ID: 1180741705

View in Genome Browser
Species Human (GRCh38)
Location 22:18057597-18057619
Sequence AGGTGGTTATGGGTGCTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180741698_1180741705 2 Left 1180741698 22:18057572-18057594 CCCAGCCTAGGTTCACTTTTGCA No data
Right 1180741705 22:18057597-18057619 AGGTGGTTATGGGTGCTTAACGG No data
1180741697_1180741705 7 Left 1180741697 22:18057567-18057589 CCTCTCCCAGCCTAGGTTCACTT No data
Right 1180741705 22:18057597-18057619 AGGTGGTTATGGGTGCTTAACGG No data
1180741699_1180741705 1 Left 1180741699 22:18057573-18057595 CCAGCCTAGGTTCACTTTTGCAA No data
Right 1180741705 22:18057597-18057619 AGGTGGTTATGGGTGCTTAACGG No data
1180741700_1180741705 -3 Left 1180741700 22:18057577-18057599 CCTAGGTTCACTTTTGCAAAAGG No data
Right 1180741705 22:18057597-18057619 AGGTGGTTATGGGTGCTTAACGG No data
1180741696_1180741705 10 Left 1180741696 22:18057564-18057586 CCACCTCTCCCAGCCTAGGTTCA No data
Right 1180741705 22:18057597-18057619 AGGTGGTTATGGGTGCTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180741705 Original CRISPR AGGTGGTTATGGGTGCTTAA CGG Intergenic
No off target data available for this crispr