGGCAGGATAGCATCTGCTGG - Intronic
1160702930 19:517337-517359 CAGGGCTGGATGGGAGCTGCGGG + Intronic
1160967894 19:1754521-1754543 CTGGGCGGGCTGGCGGCGGCCGG + Exonic
1161270749 19:3388023-3388045 CGGGGCGGGCTGGCAGCTGCTGG - Intronic
1161417754 19:4157167-4157189 CTGGGCAGGATGGCAGCCGGCGG - Exonic
1161440992 19:4291545-4291567 CTGGGAGTGATGCCAGCTGCGGG + Intergenic
1162316838 19:9944369-9944391 CTGGGCGTGGTGGCAGGTGCCGG - Intergenic
1162778709 19:12995805-12995827 CCGGGCGGGAGCGCGGCGGCCGG - Exonic
1163054195 19:14706105-14706127 CTGGGCAGGATGGCAGCAGCAGG - Intronic
1163313819 19:16529659-16529681 GTGGGCGGGATGGCAGGGGCAGG + Exonic
1165596327 19:37013548-37013570 CAGCGCGGGATCCCAGCTTCAGG + Intronic
1165702713 19:37950715-37950737 CTGGGAGGGCTCGCAGCGGAGGG - Intronic
1166872182 19:45877340-45877362 CGGGGCAGGGTCGCAGCTGTGGG + Intergenic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
928158114 2:28894896-28894918 CTGGGCGCCAGCGCGGCTGCAGG + Exonic
929857789 2:45650929-45650951 CTGCCCGGGGTCGCAGCGGCGGG - Intergenic
932165204 2:69499065-69499087 CTGGGTCTGATAGCAGCTGCTGG - Intronic
938307081 2:130263719-130263741 CTGGGAGTGAGTGCAGCTGCAGG - Intergenic
943811728 2:192195673-192195695 TTGGGCTGGGTCGGAGCTGCGGG - Exonic
946163300 2:217848740-217848762 CTGGGCGGGACCTGAGGTGCTGG + Exonic
947347765 2:229210798-229210820 CTGGAGGGGACCGCTGCTGCTGG - Intronic
948656068 2:239477209-239477231 CTGGGAGGGTTGGCAGCTGTTGG + Intergenic
948937973 2:241180753-241180775 CTGGTCGGGACAGCAGCAGCAGG + Intronic
1168913283 20:1466928-1466950 GCGGGCGGGCTCCCAGCTGCTGG - Intronic
1171030901 20:21675545-21675567 CTGGGAGTGACTGCAGCTGCTGG - Intergenic
1175333432 20:58179763-58179785 CCGGGCGGGACCTCAGCTGCGGG + Intergenic
1175806876 20:61834385-61834407 CTGGGCTGGAGCACAGGTGCAGG - Intronic
1175877027 20:62235225-62235247 CTGGCCTGGCTGGCAGCTGCTGG - Intronic
1175970366 20:62683428-62683450 CTTGGCGGGACGGAAGCTGCGGG + Intronic
1179103416 21:38376778-38376800 CTGGACGGAGTCCCAGCTGCTGG - Intergenic
1179939632 21:44629141-44629163 GTGGGCGGCATCGCAGCCCCGGG - Intronic
1180736942 22:18024389-18024411 CTGGGCGGGATCGCAGCTGCAGG - Exonic
1181343939 22:22203464-22203486 CTGGGCAGCCTCGCTGCTGCTGG - Intergenic
1182572243 22:31248210-31248232 CTGGGCTGGATCGAGGCTGCAGG - Intronic
1183361865 22:37386988-37387010 CTGGGCAGGGTCACAGCTCCAGG + Intronic
1183732955 22:39628635-39628657 CTTGCCGGGGTCACAGCTGCCGG - Intronic
950644677 3:14369936-14369958 CTGGCCGGGACAGCATCTGCAGG - Intergenic
950726623 3:14921239-14921261 CTGGGCGGGAGCAGTGCTGCAGG - Intronic
951631482 3:24726082-24726104 CTGGGCATGATCTCAGCTTCAGG + Intergenic
953508072 3:43506518-43506540 CTGGGTGGCATGGGAGCTGCCGG - Intronic
953748774 3:45594298-45594320 CCGGCCGGGATCGCAGCTCCGGG + Intronic
961457627 3:127032008-127032030 CTGGGCCGGAGCTGAGCTGCAGG + Intronic
964041824 3:152269515-152269537 CCGGGCGGGATGGCAGCCCCGGG - Intronic
965900818 3:173639409-173639431 CTGGGCCAGACCTCAGCTGCTGG + Intronic
967823965 3:193863834-193863856 CTGGGCCTCATCGCAGATGCAGG + Intergenic
969647590 4:8441323-8441345 CGGGGCGGGATCGCAGCCAGAGG + Exonic
976175128 4:82344101-82344123 CTGGGCGTGGTGGCAGGTGCCGG - Intergenic
981474986 4:145179736-145179758 CTGGGTGGGGAGGCAGCTGCGGG - Intronic
984734867 4:183099418-183099440 CGCGGCGGGAACGCGGCTGCCGG - Exonic
987226624 5:15848522-15848544 CTGGGCGTGGTGGCAGGTGCTGG - Intronic
995462802 5:112420170-112420192 CTGGGCGGGGTATCAGCTGGGGG + Intergenic
998051776 5:139041987-139042009 CTGGGAGGGCTCACAGGTGCAGG - Intronic
998195048 5:140061487-140061509 CTGGGCGTGGTGGCAGGTGCCGG + Intergenic
999744796 5:154583991-154584013 CTGGGCAGGAACGCAGCTTTGGG - Intergenic
1000288394 5:159847304-159847326 CTGGGAGGGCTGGGAGCTGCTGG - Intergenic
1002126322 5:177047646-177047668 CTGGGCGTGGTGGCAGGTGCCGG - Intronic
1004297598 6:14427964-14427986 CTGGGCGTGGTGGCAGGTGCCGG + Intergenic
1006677761 6:35776592-35776614 CTGGGCGGCAGAGCAGCGGCGGG - Intronic
1006911419 6:37566023-37566045 CTGGGCGGGGTGGCGGGTGCTGG - Intergenic
1006933124 6:37699151-37699173 CGGGGCGGGATCGGAGGCGCGGG - Intronic
1010926579 6:81752496-81752518 CTGAGCGCGCTCGCAGCTCCTGG - Exonic
1017530589 6:155287977-155287999 CTGAGCTGGTTTGCAGCTGCTGG + Intronic
1019400690 7:851404-851426 CTGCGCAGGATCGGAGCTGTGGG + Exonic
1019411499 7:908731-908753 CGGGGAGGCATCGCAGCAGCGGG + Intronic
1019428025 7:986527-986549 CTGGGCGTGAACACAGCCGCTGG + Intronic
1022112974 7:27242890-27242912 CTGGGAGGGCGCGGAGCTGCTGG - Exonic
1022816784 7:33921717-33921739 CTGGGATGGGTAGCAGCTGCAGG + Intronic
1025296246 7:57777014-57777036 CAGGGCGGGATCCCAGCCTCAGG + Intergenic
1026895916 7:74010050-74010072 GTGGACGGGAACACAGCTGCGGG + Intergenic
1029159367 7:98540868-98540890 CTGGGCAGCATAGCATCTGCAGG + Intergenic
1030112325 7:106037587-106037609 CTGGGCAGGTTCCCTGCTGCAGG - Intergenic
1032128132 7:129209364-129209386 CTGAGTGGGAGCGCAGCTTCCGG + Exonic
1033570912 7:142627439-142627461 CTGGGGCGGAGGGCAGCTGCAGG - Intergenic
1035126805 7:156613807-156613829 CTGGGCGTGATGGGAGGTGCTGG + Intergenic
1035663535 8:1364215-1364237 CCGGGCTGGATCCCAGCTGTGGG + Intergenic
1037450798 8:19014008-19014030 CAGGGCGGGCGCGCGGCTGCGGG - Intronic
1037772807 8:21812325-21812347 CTTGCCGGGGTCTCAGCTGCTGG + Intronic
1039391073 8:37181084-37181106 CTGAGCAGGATCTCAGCTGCTGG + Intergenic
1042532776 8:69832625-69832647 CGGGGCGGGAGAGCAGCTGGAGG - Exonic
1049165700 8:141124395-141124417 CTGGGCAGGATCCAAGGTGCTGG - Intronic
1049181500 8:141225536-141225558 GTGGGCTGGGTCGCACCTGCAGG - Intronic
1049201923 8:141344511-141344533 CTGCCCGGGATTGCAGCTGCGGG + Intergenic
1049721039 8:144115679-144115701 CTGGTCGCACTCGCAGCTGCTGG + Exonic
1051513748 9:17907033-17907055 CTGGGCGGCAGCGCAGCCCCAGG - Intergenic
1052970175 9:34372551-34372573 CAGGGCGCCATCGCGGCTGCAGG + Exonic
1056539548 9:87559555-87559577 CTGGGAGGGCCCTCAGCTGCAGG - Intronic
1056931419 9:90880957-90880979 TTGGGCAGCATGGCAGCTGCGGG + Intronic
1061663078 9:132143368-132143390 CTGGCCGGGACCTCAGATGCTGG + Intergenic
1062052353 9:134454178-134454200 CTGCCCGGGATCACAGCCGCTGG + Intergenic
1189220504 X:39367828-39367850 CTGGGGAGCATCTCAGCTGCTGG - Intergenic
1190934549 X:54984962-54984984 CTGGGCGAGACAGCAGCTTCTGG - Intronic
1198880818 X:141279091-141279113 CAGGTCTGGATCGGAGCTGCAGG + Intergenic
1199768908 X:150961126-150961148 CTGGGCGTGGTGGCAGGTGCTGG + Intergenic
1200210016 X:154342912-154342934 CCGGGAGGGTTCCCAGCTGCTGG + Intergenic
1200220836 X:154389180-154389202 CCGGGAGGGTTCCCAGCTGCTGG - Intergenic