ID: 1180745716

View in Genome Browser
Species Human (GRCh38)
Location 22:18087648-18087670
Sequence TTTCCAAGGCTGCTTCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180745708_1180745716 23 Left 1180745708 22:18087602-18087624 CCCTGGTCTCCTAGTGGGGATGG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG 0: 1
1: 0
2: 3
3: 30
4: 246
1180745712_1180745716 14 Left 1180745712 22:18087611-18087633 CCTAGTGGGGATGGCATGAGGAC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG 0: 1
1: 0
2: 3
3: 30
4: 246
1180745710_1180745716 22 Left 1180745710 22:18087603-18087625 CCTGGTCTCCTAGTGGGGATGGC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG 0: 1
1: 0
2: 3
3: 30
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180745716 Original CRISPR TTTCCAAGGCTGCTTCAGAA GGG Intronic
902492791 1:16797378-16797400 TATCCAAGGCTTCGTAAGAAAGG - Intronic
903672853 1:25046722-25046744 TTTTCAAGGCTGCTACCAAAGGG + Intergenic
906127179 1:43434066-43434088 TTCTCAAGTCTTCTTCAGAATGG - Intronic
906246064 1:44275172-44275194 TTTCCAAGTTAGCTTCTGAATGG + Intronic
907195933 1:52686927-52686949 TTCCCAAGGCAGCTTCAGCTAGG - Exonic
907364718 1:53948557-53948579 TTTCCCAGCCTGCTACAGGAAGG - Intronic
908654548 1:66373911-66373933 TTTCCAAAACTGGTTCATAAAGG - Exonic
911173818 1:94798242-94798264 TTTTCAAGGCTGCTGCCAAAGGG - Intergenic
914849339 1:151302519-151302541 CTACCAAGGCTGATTCAGAATGG + Intronic
918475435 1:184919275-184919297 AATCCAAGGCTGCTTCAGGCAGG - Intronic
920280924 1:204843011-204843033 TTTCCTAGTCTGACTCAGAATGG - Intronic
920591082 1:207219542-207219564 TTTGCAGAGCTGCTTTAGAAAGG + Intergenic
921608267 1:217180043-217180065 TATCAAAGGCTGCTTCAGGCAGG - Intergenic
922000890 1:221477211-221477233 TTTTCAAGGCTGCTGCATCATGG - Intergenic
922597008 1:226821789-226821811 TTTCCAGGTGGGCTTCAGAAGGG - Intergenic
922632155 1:227126335-227126357 ACTGCAAGGTTGCTTCAGAAAGG + Intronic
922976172 1:229785273-229785295 ATTCCATGGTTGCTACAGAACGG + Intergenic
923527657 1:234785154-234785176 TATCCAAGGCTTCGTAAGAAAGG + Intergenic
923769884 1:236929330-236929352 ATTCCTAGGCTGCTTAAGATGGG + Intergenic
1062980262 10:1716422-1716444 TTTCACTGGCTGCTTCATAATGG - Intronic
1063262419 10:4405269-4405291 TTTGAAAAGCTGCTTCAAAAGGG + Intergenic
1063524291 10:6770158-6770180 CTTCCAAGGCTAGGTCAGAAAGG + Intergenic
1063536042 10:6884357-6884379 TTTCTTAGGCTTCTTCAGAATGG - Intergenic
1064283591 10:13972344-13972366 TCTCCAGTGCTGCTACAGAATGG - Intronic
1067524518 10:47030111-47030133 ATTCCAACCCTCCTTCAGAAAGG - Intergenic
1068802508 10:61158082-61158104 TTTTTAATGCTGCTTGAGAAGGG - Intergenic
1071931299 10:90474013-90474035 TTGGCCAGGCTGCTCCAGAATGG + Intergenic
1072008675 10:91284844-91284866 TCTTCAAGGCTGCTGCAGAATGG + Intergenic
1074245931 10:111693383-111693405 TTTCCTAAGCTGATTTAGAAAGG + Intergenic
1075510105 10:123065322-123065344 TTTTGGAGGCTGCTCCAGAAAGG - Intergenic
1075910119 10:126117347-126117369 TTTCCAGTGCTGCTGCAAAAAGG + Intronic
1078388415 11:10913371-10913393 TTTCCAAGGATGCTGTAGCATGG - Intergenic
1078524366 11:12089387-12089409 TTTCTAAGGATTCTTCAGTATGG + Intergenic
1078544559 11:12237635-12237657 TGTCCAGGGCTGTCTCAGAAAGG - Intronic
1080006450 11:27413091-27413113 TTTCCAAGGATACTTAAGAGGGG - Intronic
1080305447 11:30829962-30829984 CTTTCACAGCTGCTTCAGAATGG - Intergenic
1084056533 11:66637633-66637655 TTTCAAAAGCTGCTTCGCAAAGG + Intronic
1087214314 11:95479052-95479074 TTTCTAAGGAGGCTTCAGAGAGG + Intergenic
1087542851 11:99542948-99542970 TCTTCAAGGCTGCCTCATAAAGG + Intronic
1088841979 11:113635070-113635092 TTTCAAAGCCTGCTGGAGAAGGG - Intergenic
1089167037 11:116485330-116485352 TTTATGAGGCTGCTTCAGAAAGG + Intergenic
1089843053 11:121435425-121435447 TTTCCAAGCCTACCTCAGGAAGG - Intergenic
1090487691 11:127128736-127128758 CTTTCAAGGCAGCTTCAGAAGGG - Intergenic
1090901264 11:131033738-131033760 TTTCCAAGTCTGCTGCAAAGAGG + Intergenic
1091921240 12:4306578-4306600 ATTCCAAGGATGGTTAAGAATGG - Intergenic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1092472156 12:8789726-8789748 TTTTCAAGACTGCATCAGTAAGG + Intergenic
1092918077 12:13206261-13206283 TTTCCCTGGCAGCTTAAGAAAGG - Intronic
1093087850 12:14886433-14886455 TTTCCAAGGGTTCATCAGGATGG + Intronic
1093370233 12:18356234-18356256 TTGCCTAGGATACTTCAGAAGGG - Intronic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1094402706 12:30079458-30079480 TTTCAAAGGCAGATTCTGAAGGG + Intergenic
1095811830 12:46380378-46380400 CTTCCAAGGCTAGTTCATAAAGG - Intergenic
1096687031 12:53295010-53295032 TTTCCAAGGACAATTCAGAACGG + Intergenic
1097249922 12:57626870-57626892 TGTCCAAGGCAGCTTCAGTTTGG + Exonic
1099147230 12:79061925-79061947 TTACTAAGGCTTCTACAGAATGG - Intronic
1099929312 12:89055222-89055244 TTCCAAAGGGTGCCTCAGAATGG - Intergenic
1100643796 12:96508236-96508258 TTTGGAAGGCTGATGCAGAATGG - Intronic
1100664271 12:96733927-96733949 TTTCCAAGGCTAACTCAGCATGG - Intronic
1103282640 12:119772639-119772661 TTTCAAAGGGATCTTCAGAAGGG + Intronic
1104684156 12:130773515-130773537 TTCCCAAGGCTGCGTTAGCAGGG - Intergenic
1106401414 13:29434853-29434875 TTTGCAAGGCTGCTCTAGCAAGG + Intronic
1106410987 13:29511402-29511424 TTCCCCAGGCTGTCTCAGAAAGG - Exonic
1106639428 13:31567812-31567834 TTTTCAAGGCTACATCAGAGTGG - Intergenic
1110143341 13:72158761-72158783 TTTTCTAGGTTGCTTCAGCAAGG + Intergenic
1110449266 13:75623338-75623360 TTTCTAAGGCAGAATCAGAAAGG + Intronic
1111359067 13:87150215-87150237 CCTTCAAGGATGCTTCAGAAAGG - Intergenic
1112807375 13:103177945-103177967 TTTAGAAGGCTGATGCAGAAAGG + Intergenic
1117550292 14:56829038-56829060 TTTCCACCTCTTCTTCAGAAAGG + Intergenic
1118760928 14:68879792-68879814 TTTCCAAGGCTGGTTTTGCAGGG + Intronic
1120356351 14:83439117-83439139 TGTCTAACGCTGCTTTAGAAGGG + Intergenic
1121446551 14:93982543-93982565 TTCCCAAGGGTGATTCAGACAGG - Intergenic
1121479660 14:94254739-94254761 TTTCCATGGCTGTTTTAGAGAGG - Intronic
1122024311 14:98864084-98864106 TTTGCAAGGCTGTTTCAGGAAGG + Intergenic
1126647073 15:50885301-50885323 TTTACCAGGCTGATTCAGACCGG + Intergenic
1129269565 15:74412192-74412214 CTTCCAAGGCTGATCCAGAGAGG + Intronic
1129627857 15:77223230-77223252 CTTCCAAGTTTGCTTCAAAAGGG - Intronic
1129769061 15:78192181-78192203 TTGCCAAGGCTGCTGGAAAAGGG - Intronic
1130226843 15:82065629-82065651 TTTCCATGGCTGCTTTAGGTGGG - Intergenic
1131157377 15:90083555-90083577 TTTCCAAGGCTGCCTGAGTTTGG - Exonic
1132319817 15:100918032-100918054 ATTCCCAGGCTCCTTTAGAAGGG + Intergenic
1134809423 16:17154587-17154609 TTTCCCAGGCAGCCTCAGCAGGG - Intronic
1135544973 16:23359516-23359538 TGTCCAAGGCTGACTCAGGAAGG - Intronic
1137595636 16:49721664-49721686 TTTCCAAGGGTGCGCCAGAGTGG - Intronic
1139270613 16:65679370-65679392 CTTCCAGGGCTGCCTCAGAAAGG - Intergenic
1141175728 16:81717740-81717762 TTGCAAAGGCTGTTTCAGCATGG + Intergenic
1141229478 16:82151858-82151880 TTTCCAATTCTTTTTCAGAAAGG + Intronic
1141698546 16:85632101-85632123 TTTCCAAGGCCGCTTCAACCCGG - Intronic
1141700686 16:85640697-85640719 TTTCCGAGGCAGCGGCAGAAAGG - Intronic
1143163647 17:4886804-4886826 TTTGGAAGGCTGATTCAGACTGG - Intronic
1143652534 17:8272500-8272522 TTCCCAAAGCTACTTCAGTATGG - Intergenic
1146316801 17:31813690-31813712 CTCCCATGGCTCCTTCAGAATGG + Intergenic
1146602318 17:34228525-34228547 TTGCAAAGGCTGCTTCAGGAGGG - Intergenic
1147161173 17:38570180-38570202 TTTCCAGGGCTGTTTCTGACTGG - Intronic
1148492678 17:48033403-48033425 TTTCCAAGGGTTCTCCAGAAAGG - Intronic
1151452109 17:74204116-74204138 TTTCCGAGGCTGCAACACAAAGG - Exonic
1152219590 17:79055709-79055731 TTTCCAAGGCTGCTTGTGTGTGG + Intergenic
1154129004 18:11719761-11719783 TGTCCATGGCTGCTGCAGCATGG - Intronic
1155627177 18:27847775-27847797 ACTCCAAGGCTGCTGGAGAATGG - Intergenic
1156454580 18:37285730-37285752 TGTCCCAGGCTCCTGCAGAAAGG - Intronic
1158000706 18:52615171-52615193 TTTGGAAAGGTGCTTCAGAATGG + Intronic
1158937057 18:62374292-62374314 TTTTCAAGCATGATTCAGAATGG + Intronic
1159427688 18:68310701-68310723 TTTCAAAGGCTGTTTCACACAGG - Intergenic
1159677898 18:71309008-71309030 TTTCTGAGGCTGCTTCATATTGG - Intergenic
1160358565 18:78249678-78249700 TTTAAATGGCTGCTTAAGAATGG - Intergenic
1161410689 19:4115548-4115570 TTTCCAAGGCTGCTCCGGTTTGG + Intronic
1161504310 19:4635850-4635872 TTTCCAAGGCCGCTTGAGAAAGG - Intergenic
1164860564 19:31559063-31559085 TTTCCCAGGCTGCTGCAGAGTGG + Intergenic
1164993120 19:32698816-32698838 TTTCCAAGAATGCATCAGTAAGG - Intronic
1165123922 19:33580860-33580882 TTTCCAGGGATGCTTCGGCATGG + Intergenic
1165222446 19:34327983-34328005 TTTCCAGGGCTGCTGCAGCGAGG + Exonic
1165228331 19:34369745-34369767 TTACAAAGGCTGCTTCTGGAGGG - Intronic
1168353335 19:55688463-55688485 TTTCCAGGGCTTGTTGAGAATGG - Intronic
926365107 2:12125832-12125854 TCTCCAATGCAGCTTCACAATGG - Intergenic
926893614 2:17660238-17660260 TTCCCAAGGCTGGGCCAGAAAGG - Intergenic
927713368 2:25339316-25339338 TTTCCTAGGCTTCTCCAGGAAGG + Intronic
928433805 2:31240777-31240799 TTTTTGAGGCTGCCTCAGAATGG + Intronic
929823255 2:45290178-45290200 TTTCCAAGGCTCACTGAGAAGGG - Intergenic
930690118 2:54353507-54353529 TTTTCAAGGCTTCTGCAGAGGGG + Intronic
931689481 2:64823109-64823131 ATTCCAAGGCTGCTTCTGCCAGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932569522 2:72931321-72931343 TTTCCAAGTGTCCTTCAGGAAGG - Intronic
933333378 2:80922953-80922975 TTTCAAAACCTGTTTCAGAAAGG - Intergenic
933810761 2:86031453-86031475 TTTCCGGGGCTGCGTCAGGAGGG + Exonic
935226846 2:101060229-101060251 TTTGCAAGGCTGCTTAGGATTGG - Intronic
937070875 2:119062033-119062055 CTTAGGAGGCTGCTTCAGAAGGG - Intergenic
938838081 2:135128684-135128706 TTTTTGAGGCTTCTTCAGAAAGG - Intronic
938888769 2:135681310-135681332 TTCACAAGGCTGCTTGTGAAAGG + Intronic
938928786 2:136067753-136067775 TTACAAAGGCTGCTTCAAAAAGG + Intergenic
939575104 2:143886471-143886493 TTTTCCAGGCTCCTTCAGGATGG - Intergenic
939678878 2:145106218-145106240 TTGCCAAGGCTGGATCATAAAGG + Intergenic
941008024 2:160267316-160267338 TTCCCAAGCCTGTTTCAGATAGG - Intronic
941448692 2:165632886-165632908 TTTCTAAGGCTATTCCAGAAGGG + Intronic
942059574 2:172215735-172215757 TTTCCCAGGCTGCCTCTGCATGG + Intergenic
942228345 2:173836439-173836461 TTTCCCAGGCTGCTAAATAAAGG - Intergenic
942238513 2:173936423-173936445 TTTCAAAGGCTCCTTAAGTAAGG + Intronic
942870853 2:180732646-180732668 TTTCAAAGGATGCCTCAGAGAGG + Intergenic
943768695 2:191691814-191691836 TTTCCAATGCTGATGGAGAAAGG - Intronic
944036530 2:195301304-195301326 TTTCAAAAGCTGCTTCACAGGGG + Intergenic
944897266 2:204177877-204177899 CTTCCAAAGCTGCTTCAGGCAGG - Intergenic
945391775 2:209273573-209273595 TTTTTAAGGATGCATCAGAAGGG - Intergenic
945593387 2:211762490-211762512 TTTCCAGGTATGTTTCAGAAAGG + Intronic
947801602 2:232932011-232932033 TTTCCAAGGCCTCATTAGAATGG + Intronic
948086357 2:235252795-235252817 TGACCAATGCTGTTTCAGAAAGG + Intergenic
1169651087 20:7868213-7868235 CTGGCAAGGCTACTTCAGAATGG - Intergenic
1169830084 20:9815443-9815465 TTTGTAGAGCTGCTTCAGAAGGG - Intronic
1170480350 20:16759149-16759171 TTGCTAGGCCTGCTTCAGAAAGG - Intronic
1170824366 20:19781102-19781124 TTTACAAGGCTATTGCAGAAAGG + Intergenic
1170847110 20:19971671-19971693 TTTCCAAGGAAGCTTCAGCGAGG + Intronic
1171299585 20:24048591-24048613 TTTCAGAGGCTCCTTGAGAATGG - Intergenic
1171475558 20:25406157-25406179 TTTCAAAGGCGGTTTCAAAAAGG + Intergenic
1172170214 20:32925768-32925790 TTGCCATGGCTCCTTCTGAAGGG + Intronic
1173243165 20:41316225-41316247 TTTCCAAGGCAGCAACAGAAGGG + Intronic
1173353411 20:42265209-42265231 TTCCCAATGCTGGCTCAGAATGG + Intronic
1173364938 20:42376586-42376608 TTTCCATGGCCCCTTCTGAAAGG + Intronic
1176370600 21:6059695-6059717 TCTCCCAGGCTGCTGCAGCATGG + Intergenic
1178354036 21:31895663-31895685 TTTCAAAGGCTGCTTAAGCCTGG - Intronic
1179752919 21:43478846-43478868 TCTCCCAGGCTGCTGCAGCATGG - Intergenic
1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG + Intronic
1182513070 22:30833010-30833032 TTTCAAAGTTTGATTCAGAAAGG + Intronic
1183291483 22:37004309-37004331 GTTCCAAGGCTGCTTGAGATAGG - Intronic
1183688418 22:39375039-39375061 TGCCAAAGGCTGCTTCTGAAGGG - Intronic
1184607002 22:45579947-45579969 TTTTCAGGGCTGCTTCAGGCTGG - Intronic
1185347795 22:50318008-50318030 TCTCCAAGGCAGCCTAAGAAGGG + Exonic
949202578 3:1396386-1396408 TTTCCAACACTGTTTCACAATGG - Intronic
949986750 3:9547229-9547251 TTTCGAAGGCTGAGGCAGAAGGG - Intronic
951103760 3:18719483-18719505 TTTCCAAGGTCATTTCAGAAGGG - Intergenic
951462660 3:22968264-22968286 TTTCCAAGGATGACTGAGAAAGG - Intergenic
952710528 3:36427377-36427399 TTTCCAAGGCTGGCCCAGAGGGG - Intronic
954441866 3:50526450-50526472 TTTCCAAGGCTGCCTCAGCCAGG + Intergenic
954973507 3:54671735-54671757 TTTCCAGGGCTGCTTCAGCTAGG - Intronic
956168311 3:66413071-66413093 TAGCCAGGACTGCTTCAGAATGG - Intronic
957503518 3:81089744-81089766 TCTCCAAGGCTGTTTTACAAAGG + Intergenic
958473315 3:94549235-94549257 TCTTCAAGGCTGCCTCAGGAAGG + Intergenic
958667627 3:97160821-97160843 GTTTCAGGGCTGTTTCAGAAAGG + Intronic
962096078 3:132294440-132294462 TTTCTAAGTCTTCTTCAGTAAGG - Intergenic
962685654 3:137845219-137845241 ATTCCAAGGCAGCTTCAGAGAGG + Intergenic
963432388 3:145225002-145225024 TTTCCAAGACTGGATCGGAATGG + Intergenic
966216357 3:177507306-177507328 TATCCAAGGCTTCAGCAGAATGG - Intergenic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
969547885 4:7843846-7843868 GTTCCAAGGATGCCCCAGAAGGG - Intronic
970012448 4:11474320-11474342 CTTCTAAGGTTGCTTCAGCATGG - Intergenic
970033108 4:11700318-11700340 TTTGCAAGACTGTTTCATAAAGG + Intergenic
971468072 4:26987117-26987139 TTTGGAAGGCTGCTTCAGCTGGG + Intronic
972610343 4:40650397-40650419 TTTCTGGGCCTGCTTCAGAAAGG + Intergenic
973172427 4:47162328-47162350 TCTCCCAGGATACTTCAGAAGGG - Intronic
975720961 4:77248224-77248246 TCTACAAGGCTACTTCTGAATGG + Intronic
979011043 4:115368845-115368867 TTCCCAAGGCTGCTTTATACTGG + Intergenic
982473783 4:155825887-155825909 TTTCCAAGGATGTTTGGGAAGGG + Intergenic
982999927 4:162401520-162401542 TTTCCAAAACTATTTCAGAAGGG + Intergenic
984222355 4:176993875-176993897 TTTCCAAGGCTGTCTCACAGTGG - Intergenic
984553789 4:181190747-181190769 TTTGCAAAGCTGTTTCAGATAGG + Intergenic
985717044 5:1468457-1468479 GTTGCAAGGCTGCTTCAGAGGGG + Intronic
987370436 5:17187941-17187963 TTTCCAAAGCTACTAAAGAAAGG - Intronic
987443277 5:17984160-17984182 TTTCCAAGGCTACACCAGACTGG + Intergenic
987545419 5:19306015-19306037 TTTTCAAGGATGCATCAGTAAGG - Intergenic
987929708 5:24388478-24388500 TTTTCAAGAATGCTTCAGTAAGG + Intergenic
990039165 5:51358225-51358247 TTTCAATGTCTGCTTCAGAGGGG + Intergenic
990978793 5:61583122-61583144 TTTGCAAGACTGCTCCAGACAGG + Intergenic
991998668 5:72414268-72414290 TTTCTATGGCTGCTGTAGAATGG + Intergenic
992073553 5:73170745-73170767 TTTCCCAGGCTGCTCCAGTTAGG - Intergenic
994046022 5:95310591-95310613 TTTCCAAGTCTTCTTCAGATTGG + Intergenic
995555524 5:113324169-113324191 GTTCAGAGGCTGCCTCAGAAAGG - Intronic
996185683 5:120472065-120472087 TTGCAAATGCTGCTTCAGATTGG + Intronic
997648228 5:135495522-135495544 CTTCCAAGGCTGCGTCAGAAAGG - Intergenic
998512714 5:142727052-142727074 CTTCCAAGGATGATTAAGAAAGG - Intergenic
999314616 5:150575639-150575661 TTTTCAAGGCTGCCTGGGAAGGG + Intergenic
1004613316 6:17266685-17266707 CTTTCAAGGCTGCCTCCGAATGG - Intergenic
1006101976 6:31691118-31691140 TTTCCACGGCTGCTTCATGGAGG + Intronic
1008141149 6:47833811-47833833 TCTCCAAGACTGCTACAAAAGGG + Intergenic
1008246696 6:49183615-49183637 CTTCCAAAGTTGATTCAGAATGG + Intergenic
1009407880 6:63331774-63331796 TTTTCAAGGATGCATCAGTAAGG - Intergenic
1009872620 6:69469673-69469695 TTTTCAAGACTGCGTCAGTAAGG + Intergenic
1009931692 6:70183665-70183687 ATTCCCAGGATGTTTCAGAAAGG + Intronic
1010029129 6:71254794-71254816 TGGACAAGGCAGCTTCAGAAAGG - Intergenic
1011015634 6:82751599-82751621 TTTCTAAGGATGGTGCAGAAAGG - Intergenic
1011153685 6:84304402-84304424 TATCCAAGGCTGCAGCAGCATGG + Intergenic
1012393653 6:98771165-98771187 TCTCCCAGGAGGCTTCAGAAGGG - Intergenic
1013707481 6:112855189-112855211 TTTCCAAGGCAGGTTTGGAAGGG + Intergenic
1014277900 6:119407368-119407390 TTTCCTAGGCAGCTTCAGGATGG + Intergenic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1015800825 6:137060800-137060822 TTCTCAAGGCTGCTTCAAACGGG + Intergenic
1015929845 6:138348143-138348165 TTTCAAAGGCTGCTCTTGAAAGG + Intergenic
1016001759 6:139048935-139048957 TTTCCCAGGCTGATTCTGATGGG + Intergenic
1017616472 6:156251770-156251792 TGAGAAAGGCTGCTTCAGAAAGG - Intergenic
1019024869 6:168951019-168951041 TTTCCACGGCTGCCTCTGAACGG + Intergenic
1020085988 7:5310717-5310739 TTTCCAAAGCTGCTCTAGAATGG - Intronic
1020115386 7:5473300-5473322 GCTCCAGGGCTGCTGCAGAACGG - Intronic
1021499887 7:21320666-21320688 TTTCTAAGACTTCATCAGAATGG - Intergenic
1023997649 7:45171832-45171854 TTTCCATAGCTGTTGCAGAAGGG - Intronic
1025208321 7:57006434-57006456 TTTCCAAAGCTGCTCTAGAATGG + Intergenic
1025663628 7:63570444-63570466 TTTCCAAAGCTGCTCTAGAATGG - Intergenic
1025909755 7:65818868-65818890 GTTCCTAGACTGCTTCAGAAGGG - Intergenic
1026834111 7:73626862-73626884 TTTCCAAGGCTGCCACACATGGG - Intergenic
1028524675 7:91770306-91770328 TTTGGAAGGGTGGTTCAGAATGG - Intronic
1030665695 7:112275854-112275876 TTACCAAAGTTGCTTGAGAAAGG + Intronic
1032336598 7:131030531-131030553 TCTGCAAGGGTGCTTCAGAGTGG + Intergenic
1032638576 7:133738748-133738770 TCTCCAAGGATACTGCAGAAAGG + Intronic
1033483732 7:141767355-141767377 TTTTCAAGGCTGCCACAAAAGGG - Intronic
1033555662 7:142486793-142486815 TTTCCATGGCTGCTTAATTATGG - Intergenic
1033558051 7:142506298-142506320 TTTCCATGGCTGCTTAATTATGG - Intergenic
1033560510 7:142526319-142526341 TTTCCATGGCTGCTTAATTATGG - Intergenic
1035248158 7:157578556-157578578 TTTCGGAGGCTGCTTCTGACAGG - Intronic
1035591772 8:821814-821836 TTTCAAATCCTGCTTTAGAATGG + Intergenic
1035961580 8:4144145-4144167 TTCCCAAAGCTGTATCAGAAGGG - Intronic
1037925609 8:22841912-22841934 TTTCCAGTGCTGCTGCAGAAAGG + Intronic
1038490997 8:27971148-27971170 CTCCCAAGGCTGCATCTGAAAGG - Intronic
1043096856 8:75986214-75986236 TTTAAAAGGATGATTCAGAAAGG + Intergenic
1043138522 8:76558348-76558370 TTTCAAAGGATGCCTCAGAGAGG + Intergenic
1044386739 8:91598048-91598070 TTTCCAAGGCTGTTTTGGACAGG - Intergenic
1046034920 8:108829217-108829239 TTTTCAATGCTGCTTAAAAATGG - Intergenic
1046790919 8:118321210-118321232 TTTCCATGGTTCCTTGAGAAAGG + Intronic
1048371997 8:133786629-133786651 TTTCCAAGTCTTCTTCACCATGG - Intergenic
1049636874 8:143693812-143693834 TTCCCAGAGCTGCTCCAGAAAGG + Exonic
1050405745 9:5307001-5307023 TTTCTATGTCTGCTTCAGGAAGG - Intergenic
1051802759 9:20955015-20955037 ACTCAAAAGCTGCTTCAGAAGGG - Intronic
1052849854 9:33371250-33371272 TTACCCAGTCTGCTTCAAAAGGG + Intergenic
1053516339 9:38733770-38733792 TCTCCAGGGCTGCCTCACAAAGG + Intergenic
1055608238 9:77993963-77993985 TTTACAAAGCAGCTTCAGTAAGG - Intronic
1056295514 9:85189451-85189473 TCTCTAAGGCAGCTTAAGAATGG - Intergenic
1056303276 9:85263940-85263962 TTCACAAGGCTGTTTCAGACAGG + Intergenic
1056335087 9:85560412-85560434 TTTCAAAAGATGCTTCAGAGAGG + Intronic
1056481091 9:87007122-87007144 TTCCCAAGGCTGCTTGAGGATGG + Intergenic
1057005266 9:91551794-91551816 TATCCAAGGTTTCTGCAGAAGGG + Intergenic
1057165722 9:92923863-92923885 TTTCCATGGCTGTTTCCCAAAGG - Intergenic
1059517425 9:114908784-114908806 TTGCCAGAGCTGGTTCAGAAAGG + Intronic
1061045590 9:128163348-128163370 TTTCCCAGCCTGCTTCCCAAAGG - Intronic
1185740877 X:2531129-2531151 TTGCAAAGGCTGGTTCAGACTGG - Intergenic
1186695159 X:12022692-12022714 TTCCCAACTCTGCTTCAGATGGG - Intergenic
1189292968 X:39899024-39899046 CTTCCAAAGCTGTGTCAGAAAGG + Intergenic
1190775536 X:53549596-53549618 TCTCCAAGGAGGCTTGAGAAAGG + Intronic
1191202061 X:57793987-57794009 TTTCCAAGGCTTCATCAGAATGG + Intergenic
1191604456 X:63045316-63045338 TTTCCAAGGAAGCTTGAGAGAGG + Intergenic
1194359629 X:92933687-92933709 TTCCCCAGGCTGGTCCAGAATGG - Intergenic
1195877400 X:109556282-109556304 TTTCCTAGGCTGCTGCTGAAGGG - Intergenic
1198602929 X:138304258-138304280 TTTGAAAGACTGCTCCAGAAAGG + Intergenic
1199082280 X:143590504-143590526 TTTCAATGGCAGTTTCAGAATGG - Intergenic
1200667823 Y:6049510-6049532 TTCCCAAGGCTGGTCCAGAATGG - Intergenic
1201634091 Y:16103142-16103164 TTTCCAAGTCTGTTCCAGTATGG - Intergenic
1202039183 Y:20664890-20664912 TTTTTCAGGCTGCTTCAGGAAGG + Intergenic