ID: 1180748802

View in Genome Browser
Species Human (GRCh38)
Location 22:18110709-18110731
Sequence GCCCCCCGGCATCACAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180748802_1180748807 6 Left 1180748802 22:18110709-18110731 CCGGCACTGTGATGCCGGGGGGC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1180748807 22:18110738-18110760 GGGCCCGGCGCGCCTGTCCCCGG 0: 1
1: 0
2: 2
3: 22
4: 256
1180748802_1180748806 -9 Left 1180748802 22:18110709-18110731 CCGGCACTGTGATGCCGGGGGGC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1180748806 22:18110723-18110745 CCGGGGGGCAGCTGCGGGCCCGG 0: 1
1: 0
2: 2
3: 38
4: 576
1180748802_1180748811 22 Left 1180748802 22:18110709-18110731 CCGGCACTGTGATGCCGGGGGGC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1180748811 22:18110754-18110776 TCCCCGGCGTCCCCCCCTCCCGG 0: 1
1: 0
2: 2
3: 34
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180748802 Original CRISPR GCCCCCCGGCATCACAGTGC CGG (reversed) Intronic
900981193 1:6047265-6047287 GCCCCCCGGTAAGACACTGCAGG - Intronic
901212192 1:7533093-7533115 GCACCCGGGCACCACAGCGCTGG - Intronic
901606177 1:10461155-10461177 CCCCCTCGGCCTCCCAGTGCTGG + Exonic
901678446 1:10900111-10900133 GCCTCCCGGCCTCGCAGTCCTGG + Intergenic
902089677 1:13893202-13893224 GCCCCGCGGCGTCTCAGTCCAGG - Intergenic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
906678860 1:47711478-47711500 GGCAGCCGGCAACACAGTGCTGG - Intergenic
917511781 1:175674809-175674831 GCCCCCCAGCATCAATCTGCTGG + Intronic
918414426 1:184291913-184291935 TCCCCCTTGCAACACAGTGCTGG + Intergenic
1063871405 10:10421463-10421485 GTCCCCCAGCATCCCAGTTCTGG + Intergenic
1064220856 10:13439460-13439482 CCCACCCGGCAGAACAGTGCAGG + Exonic
1064321552 10:14310007-14310029 GCCCTCGTGCATCTCAGTGCTGG + Intronic
1067248349 10:44565565-44565587 GCACCCGTGCATCACAGTGATGG - Intergenic
1067315360 10:45156108-45156130 ACCCCTCAGCATGACAGTGCAGG - Intergenic
1069820024 10:71221646-71221668 GCACCCCAGCATCACAGGCCAGG - Intronic
1070559899 10:77558480-77558502 CACCCCCGACATCCCAGTGCTGG - Intronic
1076584366 10:131535156-131535178 TCTCCCCGGCATCACAGAGCCGG + Intergenic
1084227583 11:67726834-67726856 GCCTCCCGGCCTCAGAGTTCCGG - Intergenic
1084261005 11:67978527-67978549 GCCTCCCGGCCTCAGAGTTCCGG - Intergenic
1084747552 11:71182905-71182927 GCCTCTCTGCATCACAGTGTGGG + Intronic
1084834787 11:71794753-71794775 CTCCCACGGCATCACAGTCCTGG + Intronic
1084844728 11:71890038-71890060 GCCTCCCGGCCTCAGAGTTCCGG + Intronic
1085125725 11:74000952-74000974 GCCACCCAGCAACACAGAGCTGG - Exonic
1085738099 11:79056893-79056915 GCCCCCCGTCCTTACAGTACTGG + Intronic
1091753707 12:3038413-3038435 GCCCTCTGGCTTCACAGTGGAGG + Intronic
1092155344 12:6278650-6278672 GCCTCCCGGGAACACAGGGCAGG - Intergenic
1092432260 12:8419081-8419103 GCCTCCCGGCCTCAGAGTTCCGG - Intergenic
1095280268 12:40343113-40343135 GTCCCCAGCTATCACAGTGCTGG - Intronic
1095412180 12:41936386-41936408 GGCCCCAGGGAACACAGTGCTGG - Intergenic
1102646045 12:114404716-114404738 CCCGCCCGGCATCAGAGCGCTGG - Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1104380392 12:128302278-128302300 GACCACTGTCATCACAGTGCTGG + Intronic
1105274289 13:18905759-18905781 CCCCCCTGCCATGACAGTGCAGG - Intergenic
1112896652 13:104307202-104307224 GCCCCAGGGCTTCACTGTGCAGG - Intergenic
1113857592 13:113456535-113456557 GCCCCCCTGCAGCACTGTGCAGG - Intronic
1117038909 14:51752510-51752532 GCCTCCCGGCCTCAGAGTTCCGG + Intergenic
1119456897 14:74763752-74763774 GCCCCCCGGCATCACTGGCGGGG - Exonic
1122062118 14:99143090-99143112 GCCCCCCAGTTTCCCAGTGCAGG - Intergenic
1122828171 14:104382421-104382443 TACCTCCGGCATCACAGGGCCGG + Intergenic
1128682131 15:69659926-69659948 GGCCCCAGGCATCACATTCCTGG - Intergenic
1128768677 15:70266258-70266280 GCCCCTTGGCCTCACGGTGCTGG - Intergenic
1132670668 16:1101026-1101048 GCCCCCGGGCCTCAGAGGGCAGG - Intergenic
1133220461 16:4317213-4317235 GCCCCCAGCCATCACAGCCCAGG + Intronic
1134247213 16:12548767-12548789 TCCCCCAGCCACCACAGTGCTGG + Intronic
1136623073 16:31442879-31442901 GACCCCCGGCATCCTAGTCCTGG - Exonic
1139513453 16:67440162-67440184 GCCCCTCAGCATCACAGAGCAGG + Intronic
1141658158 16:85427115-85427137 GACCCCAGGACTCACAGTGCTGG - Intergenic
1142175392 16:88642829-88642851 GCCCCCCAGCATCAGTGTGGGGG + Intergenic
1143041763 17:4043453-4043475 TCACCCCGCCATCACAGAGCAGG + Intronic
1146263995 17:31439028-31439050 GCCCCCAGGAAGCTCAGTGCAGG - Intronic
1152374795 17:79913524-79913546 GCCCCCCAAGATCAGAGTGCAGG + Intergenic
1152487677 17:80605140-80605162 GCCCCAGGGCATCTGAGTGCTGG - Intronic
1152729337 17:81961881-81961903 GCCCCCCGGGATCAAAGCGGCGG + Intergenic
1154465984 18:14643013-14643035 CCCCCCTGTCATGACAGTGCAGG - Intergenic
1160583977 18:79902764-79902786 GCCCCCAGGCCTCAGAGTTCTGG - Exonic
1160627235 18:80219058-80219080 GCCCCCTGTCATCACAGGCCTGG - Intronic
1161034738 19:2078279-2078301 GCCCCCCGACATGACGGGGCAGG + Exonic
1161283936 19:3459343-3459365 GCCACCCAGCCTCACAGTGGGGG - Intronic
1162184178 19:8891864-8891886 GACCCACGGCATCACTGAGCTGG - Exonic
1163506399 19:17709657-17709679 GCTCCCTGGCATCCCAGAGCAGG + Intergenic
1165807173 19:38587554-38587576 GCCCCCCAGCATCACTGTGTTGG + Intronic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167933350 19:52886380-52886402 CCACCTCGGCATCCCAGTGCTGG + Intronic
926337807 2:11877350-11877372 GCCTCCCAGCCTCACATTGCTGG + Intergenic
926892407 2:17649769-17649791 TCCCCGCTGCAGCACAGTGCTGG + Intronic
935071510 2:99698373-99698395 GCCCCCCAGCACCCCAATGCTGG - Intronic
936283932 2:111166308-111166330 GCCCCTGGGCAGCACAGGGCAGG - Exonic
942186195 2:173427173-173427195 GCCCCCAGCCATGGCAGTGCTGG + Intergenic
944336188 2:198538193-198538215 GGCCCCTGGCTTCCCAGTGCTGG - Intronic
948093356 2:235314301-235314323 GCCCCCCACAATCACAGTGGGGG + Intergenic
948698171 2:239744247-239744269 GCCCACTGGCATCACGCTGCAGG - Intergenic
948874946 2:240821129-240821151 GCACCCCCGCACCGCAGTGCGGG - Intergenic
1170578134 20:17680256-17680278 GCCCCCCAGCTGCACAGGGCGGG + Intronic
1170590423 20:17767238-17767260 GCCCCCAGGGCTCACAGAGCTGG + Intergenic
1176149206 20:63580743-63580765 CCTCCCCAGCATCACAGTGCAGG - Intergenic
1176312090 21:5157119-5157141 GCCTCCCGCAAGCACAGTGCTGG + Intergenic
1176650238 21:9539335-9539357 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1176808601 21:13515582-13515604 CCCCCCTGCCATGACAGTGCAGG + Intergenic
1176966048 21:15213072-15213094 GGCACTCAGCATCACAGTGCTGG - Intergenic
1178561515 21:33642940-33642962 GGCCCCCGGCCTCCCAGTGCGGG - Intronic
1179844958 21:44104911-44104933 GCCTCCCGCAAGCACAGTGCTGG - Exonic
1179998228 21:44983819-44983841 GCCCCCAGGCGTCACGGGGCCGG + Intergenic
1180211118 21:46295909-46295931 GCCCCTCCCCAGCACAGTGCTGG + Intronic
1180748802 22:18110709-18110731 GCCCCCCGGCATCACAGTGCCGG - Intronic
1181580347 22:23824693-23824715 GCCTGCAGGGATCACAGTGCTGG - Intronic
1181855991 22:25781919-25781941 GTCCCACGGCCTCTCAGTGCTGG - Intronic
1181926359 22:26362262-26362284 GCCCCCTGGCATTCCAGAGCAGG - Intronic
1182129774 22:27842415-27842437 GCCCCCCGGAGTAAAAGTGCTGG + Intergenic
1182486670 22:30643229-30643251 GCCCGTCCGCATCACAGAGCAGG + Intronic
1184755643 22:46514435-46514457 GCCCCCGGGGATCAGAGTGCAGG - Intronic
1184765270 22:46569051-46569073 GCTCCCCGGGATCACAGGGAGGG + Intergenic
1185185706 22:49398385-49398407 CACAGCCGGCATCACAGTGCTGG - Intergenic
950719127 3:14870161-14870183 GCCCTAGGGCTTCACAGTGCGGG - Intronic
957044275 3:75361899-75361921 GCCTCCCGGCCTCAGAGTTCCGG - Intergenic
957076064 3:75604082-75604104 GCCTCCCGGCCTCAGAGTTCTGG - Intergenic
961278145 3:125743723-125743745 GCCTCCCGGCCTCAGAGTTCTGG + Intergenic
961778350 3:129306039-129306061 GGCCCCCGCCTCCACAGTGCAGG - Exonic
968462785 4:733574-733596 GCCCCCAGGGAGGACAGTGCAGG - Intronic
968747992 4:2370810-2370832 GGCGCCCAGCATCACAGTGTGGG - Intronic
968852405 4:3092267-3092289 GCCCCTCGGCCTCCCAGTGTTGG + Intronic
969729595 4:8946383-8946405 GCCTCCCGGCCTCAGAGTTCCGG + Intergenic
975361604 4:73477248-73477270 CCCCACCTGCATCACATTGCAGG - Intergenic
978735177 4:112076933-112076955 GCCCCACAGCATCTCAGGGCAGG - Intergenic
980077309 4:128307481-128307503 TCCCCCCACCATCACAGGGCTGG + Intergenic
983040462 4:162919361-162919383 GCCTCCCTGGATTACAGTGCTGG - Intergenic
984849789 4:184143690-184143712 GCCCCTCTGCAGCCCAGTGCGGG + Intronic
988610016 5:32714337-32714359 GCCCCTCGCCCTCACAGTGGTGG + Intronic
990533575 5:56697753-56697775 GCTCCCCTACAACACAGTGCAGG + Intergenic
993252845 5:85550351-85550373 GCACCCAGGCAACACAGTCCGGG - Intergenic
997831340 5:137153135-137153157 GGCCCCTGGCCTCACAGAGCAGG - Intronic
1002024668 5:176388830-176388852 GACCTCCGGAATCACAGGGCCGG - Exonic
1002193073 5:177488960-177488982 ACCCCCCAGCATCAGCGTGCCGG - Intronic
1002430270 5:179199325-179199347 TCCCCACGGCATCTCAGGGCAGG + Intronic
1010405712 6:75503692-75503714 GCTCCCCATCATCACAGTGGTGG - Intergenic
1011613700 6:89179013-89179035 GCCGTCCAGCATCGCAGTGCGGG + Exonic
1013520057 6:110924508-110924530 GCTCCCAGGCAACACAGTCCAGG - Intergenic
1018034013 6:159866615-159866637 GCTCCCCTGTATCACTGTGCGGG + Intergenic
1018992339 6:168683774-168683796 GCCGCCCCACATCACTGTGCTGG - Intergenic
1020987617 7:15156149-15156171 GCCTCCCGCCATCACCTTGCTGG - Intergenic
1023017409 7:35981849-35981871 GCTCCCCCTCATCCCAGTGCTGG + Intergenic
1023861451 7:44219771-44219793 GGCCCCGGGCAGCACAGTCCTGG - Intronic
1025276861 7:57589631-57589653 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1028007544 7:85593887-85593909 GCCCCCCCACTTCACTGTGCTGG - Intergenic
1029078063 7:97951343-97951365 GCCTCCCGGCCTCAGAGTTCCGG - Intergenic
1029270432 7:99374268-99374290 GCCCACCGGCATCAGCGTGAAGG + Intronic
1029274509 7:99396260-99396282 GCACCCAGGCAACACAGTCCGGG + Exonic
1033033331 7:137847173-137847195 TCCCCCCAGCCTCACGGTGCAGG - Intergenic
1034959927 7:155358812-155358834 GCCCCCCATCATCACAGGCCGGG + Intronic
1035737476 8:1898822-1898844 GCCCCGCGGCCCCCCAGTGCTGG - Intronic
1036261923 8:7247998-7248020 GCCTCCCGGCCTCAGAGTTCCGG - Intergenic
1036304669 8:7591554-7591576 GCCTCCCGGCCTCAGAGTTCCGG + Intergenic
1036313963 8:7706543-7706565 GCCTCCCGGCCTCAGAGTTCCGG - Intergenic
1036355518 8:8039546-8039568 GCCTCCCGGCCTCAGAGTTCCGG + Intergenic
1036833224 8:12037997-12038019 GCCTCCCGGCCTCAGAGTTCCGG - Intergenic
1041658997 8:60382775-60382797 CCACCTCGGCCTCACAGTGCTGG - Intergenic
1049006471 8:139858808-139858830 CCCCCCCGGATTCACAGTCCCGG - Intronic
1049543053 8:143217247-143217269 GCCCCACTGGAGCACAGTGCAGG + Intergenic
1052350635 9:27455272-27455294 GCCCCCTGACATCACAGGACAGG + Exonic
1052991193 9:34520312-34520334 GCCCCCCGCCTTCGCAGAGCTGG + Intronic
1056714132 9:89014281-89014303 GACCCCAGGGACCACAGTGCAGG - Intronic
1057260876 9:93582637-93582659 CCCCCCCGCCACCATAGTGCTGG + Intronic
1060823325 9:126673676-126673698 GCGCCCAGGAAGCACAGTGCTGG - Intronic
1061338817 9:129962216-129962238 GCCCCCAGGCCTCACAGGGCTGG - Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1203627979 Un_KI270750v1:42890-42912 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1189366452 X:40392730-40392752 GCACACAGGCATCACAGGGCTGG - Intergenic